ID: 1118968833 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:70614072-70614094 |
Sequence | CTAAGGCTACACCCCTGTCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 0 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
---|
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1118968833 | Original CRISPR | CTAAGGCTACACCCCTGTCT AGG (reversed) | Intergenic | ||