ID: 1118966850

View in Genome Browser
Species Human (GRCh38)
Location 14:70595092-70595114
Sequence CAACATCCATGGGCTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 2, 1: 6, 2: 13, 3: 24, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118966847_1118966850 -1 Left 1118966847 14:70595070-70595092 CCATGTATCAGTCTGTGGAGAGC 0: 1
1: 0
2: 10
3: 31
4: 138
Right 1118966850 14:70595092-70595114 CAACATCCATGGGCTCTGCAAGG 0: 2
1: 6
2: 13
3: 24
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118966850 Original CRISPR CAACATCCATGGGCTCTGCA AGG Intronic
900507104 1:3035150-3035172 CAGCATCCATGGGCCCAGCCAGG + Intergenic
902218891 1:14952107-14952129 CAGCAGCCATGGTCTCTGCAAGG + Intronic
905326793 1:37158652-37158674 CAACAGACATGGGCCCAGCAGGG - Intergenic
905405913 1:37732298-37732320 CAAAAAACACGGGCTCTGCAGGG - Intronic
907590228 1:55659644-55659666 CAACATAAATGTGCTCTGCCAGG - Intergenic
908401213 1:63774346-63774368 GAACATCCACGGGCTCTTCCCGG - Exonic
909412809 1:75374334-75374356 CAACCTCCTTGGACTCTGCCAGG + Intronic
909862752 1:80629720-80629742 AAACTTCCATGTGCTCTCCAGGG + Intergenic
910320777 1:85941230-85941252 CAACACCTATGAGGTCTGCATGG - Intronic
912396410 1:109347861-109347883 CAACATCCCTGGCCTCTACCCGG - Intronic
918276709 1:182959805-182959827 TGACATCCAGGGGCTCCGCAAGG - Intergenic
920077829 1:203350023-203350045 CAACAGCCCAGGGCTGTGCATGG - Intronic
922449302 1:225723937-225723959 CTGCAACTATGGGCTCTGCAGGG + Intergenic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063363903 10:5478377-5478399 AAACCTGCGTGGGCTCTGCAGGG - Intergenic
1065628334 10:27653616-27653638 CCACAACCAGGGACTCTGCAAGG - Intergenic
1069563118 10:69445260-69445282 AATCATCCATTGGCTTTGCAAGG - Intergenic
1069588326 10:69625632-69625654 CAACATTCATAGGCTGGGCATGG + Intergenic
1070218406 10:74412429-74412451 GAACATTCATGGGCTGGGCATGG - Intronic
1071462724 10:85913935-85913957 CACCATCCATGTGCACTGCCGGG + Intronic
1074790343 10:116880296-116880318 TAACTTTCATGGGCTGTGCAGGG - Intronic
1075327080 10:121542442-121542464 CCAGATCCATTGGTTCTGCAGGG - Intronic
1076850213 10:133088804-133088826 CAGCCTCCATGGCCTCTGGAAGG - Exonic
1077399555 11:2347235-2347257 CAACAGCCATGGCCTGAGCAGGG + Intergenic
1077563511 11:3281276-3281298 CCCCATCAATGGGCTCTGGACGG - Intergenic
1077842939 11:5994602-5994624 CGAAATCCATGGGCTCCACAAGG - Intergenic
1080427518 11:32169767-32169789 GAACATTCATGAGCTTTGCAAGG + Intergenic
1080430249 11:32191485-32191507 CAGCAGCCATGGGGTCTGCAAGG - Intergenic
1083915969 11:65744066-65744088 CAGCATCCCTGCGCTCTTCAGGG + Intergenic
1084016748 11:66387979-66388001 AAACAACCATGGGCTAGGCATGG + Intergenic
1085445706 11:76599347-76599369 CCACATCCCTGGGGTCTGCTGGG - Intergenic
1085951985 11:81343355-81343377 CAAAATCCCTGGGTTCTCCAAGG - Intergenic
