ID: 1118971596

View in Genome Browser
Species Human (GRCh38)
Location 14:70642222-70642244
Sequence GGGCTCCTCCGCCGCCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 436}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118971596_1118971601 -8 Left 1118971596 14:70642222-70642244 CCCGGGCGGCGGCGGAGGAGCCC 0: 1
1: 0
2: 3
3: 50
4: 436
Right 1118971601 14:70642237-70642259 AGGAGCCCCAGCGAGGGGCCAGG 0: 1
1: 1
2: 4
3: 54
4: 444
1118971596_1118971604 -3 Left 1118971596 14:70642222-70642244 CCCGGGCGGCGGCGGAGGAGCCC 0: 1
1: 0
2: 3
3: 50
4: 436
Right 1118971604 14:70642242-70642264 CCCCAGCGAGGGGCCAGGTCGGG 0: 1
1: 0
2: 2
3: 31
4: 287
1118971596_1118971608 1 Left 1118971596 14:70642222-70642244 CCCGGGCGGCGGCGGAGGAGCCC 0: 1
1: 0
2: 3
3: 50
4: 436
Right 1118971608 14:70642246-70642268 AGCGAGGGGCCAGGTCGGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 385
1118971596_1118971609 4 Left 1118971596 14:70642222-70642244 CCCGGGCGGCGGCGGAGGAGCCC 0: 1
1: 0
2: 3
3: 50
4: 436
Right 1118971609 14:70642249-70642271 GAGGGGCCAGGTCGGGGCGGCGG 0: 1
1: 0
2: 4
3: 80
4: 727
1118971596_1118971611 13 Left 1118971596 14:70642222-70642244 CCCGGGCGGCGGCGGAGGAGCCC 0: 1
1: 0
2: 3
3: 50
4: 436
Right 1118971611 14:70642258-70642280 GGTCGGGGCGGCGGCCGAGCCGG 0: 1
1: 1
2: 10
3: 90
4: 590
1118971596_1118971606 -2 Left 1118971596 14:70642222-70642244 CCCGGGCGGCGGCGGAGGAGCCC 0: 1
1: 0
2: 3
3: 50
4: 436
Right 1118971606 14:70642243-70642265 CCCAGCGAGGGGCCAGGTCGGGG 0: 1
1: 0
2: 1
3: 13
4: 202
1118971596_1118971602 -4 Left 1118971596 14:70642222-70642244 CCCGGGCGGCGGCGGAGGAGCCC 0: 1
1: 0
2: 3
3: 50
4: 436
Right 1118971602 14:70642241-70642263 GCCCCAGCGAGGGGCCAGGTCGG 0: 1
1: 0
2: 3
3: 39
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118971596 Original CRISPR GGGCTCCTCCGCCGCCGCCC GGG (reversed) Exonic
900098047 1:948350-948372 GGGCTCCTGGGCCCCAGCCCTGG + Intronic
900111310 1:1006775-1006797 CCACTCCTCAGCCGCCGCCCTGG - Intergenic
900368854 1:2322655-2322677 GGGCTCTTCCTCCGCCCGCCAGG - Intronic
900409963 1:2508013-2508035 GGGGTCCTCCCCCTCAGCCCAGG - Intergenic
900537583 1:3186437-3186459 TGTCTCCTTTGCCGCCGCCCGGG - Exonic
900793096 1:4692282-4692304 GGGCTCCTCACCCCGCGCCCTGG + Intronic
901045411 1:6393111-6393133 GGCCTTCCGCGCCGCCGCCCCGG - Intronic
901325181 1:8361157-8361179 GGGCTCCCCCACGGCCTCCCAGG - Exonic
901454446 1:9355055-9355077 GGGCTCATCCCCCGACCCCCGGG - Intronic
901628974 1:10639029-10639051 CGCCGCCTCCGCCGCCGCCTCGG + Exonic
901805497 1:11736171-11736193 GGGCACCTGCGCCGCAGCCGCGG - Exonic
902286052 1:15409602-15409624 GGGCTCCTCCCCCGCGGCTTGGG - Intergenic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
902585711 1:17437883-17437905 GCGCCCCTCCCCCCCCGCCCCGG - Intronic
902586067 1:17439123-17439145 GGGCTCTTCCCCCGTCGCCGGGG - Intronic
902823110 1:18955637-18955659 CCGCCCCTCCCCCGCCGCCCTGG - Intronic
902823310 1:18956429-18956451 GGGCTCCAGCGCGGCCGGCCGGG + Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903380747 1:22895515-22895537 CGGCTCCTCGGCCGCTGGCCTGG + Exonic
