ID: 1118966340

View in Genome Browser
Species Human (GRCh38)
Location 14:70589364-70589386
Sequence GAATGCAACTAGTAACAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118966340 Original CRISPR GAATGCAACTAGTAACAGTA TGG (reversed) Intronic
910213768 1:84820966-84820988 GAGTGCATCAAGTAATAGTAAGG + Intronic
911320492 1:96408385-96408407 GCATGAAACTAGTTGCAGTATGG + Intergenic
913294354 1:117304307-117304329 GAATGCAACCACTAAAAGAAAGG + Intergenic
921989725 1:221351465-221351487 AAATGGAACTACTAACAGAAGGG - Intergenic
922639298 1:227211109-227211131 AAATCCAACCAGTGACAGTAAGG + Intronic
1063812839 10:9733883-9733905 TCATGCAGCTAGTAACAGTTCGG - Intergenic
1068212927 10:53945077-53945099 TAATGCAAATAGTAACAATGAGG - Intronic
1068392404 10:56414820-56414842 GAAAACAACTAGTAACAATTAGG - Intergenic
1074918764 10:117985299-117985321 AAAAGCAACTAATAACATTATGG + Intergenic
1075634780 10:124023082-124023104 GAATACAACTAGGAAAAGTAGGG - Intronic
1077056235 11:594980-595002 GACTGCAAATTGTAACAGTATGG - Intronic
1077960809 11:7074731-7074753 GAATGCATCTAGGAAAAATAGGG + Intergenic
1078821651 11:14889550-14889572 CATTGCAGCTAGTAACAGTTTGG + Intronic
1080735621 11:35011000-35011022 GAATCCAACAGGTAACAGTGAGG + Intronic
1082143241 11:48634454-48634476 GAATGGACCTTCTAACAGTAAGG + Intergenic
1082570434 11:54731818-54731840 GAATGGACCTTCTAACAGTAAGG + Intergenic
1085914940 11:80875063-80875085 TAATGCAACTAATTGCAGTAAGG + Intergenic
1088499415 11:110468315-110468337 GAAAGCAACTATTCACAGTAAGG - Intergenic
1098005595 12:65993676-65993698 GAATGTAACTATTAAGAGAAGGG + Intergenic
1098913187 12:76231379-76231401 GAAAGCAAATATTAACAGAATGG - Intergenic
1100505886 12:95219334-95219356 GATGGTAACTATTAACAGTACGG + Intronic
1101507949 12:105364675-105364697 GAATTCAACTTGTAACACTAAGG - Intronic
1104055851 12:125229394-125229416 GAATGAACCTAGTGACGGTAAGG - Intronic
1104310702 12:127652132-127652154 AAGTGCAACTGATAACAGTAAGG - Intergenic
1105618645 13:22045677-22045699 GAATAAAAATACTAACAGTATGG + Intergenic
1108045174 13:46377044-46377066 GAGTGGAACTAGTAAGAGAAAGG - Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1111202658 13:84960997-84961019 GAAAGTAACTAGTAACAGGCTGG - Intergenic
1111344330 13:86929187-86929209 TAATGCAATAGGTAACAGTATGG - Intergenic
1113975102 13:114222032-114222054 GAATGATACTAGTTACAGAATGG + Intergenic
1114332730 14:21653684-21653706 GAATGAGACTAATAACAGGAAGG + Intergenic
1114696113 14:24629344-24629366 GAATGAAACTAGAATCAGGAAGG - Intergenic
1114839900 14:26251274-26251296 CAATGAAACTAGTAACACTATGG + Intergenic
1115712316 14:36063901-36063923 GAATGCAGCTTTTAAAAGTATGG + Intergenic
1116100735 14:40431540-40431562 GAATGAAACAAGTAAATGTATGG + Intergenic
1116688265 14:48071316-48071338 TAATCCAAGTAGAAACAGTAAGG + Intergenic
1118966340 14:70589364-70589386 GAATGCAACTAGTAACAGTATGG - Intronic
1121062249 14:90923552-90923574 GAATGCAAATAGTCCTAGTAAGG + Intronic
1123926756 15:25120911-25120933 AAAAGCAACAAGAAACAGTAAGG - Intergenic
1125382094 15:39097137-39097159 GAGTGCAACTAGCAAAAATATGG + Intergenic
1138826055 16:60321534-60321556 GAATGCAACTGATATCAGGAAGG - Intergenic
1140444893 16:75018241-75018263 AAAAGCTACTATTAACAGTAAGG - Intronic
1146980140 17:37152683-37152705 GAATGCAACTAATAAAAGAAAGG + Intronic
1147531134 17:41278916-41278938 GAATGTAACTAGTTAAGGTAAGG + Intergenic
1148431529 17:47647652-47647674 GAAATCCACTAGTCACAGTATGG + Intergenic
1148976080 17:51530008-51530030 GAGTACAACCACTAACAGTATGG + Intergenic
1157648936 18:49307451-49307473 GAATGTAAGTAGAAATAGTATGG - Intronic
1157910496 18:51613585-51613607 GAATTCAACGAGAAACAGCAGGG - Intergenic
927366043 2:22297649-22297671 AAATGCAAGTAGTAATATTATGG - Intergenic
927415379 2:22873988-22874010 GAATGAAACTATTAAGAGTTTGG + Intergenic