1087187071 11:95211242-95211264 CAACTTCCAAGTGCACTGCATGG + Intronic
1090232012 11:125114109-125114131 CAACGTCCGTGGGCTCCACAAGG + Intergenic
1090829513 11:130411227-130411249 CCACCTAAATGGGCTCTGCAAGG - Intronic
1090998318 11:131886679-131886701 CAAGCTCCCTGGCCTCTGCAGGG - Intronic
1092196527 12:6552906-6552928 CGATATCCATGTGTTCTGCATGG + Intronic
1093442816 12:19219166-19219188 TCACATACATGGGCTCTGCAAGG + Intronic
1094400095 12:30053560-30053582 AAACACCCAAGGGCTTTGCAAGG + Intergenic
1095941930 12:47733054-47733076 CAAGATCCAAGTGCTCTCCAAGG + Intergenic
1096239756 12:49953523-49953545 CAACCTCCATAGGATGTGCAGGG + Intronic
1096634710 12:52950789-52950811 CGACATCCATGGGCTCCGCAAGG + Exonic
1097950237 12:65419459-65419481 CGACATCTATGGGCTCTGCAAGG - Intronic
1101111863 12:101494216-101494238 CAACATCAAAGAGCTGTGCAGGG + Intergenic
1101468988 12:104977479-104977501 TGACATCCATGGGCTCCGCAAGG - Intergenic
1102145148 12:110649683-110649705 CCACATCCCAGGGCTCTGCCAGG - Intronic
1103796459 12:123506410-123506432 CAACATGTAGGGGCTGTGCAAGG + Intronic
1104328525 12:127823066-127823088 CAGCAGCCAGGGCCTCTGCATGG + Intergenic
1104634179 12:130427405-130427427 CCGCATTCATGTGCTCTGCAGGG - Intronic
1106946551 13:34833817-34833839 CAACAACCAAGAGCTATGCAGGG - Intergenic
1108208696 13:48116961-48116983 CAACCTCCATAGACTCTTCAGGG - Intergenic
1110429904 13:75411826-75411848 AAACATCCGTGGGCTGGGCATGG - Intronic
1111581683 13:90230930-90230952 TGACATCCATGGGCTCTGCAAGG + Intergenic
1113100937 13:106717220-106717242 TTATATCCATGGGTTCTGCAAGG + Intergenic
1114412263 14:22512212-22512234 CCACATCCATGGACTGTGGAAGG + Intergenic
1116012409 14:39366721-39366743 CACCATCCAAGTGCTCTGCCAGG - Intronic
1118966850 14:70595092-70595114 CAACATCCATGGGCTCTGCAAGG + Intronic
1119407150 14:74406035-74406057 CCACAGCCCTGGGCTCTGGATGG + Exonic
1119760375 14:77146564-77146586 AAACAGCCAAGGGCACTGCAGGG - Intronic
1122329654 14:100903972-100903994 GAACATCCAGGGGCCCTCCAGGG + Intergenic
1122836832 14:104434656-104434678 TAAGTTCCATGGGCTTTGCAGGG + Intergenic
1127366858 15:58299413-58299435 TCACAGCCATGGGCTCTGAAGGG + Intronic
1129229536 15:74189114-74189136 CACCATCTGTGGGCTCTGGAAGG - Exonic
1130660262 15:85825880-85825902 CAAAATCCATGGGCCCTGTCTGG - Intergenic
1132321473 15:100928786-100928808 CCACATCCAGGGGCTTTGAAAGG - Intronic
1133180343 16:4049434-4049456 CAGCATCCTTGGGCTCGGCTAGG - Intronic
1133975201 16:10595627-10595649 CAAGTTCCAGGGGCTCTGCCTGG + Intergenic
1136019218 16:27429425-27429447 CTACATCAATAGGCTCAGCAAGG + Intronic
1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG + Intronic
1137044420 16:35642556-35642578 CAAGACCCATGTGCCCTGCAAGG - Intergenic
1137633302 16:49963669-49963691 AATCATGCATGGGCTCAGCACGG + Intergenic