903778723 1:25808815-25808837 GGGCCCCTCCGCCCGAGCCCAGG + Intronic
904252931 1:29237667-29237689 GGGCCCCGCGGCCGCCGCCTCGG + Intronic
904652221 1:32014127-32014149 GGGATCCCCCTCCGCCTCCCCGG - Exonic
904782932 1:32964389-32964411 AGGCTCCGCCGCCGCCGCCGCGG + Exonic
905198981 1:36303837-36303859 AGGCTCCTCGGCCCCGGCCCCGG - Exonic
905449165 1:38046230-38046252 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
905990694 1:42335008-42335030 CGCCTCCTCGCCCGCCGCCCAGG + Intronic
906528700 1:46511194-46511216 GGGGTCCTCAGCCCCTGCCCTGG - Exonic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
907329867 1:53663804-53663826 GGGCTGCCCCGCCGCTGGCCTGG - Intronic
908187179 1:61663737-61663759 GGGTTTCTCTCCCGCCGCCCAGG + Intergenic
908527581 1:65002685-65002707 CGCCTCCGCCGCCGCCGGCCAGG - Intergenic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
913703292 1:121395926-121395948 GCCCTCCACCGCCGCCGCCACGG + Intergenic
915228763 1:154430361-154430383 GGGCCCCTCGGCCCCAGCCCTGG - Intronic
915238216 1:154501637-154501659 GGGCTCCTCCTCCGTGGCCCGGG + Exonic
915340253 1:155173412-155173434 GGCATCCTCGGCCACCGCCCTGG + Exonic
915636384 1:157189902-157189924 GGCCTCCTCAGCTGCCTCCCTGG - Intergenic
918015859 1:180632066-180632088 CTCCTCCTCCGCCGCCGCCGAGG - Exonic
919070689 1:192751496-192751518 GGGCAGCTCCGCCGCAGCCCTGG + Intergenic
919699798 1:200620523-200620545 GGACCCCTTCGCCGCCGACCTGG + Exonic
920071788 1:203307437-203307459 AGGCCCTTCCGCCCCCGCCCTGG + Exonic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920385631 1:205568900-205568922 AGGCGCCCCCGCCGCCGCCCGGG + Intronic
921029700 1:211326761-211326783 GCGCCCCTCCGCCCGCGCCCCGG + Intronic
921031099 1:211335868-211335890 GGTCACCTCTGCCGCCACCCTGG + Intronic
922503080 1:226110714-226110736 TGCCTCCTCCGCCCCCGCTCCGG - Intergenic
922505287 1:226122346-226122368 GGGCTCCTCCGCACCACCCCCGG + Intergenic
922648806 1:227318754-227318776 ATGCTCCGCCACCGCCGCCCGGG - Intergenic
922766243 1:228158092-228158114 CGCGCCCTCCGCCGCCGCCCGGG + Exonic
922821408 1:228487922-228487944 GCGCCTCTCCGCCCCCGCCCCGG + Intronic
924940887 1:248811935-248811957 GGGCTCCGCCGTCGCTGCCCCGG + Exonic
1063450064 10:6145123-6145145 GGGCGGCACCGCCGCAGCCCGGG - Intronic
1064622443 10:17229379-17229401 CCGCGCCACCGCCGCCGCCCAGG + Exonic
1069024146 10:63521669-63521691 GGGCTACCCCGTCCCCGCCCAGG - Intronic
1069474572 10:68721393-68721415 GAGCCCCACCGTCGCCGCCCGGG - Intronic
1069544490 10:69318812-69318834 CGGCTCCTCCCCCTCGGCCCGGG - Intronic
1069723600 10:70564183-70564205 GGGCTCCTGACCCGCGGCCCTGG + Intronic
1069768731 10:70883872-70883894 GGGCTCCTCAGCTCCCTCCCTGG + Exonic
1069822200 10:71235022-71235044 GGGCCCCTCCTCCCCCGGCCTGG + Intronic
1070305132 10:75235146-75235168 GGGCTACTCCGCCCTGGCCCTGG - Exonic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1071695295 10:87863517-87863539 CGCCCCCTCCGCCGCCGCGCCGG - Exonic
1072706925 10:97687446-97687468 GGGCGCCTCGGGCGCCGCGCGGG - Intergenic