929147706 2:38721250-38721272 GAATGCAAATAGAAAGAGGAAGG + Intronic
931955044 2:67413743-67413765 CAATGCAAGTAGTAAAATTAAGG + Intergenic
934506734 2:94900327-94900349 GGATGCAAGTAATAACAGGAAGG + Intergenic
941737204 2:168991803-168991825 GAATTAAACATGTAACAGTAAGG + Intronic
942745867 2:179231773-179231795 CAAAGCAAATAGAAACAGTAAGG + Intronic
943927901 2:193811648-193811670 AAATGCAAGTATTAACACTAAGG + Intergenic
1170229764 20:14032514-14032536 AAATGCAAATAGTAACAGCAAGG - Intronic
1170451536 20:16489048-16489070 GAAAGCCATTAGGAACAGTAAGG + Intronic
1172688046 20:36772178-36772200 GAACTAAACTAGTAACAGTGAGG - Intronic
1173969806 20:47143772-47143794 GAATAGAACTAGTAACACAAAGG + Intronic
1175163078 20:57023142-57023164 GAATGCAACTATAAACAATATGG + Intergenic
1178446065 21:32643696-32643718 GTATGCAATTACTACCAGTAGGG + Intronic
959420705 3:106124702-106124724 GAATGAAACTAGAAAAAGAAAGG - Intergenic
960304750 3:116047332-116047354 GAAAGACACTAGGAACAGTAAGG - Intronic
960760476 3:121068780-121068802 GAATGCAAGTAGACATAGTAAGG - Intronic
960959293 3:123057912-123057934 AAATGTAACTATTAACAGAAGGG + Intergenic
965495102 3:169388511-169388533 AAAGGAAACTAGTAAAAGTAGGG + Intronic
965802151 3:172505351-172505373 GAATGTAACTAGTTAAGGTAAGG - Intergenic
968142445 3:196269724-196269746 AGATACAACTAGTAACAGGATGG + Intronic
971960796 4:33484641-33484663 GGATGAAATAAGTAACAGTATGG + Intergenic
973241077 4:47956322-47956344 GAATGCATCTAGCAGGAGTAGGG + Intronic
976048812 4:80985746-80985768 GAAGGCAACAGGTAACAGTCTGG - Intergenic
976601945 4:86945897-86945919 GAAAGCTACTATTAACAGTTTGG + Intronic
976866125 4:89729407-89729429 GAATGCCAGTAGTAATATTAAGG - Intronic
984397842 4:179223861-179223883 GAAAGTAACTACTGACAGTAGGG - Intergenic
986064386 5:4221489-4221511 AAATGCAAATAGTAATACTAGGG - Intergenic
986865308 5:11979888-11979910 GAATGCATCTAGTAAGAGGAAGG + Intergenic
991218657 5:64186260-64186282 GAATATATCTAGTAAGAGTATGG + Intronic
993189789 5:84667683-84667705 GAATTCCACCAGCAACAGTAGGG + Intergenic
998966787 5:147549603-147549625 GCATGCAACTATTGACAATAAGG - Intergenic
999648301 5:153740700-153740722 GTCTGCAACTAGCATCAGTATGG - Intronic
1010069970 6:71732446-71732468 TATTACAACTAGTAAAAGTAAGG + Intergenic
1011278519 6:85653594-85653616 CAATCCAACCAGTAATAGTATGG - Intergenic
1011864027 6:91798692-91798714 AAATGCAACAAATAACTGTAAGG - Intergenic
1018488784 6:164270818-164270840 GAGTGCAACTCCTAAGAGTATGG - Intergenic
1020736743 7:11959356-11959378 AAAGGCAACTAGGAAAAGTATGG - Intergenic
1024503406 7:50138848-50138870 AAATGCAAATAGTGACAGTACGG + Intronic
1027953936 7:84856057-84856079 GAATACCACTTGTAACTGTAGGG + Intergenic
1031273705 7:119689469-119689491 GAATTCTATTAGAAACAGTAAGG - Intergenic
1031342204 7:120616846-120616868 GAATGTAACTAAGAACAGAAAGG - Intronic
1034184794 7:149167131-149167153 AAATGCAACTTGTAACTGTTAGG - Intronic
1039670346 8:39589232-39589254 GAAAGCAGCCAGTAACATTAAGG - Intronic
1044126754 8:88468067-88468089 GAATGCAACTACAAACTGTTAGG - Intergenic
1044537714 8:93376232-93376254 TAGTTCATCTAGTAACAGTAAGG + Intergenic
1052011835 9:23420111-23420133 CAATATAACAAGTAACAGTATGG + Intergenic
1055192037 9:73536888-73536910 GCATGGAACTAGAAACAATAAGG + Intergenic
1056119872 9:83477078-83477100 GAATGCTGCTACTCACAGTATGG + Intronic
1059866031 9:118514720-118514742 TAATGCTATTAGTAAAAGTAGGG + Intergenic
1060451647 9:123747742-123747764 AAATGCAAATTGTAACATTAAGG - Intronic
1061944339 9:133900330-133900352 GAATGGAACTAGTGACAGGAGGG - Intronic
1187560526 X:20398720-20398742 GAATGCTACTAGTAACTAAAGGG - Intergenic
1188313571 X:28646773-28646795 GAATGAAAGGAGTAACAGTTGGG - Intronic
1194369385 X:93052897-93052919 TAAAACAACTAGTAACAGTGGGG - Intergenic