1138204544 16:55115179-55115201 CAACCCCCATGGGCTCTGGGGGG + Intergenic
1139093845 16:63680866-63680888 CAACATCCATGTTCTTTCCACGG - Intergenic
1139547324 16:67655697-67655719 GAAGAACCATGGGCACTGCAGGG - Intronic
1140181962 16:72729154-72729176 TGACATCCATGGGCTCTGCAAGG + Intergenic
1141893668 16:86944808-86944830 GAGCATCCTTGGGCTGTGCAGGG - Intergenic
1142343977 16:89542234-89542256 CCACAGCCCTGGCCTCTGCAAGG + Intronic
1144103209 17:11962211-11962233 CTACATCCATGGCCTCTTCATGG + Exonic
1144517685 17:15930112-15930134 CACCCTGCAGGGGCTCTGCAAGG + Intergenic
1145871427 17:28276782-28276804 TGACATCCATGGGCTCCACAAGG - Intergenic
1149936340 17:60810705-60810727 GGACATCCATGGGCTCTGCAAGG + Intronic
1152239429 17:79153786-79153808 CAACATCCATGGTCCCAGCCGGG - Intronic
1153907865 18:9678975-9678997 TGACATCCATGGGCTCCGCAAGG - Intergenic
1153962033 18:10148049-10148071 CCACAACACTGGGCTCTGCAGGG - Intergenic
1156861249 18:41838768-41838790 AAACTTCCATGGGCTGGGCAAGG + Intergenic
1157729803 18:49993724-49993746 CAACTTCAATGGGCTCTCAATGG + Intronic
1158629693 18:59101199-59101221 CAACATGGATGGGCTTTGCCTGG - Intergenic
1160228959 18:77032141-77032163 CAAATTCCATGGTCTCTGCAGGG - Intronic
1160432362 18:78820350-78820372 CCACAGCGATGGCCTCTGCAAGG + Intergenic
1162550780 19:11357198-11357220 CTTCCTCCATGGCCTCTGCAGGG - Intronic
1164452992 19:28382715-28382737 CAAGGTCCTGGGGCTCTGCAAGG - Intergenic
1164477575 19:28587051-28587073 CAGCATCCAGGGGCTGTTCATGG + Intergenic
1166295657 19:41888064-41888086 CCATCTCCCTGGGCTCTGCAGGG - Exonic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
925152629 2:1625612-1625634 CCACATTCCTGGCCTCTGCAAGG + Intergenic
927285325 2:21351435-21351457 CAACATCCACAGAATCTGCAAGG - Intergenic
928495097 2:31823334-31823356 CGACATCCATGGGCTCTGCGAGG - Intergenic
929678892 2:43968296-43968318 TACCATCCATGGACTATGCAAGG + Intronic
931791394 2:65667004-65667026 CGACATCCATGGGCTCCGCAAGG + Intergenic
931986383 2:67746309-67746331 CAAAAACTATGGGCTCTCCAAGG - Intergenic
932743148 2:74307453-74307475 CGACATCCGTGGGCTCCACAAGG - Intronic
933695698 2:85215735-85215757 CAGCAGCCTTGGGCTCTGCCAGG - Intronic
936252437 2:110877015-110877037 CAACCTCCCTGGGCTGTGCCTGG + Intronic
936282062 2:111150627-111150649 AGACAGCAATGGGCTCTGCAAGG - Intronic
937609204 2:123840147-123840169 CAAATTCCATGGGATCTGCCTGG - Intergenic
937976032 2:127582566-127582588 CCAGATCCGTGTGCTCTGCATGG + Intronic
942600791 2:177639075-177639097 CAAGATCACTGGGCTCTGCCTGG + Intronic
942971373 2:181961917-181961939 TGACATCCATGGGCTCCACAAGG - Intronic
943548666 2:189311977-189311999 TGACATCCATGGGCTCCACAAGG - Intergenic
944382746 2:199130562-199130584 AAACATCAATGGGCTCTTCTGGG + Intergenic
944855728 2:203765025-203765047 CGACATCCATGGGCTCCACAAGG - Intergenic