1072719584 10:97772177-97772199 CGGCTCCCCTGCCGCAGCCCTGG + Intergenic
1072737572 10:97889327-97889349 GGGCTCCCCCACCGCCAACCTGG - Intronic
1072891606 10:99329723-99329745 GGGCCACGCCGCCACCGCCCGGG - Exonic
1073196436 10:101695145-101695167 AGCCGCCACCGCCGCCGCCCCGG + Exonic
1074866130 10:117545347-117545369 GGCCGGCTCCGCAGCCGCCCTGG - Intronic
1075254865 10:120917650-120917672 TGGCTCCTCCACCCCCACCCAGG - Intergenic
1075648660 10:124113083-124113105 GTGCTCCCCTGCCCCCGCCCGGG - Intergenic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076723982 10:132404916-132404938 GGGTGCCCCAGCCGCCGCCCAGG + Exonic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1076804236 10:132847211-132847233 GTGCTCCTCCGGGGCTGCCCTGG + Exonic
1076916003 10:133423442-133423464 GGCCGCTCCCGCCGCCGCCCCGG + Exonic
1077183205 11:1225490-1225512 GGACTCCTCCCCAGCCGCTCAGG - Intronic
1077503438 11:2919486-2919508 GGGCTCCCCAGCCTCCGCCGGGG - Intronic
1077916059 11:6612126-6612148 GGCCTCCGCCGCCTCGGCCCCGG - Exonic
1082928946 11:58579346-58579368 GGGCTCCTCCGGAGCCGCCTTGG - Exonic
1082928992 11:58579510-58579532 GGGCTGCTCCTCCGCCGGCGGGG - Exonic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083186590 11:61021439-61021461 GGGCTGCTCCACAGCAGCCCTGG + Intergenic
1083457170 11:62786933-62786955 GGCCGCCTCCGCCGCTGCCCCGG - Exonic
1083753666 11:64777984-64778006 CACCTCCTCCGCCGCCGGCCGGG + Exonic
1083879149 11:65539750-65539772 GGGCGCCCCAGCCGCGGCCCTGG + Exonic
1083883194 11:65558299-65558321 GGGCTCCTCTCCCGCGGCCGCGG + Intronic
1083902561 11:65650688-65650710 GGGCTCACCCACCGCCGACCTGG + Exonic
1084068473 11:66718917-66718939 GCCCTCCTCCGCCGCCCCGCAGG - Intronic
1085266803 11:75242162-75242184 GGGCTCCCGCGCCACCTCCCCGG + Exonic
1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG + Exonic
1085319802 11:75566992-75567014 GGGGTCCTCCTCCTCCTCCCAGG + Intronic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1088182734 11:107130191-107130213 GGGGTCCTGCTCCGTCGCCCAGG + Intergenic
1089520040 11:119057240-119057262 CGGCCCCGCCCCCGCCGCCCCGG + Intergenic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090185460 11:124736655-124736677 GGGCTCCTCCTCTGCCAACCAGG + Intergenic
1090645598 11:128764707-128764729 GGGCTCCACGGCTGCCGCTCAGG - Intronic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1092229006 12:6766642-6766664 GGGCCCCTCCGTCTCGGCCCCGG + Exonic
1092796044 12:12111058-12111080 GCGCGCCTCCTCCGCCGCCGCGG + Intronic
1093465070 12:19440200-19440222 TGCCGCCCCCGCCGCCGCCCTGG - Exonic
1093931128 12:24956086-24956108 CGCCCCCTCCGCCCCCGCCCCGG + Intergenic
1093958851 12:25251115-25251137 CCGCTCCTCCCCCGCCGGCCCGG - Intergenic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1096622688 12:52874336-52874358 GGGCGCGGCCGGCGCCGCCCTGG - Intergenic
1097850401 12:64404984-64405006 GCGCTCCTCGGCGGCGGCCCCGG - Intronic
1097929670 12:65169965-65169987 GGGCGCCTCCGCCGCCCCCGCGG + Exonic
1100330012 12:93572962-93572984 TGGCTCCTCCGCCGACCCCGCGG - Exonic