944873289 2:203935433-203935455 CCACAGCCAAGGGGTCTGCAAGG - Intergenic
945528987 2:210926486-210926508 CTACAACCCTAGGCTCTGCAGGG - Intergenic
946524557 2:220504470-220504492 AAACATCCAGTGGCTATGCAAGG + Intergenic
948607624 2:239146318-239146340 AAACCCACATGGGCTCTGCAGGG + Intronic
1169258382 20:4116940-4116962 CAAAATAAATGGGCTGTGCAGGG - Intergenic
1171140087 20:22733528-22733550 CTACCTCCATGGGCTCTGCAAGG - Intergenic
1174349582 20:49957282-49957304 CGACATCCATGGGCTCTGCAAGG + Intergenic
1174454887 20:50641958-50641980 ACACATCCAAGGGCTCTGCAGGG - Intronic
1174471915 20:50767772-50767794 ACACATCCAAGGGCTCTGCAGGG + Intergenic
1176078712 20:63260993-63261015 CAGCAGCCACGGCCTCTGCAGGG + Intronic
1176145522 20:63563697-63563719 GGACATCGATGGGCTCTGCCAGG - Exonic
1178112631 21:29384068-29384090 CAAAATCCATTGTCTCGGCAGGG + Intronic
1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG + Intergenic
1179983699 21:44909837-44909859 CAGAATCCAGGGGCTTTGCAGGG - Intronic
1180836416 22:18931875-18931897 CAGGACCCATGCGCTCTGCAGGG + Intronic
1180887577 22:19258061-19258083 CGACATCCATGGGCTCTGCAAGG + Intronic
1181235509 22:21445798-21445820 CCAGATCCATGGGCTCATCAGGG - Exonic
1181426872 22:22849319-22849341 GAACACCCATGAGCTCTGGAGGG - Intronic
1182366369 22:29782137-29782159 CATCTCCCATGGGCTCTGGATGG - Intergenic
1182924416 22:34109063-34109085 CAATATCCATGTGCTCTTCAGGG - Intergenic
1183339843 22:37274083-37274105 CAATGTCCATGGGGTCAGCAAGG - Intergenic
1184448344 22:44567499-44567521 CAACATCCATGGACTCTGTAAGG + Intergenic
1184459211 22:44627736-44627758 GCACATGCATGGGCTCTGCGGGG - Intergenic
1203286508 22_KI270734v1_random:157174-157196 CAGGACCCATGCGCTCTGCAGGG + Intergenic
950494202 3:13324067-13324089 CCACATCCCTGGGAGCTGCAGGG - Intronic
951095478 3:18624876-18624898 CCACATCCATGGGGCTTGCAAGG - Intergenic
952146143 3:30534340-30534362 CAACTTCCATGGCCTGTGGATGG - Intergenic
952319138 3:32259477-32259499 TGACATTCATGGGCTCTTCAAGG + Intronic
952755250 3:36859906-36859928 CAACACCTAAAGGCTCTGCAAGG + Intronic
952847759 3:37702500-37702522 CAAAGGCCATGGGCTTTGCAAGG - Intronic
952933473 3:38377298-38377320 CAAGATCCATGGGTTCTTGATGG - Intronic
953514460 3:43576589-43576611 CAACATCTATTTTCTCTGCAAGG + Intronic
955126327 3:56115949-56115971 TAATCTCAATGGGCTCTGCATGG - Intronic
956275715 3:67498971-67498993 TCACATACATGGGTTCTGCAAGG + Intronic
957459658 3:80500144-80500166 CAACATTCATGGCATGTGCAGGG + Intergenic
959281622 3:104348537-104348559 CAACATCCAGTGGTCCTGCAGGG + Intergenic
961474627 3:127138865-127138887 CAACATTGCTGGGCTCTGCCAGG + Intergenic
964137550 3:153361955-153361977 CCACATCCATGTCCCCTGCATGG + Intergenic
965544711 3:169903696-169903718 CAACATCCGTGGGCTCTGCAAGG - Intergenic
967594881 3:191317089-191317111 CCACCCCCATGGGCTCTGCACGG - Intronic
968294364 3:197562501-197562523 CAACATGCAGTGGCCCTGCAGGG + Intronic
973218994 4:47704327-47704349 CAACATCCAAGCACTCAGCAGGG + Intronic
974786996 4:66631344-66631366 CAACATTCATAGTCTGTGCAGGG - Intergenic
976211220 4:82672368-82672390 TAATATCCATGGGATCTGTAGGG - Intronic
977350510 4:95879360-95879382 CAACATCAATAGGCTCCTCAAGG - Intergenic
979050253 4:115921228-115921250 CAACATACATGGGCTCCGCAAGG + Intergenic
980658133 4:135816409-135816431 CAAAGGCCATGGGCTCAGCAGGG + Intergenic
981217800 4:142191590-142191612 TTTCAACCATGGGCTCTGCAGGG - Intronic
981422961 4:144572235-144572257 TCTCATCCATGGGCTCTACAAGG + Intergenic
981467252 4:145087441-145087463 CAACCTCCTTAGGCTCTGCTAGG + Intronic
985100162 4:186450843-186450865 CAAAATCCATGGGATCAGCTGGG + Intronic
989012213 5:36885742-36885764 CGACATCCGTGGGCTCTGCAAGG + Intronic
990413420 5:55563518-55563540 AAACTTCCATGGGCTGGGCATGG + Intergenic
994906653 5:105847641-105847663 CAACATCCATGGGCTGCTCCTGG + Intergenic
995215342 5:109588844-109588866 CGACATCCGTGGGCTCCACAAGG + Intergenic
996349057 5:122518413-122518435 CAACATCCATGCCCTCTTCCTGG + Intergenic
997757341 5:136411523-136411545 CAACATCCAAGTGCTCTGTTGGG + Intergenic
1000979257 5:167799041-167799063 TAACATCCAAGGGGACTGCATGG + Intronic
1002258171 5:177974921-177974943 CAAGAGCCATGGGCTGGGCACGG - Intergenic
1002814698 6:668940-668962 CCATATCCATGGGTTCTGCATGG - Intronic
1003997127 6:11553155-11553177 TCACATACATGGGTTCTGCAGGG - Intronic
1004843458 6:19613270-19613292 CGACATCTATGGGCTCCACAAGG + Intergenic
1005224121 6:23621294-23621316 CATTATTCATGGGCTGTGCAAGG - Intergenic
1005761219 6:28969861-28969883 CGACATCCATGGGTTCCGCAAGG - Intergenic
1006456113 6:34132977-34132999 CAACATCCTTCGCCTCTTCAAGG - Exonic
1011242597 6:85288259-85288281 CGACATCCGTGAGCTCCGCAAGG + Intergenic
1012168770 6:95991602-95991624 CCACATTCATGGGCTCAGGAAGG + Intergenic
1014009247 6:116458048-116458070 CGACATCCATGGGGTCCACAAGG - Intergenic
1015512836 6:134056280-134056302 CCACATCAATGTGCACTGCAGGG - Intergenic
1017945832 6:159095643-159095665 CAACACCCAAGGGCACTGCAAGG - Intergenic
1018173247 6:161158626-161158648 CAACGTCCAGGGTCTCTGCAAGG - Intronic
1018866317 6:167749107-167749129 CAACTTCCATGGGCACAGCAAGG + Intergenic
1018882242 6:167895964-167895986 CATCATTCATGGGTTCTGGAAGG + Intronic
1020444332 7:8253717-8253739 ATACATACATGGGTTCTGCAGGG + Intronic
1024734412 7:52288824-52288846 CACCATACATGTGCTCTCCACGG + Intergenic
1025151821 7:56560869-56560891 CAACATATATGGGCTGGGCATGG - Intergenic
1026806346 7:73431511-73431533 CACCATCCCTGGGCTCAGCCAGG + Intergenic
1028540898 7:91941087-91941109 CGTCCTCCATGGCCTCTGCAAGG - Exonic
1028862682 7:95671365-95671387 AAACATTCATGGTCTCTTCAAGG + Intergenic
1028898034 7:96063944-96063966 CGACATCCATGGGTCCTTCAAGG - Intronic
1036559970 8:9893401-9893423 TAACATCCAGGGGCTTTTCACGG + Intergenic
1037471966 8:19219546-19219568 CATCTGCCATGTGCTCTGCATGG + Intergenic
1037844889 8:22274549-22274571 AGACATCCAAGGGCTCTGCATGG - Intergenic
1038416188 8:27397647-27397669 CCACCACCATGGGCTCTGCAGGG - Exonic
1038489434 8:27959282-27959304 CAACATCCATGGTCACAGCCTGG + Intronic
1039388683 8:37159421-37159443 TAACATCCATGTGCACTGCAAGG + Intergenic
1039866768 8:41511776-41511798 CAACATCCATGGGCTCTGCAAGG + Intergenic
1040127496 8:43754664-43754686 AAACATAAATGGGCTCTGAAAGG - Intergenic
1040764027 8:50884827-50884849 AAACATCCATGAACTTTGCAAGG - Intergenic
1042172018 8:66000693-66000715 CAACCTCCAAGTTCTCTGCAAGG + Intergenic
1044817360 8:96126741-96126763 CACCATCCAAGAGCTCTTCAAGG - Intergenic
1045852596 8:106720631-106720653 CAACATCAATTGTATCTGCATGG - Intronic
1046013309 8:108576183-108576205 CAACATTCATGGACTTTGCATGG + Intergenic
1048914852 8:139172772-139172794 ATACATACATGGGTTCTGCAGGG - Intergenic
1049441293 8:142610941-142610963 CTACACCCATGGGGTCTCCAGGG + Intergenic
1049586152 8:143433270-143433292 TTTCATCCATGGGCTCTGTAAGG + Intergenic
1049593589 8:143473462-143473484 CAGCATCCATGGGAGATGCAGGG + Intronic
1052613002 9:30800191-30800213 CGACATCCATGGGCTCTGCAAGG - Intergenic
1055370207 9:75590398-75590420 CCACTTCCATTGGCTCTCCAGGG - Intergenic
1055708858 9:79037137-79037159 AGACATCCATGGGCTCCACAAGG - Intergenic
1056447392 9:86679020-86679042 CAACAGAGGTGGGCTCTGCATGG - Intergenic
1056838417 9:89977094-89977116 CAGCATCCAGGAGCTCTACAAGG + Intergenic
1059325463 9:113501582-113501604 CCGCTTCAATGGGCTCTGCAAGG + Intronic
1060348605 9:122838083-122838105 TGACATCCATGGGCTCCACAAGG + Intergenic
1061589696 9:131590428-131590450 CTGCCTCCCTGGGCTCTGCAAGG + Intronic
1061841677 9:133362128-133362150 TCTCATCCATTGGCTCTGCAGGG - Exonic
1062312895 9:135948777-135948799 CAAGATCCAGGGCCTCTGGAAGG + Intronic
1062651997 9:137582653-137582675 CAACATCTGTGGGCGCTGCCAGG - Exonic
1187536134 X:20142960-20142982 CAACAAACATGGTCTCTGCCCGG - Intergenic
1191585439 X:62821322-62821344 AAACCTCGATGGGCTCTGAAAGG + Intergenic
1193041096 X:77004613-77004635 CCACATCCATGGCCCATGCAGGG + Intergenic
1194254928 X:91623984-91624006 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1194321983 X:92460203-92460225 CGACATCCATGGGCTCCGCAAGG + Intronic
1195968889 X:110453439-110453461 CAACAGCCATGGTCTCTGGAGGG + Exonic
1197977728 X:132183101-132183123 CACCATGCTGGGGCTCTGCAGGG + Intergenic
1200085881 X:153604788-153604810 CAACATCCATGGGCTTTGCAAGG - Intergenic
1200573712 Y:4863587-4863609 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1200630150 Y:5573680-5573702 CGACATCCATGGGCTCCGCAAGG + Intronic
1201502916 Y:14665175-14665197 CAACTTCAATGTGCTCTTCATGG + Intronic