1100391734 12:94150076-94150098 GGGAGCCGCCGCCGCCGCCGAGG + Intronic
1100469054 12:94873827-94873849 CCGCGCCTCCGCCGCAGCCCGGG - Intergenic
1100611400 12:96194356-96194378 CCGCGCCTCCCCCGCCGCCCCGG - Intergenic
1100869313 12:98894530-98894552 GGCTTCCTCCGCCTCTGCCCCGG + Intronic
1101504235 12:105331184-105331206 GGGCTCCCCTGCAGCCGCCGGGG + Intronic
1101808178 12:108083266-108083288 GGCCTCCTCCCCTGCAGCCCAGG + Intergenic
1101941418 12:109101978-109102000 GGCCTGTTCCGCCTCCGCCCAGG + Exonic
1102256512 12:111418516-111418538 TGGCCCCGCCGCGGCCGCCCGGG + Exonic
1102277958 12:111598117-111598139 GGGAGCCCCCGCCGCCGCCTCGG + Intronic
1102495132 12:113314396-113314418 AGGCTCCTCCCCCTCAGCCCAGG - Intronic
1102678075 12:114672066-114672088 GGGCCCCGCGGCCGCCGCCATGG + Exonic
1102915730 12:116750378-116750400 GGGCTCCTCCTCTGAAGCCCAGG + Intronic
1102954082 12:117048292-117048314 GGGATCCACCCCCGCCACCCGGG + Intronic
1103096416 12:118136298-118136320 CAGCTCGTCCACCGCCGCCCCGG - Exonic
1104448841 12:128853532-128853554 CGGCCCCGCCGCCGCCGACCAGG - Exonic
1104623904 12:130337801-130337823 GGGCTCCTCTGGTCCCGCCCCGG + Intergenic
1104837189 12:131799292-131799314 AGGCTCCTCCGCCGCCCCCACGG + Intronic
1104862038 12:131929028-131929050 TCGCTCCGCCGCCGCCTCCCGGG - Intergenic
1105011768 12:132761407-132761429 TGGCCCCTCCGCCCCCGGCCCGG + Intronic
1105294228 13:19074173-19074195 GGGATCCTCCGCCTCCTTCCAGG - Intergenic
1105349447 13:19602255-19602277 GGCCGCTTCCCCCGCCGCCCGGG - Intergenic
1105437915 13:20392324-20392346 GGGCGCCCACTCCGCCGCCCCGG + Intergenic
1105578012 13:21670919-21670941 GGGCTCCTCGACTGCCTCCCAGG + Intergenic
1105617379 13:22030877-22030899 GGGCTCCTCAGCAGCCGGCTGGG + Intergenic
1106160065 13:27193512-27193534 GGGCTCAACCTCCGCCTCCCAGG - Intergenic
1106735836 13:32586914-32586936 GCCCGCCGCCGCCGCCGCCCCGG - Intronic
1107508631 13:41060444-41060466 GGGCTGCTCCCCCGCCCCTCCGG - Intronic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107605102 13:42048845-42048867 GGTCACCTCCGCCGCTGCCTCGG + Exonic
1110705921 13:78602143-78602165 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
1110874323 13:80490630-80490652 GGGCTCCTGTGCGGCCGGCCCGG - Intergenic
1110965488 13:81689963-81689985 GCGCGCCTCCTCCGCCGCCGCGG + Intergenic
1111292133 13:86184706-86184728 GGGCTCCACCCCTGCAGCCCTGG + Intergenic
1112402204 13:99086724-99086746 CGGCCCCTCCTCCGCCGTCCGGG - Intergenic
1113200769 13:107866242-107866264 GGAGTCCTCGCCCGCCGCCCAGG - Exonic
1113494011 13:110713891-110713913 GGGGGCCTGCGCCGCCGGCCGGG + Intronic
1113924018 13:113930373-113930395 GTGCTCCTGCGCCCCCGCCTCGG - Intergenic
1113924025 13:113930395-113930417 GTGCTCCTGCGCCCCCGCCTCGG - Intergenic
1113967460 13:114162151-114162173 TGGCTCCTCCTCACCCGCCCAGG + Intergenic
1116436234 14:44897681-44897703 GGGCGCCCCCGCCTCTGCCCGGG - Intronic
1117176687 14:53153029-53153051 AGGCGCCGCCGCCGCCGCCTCGG + Exonic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118627700 14:67674465-67674487 GGCCTCCTCCGCCGCCTCCTCGG - Exonic
1118752328 14:68816367-68816389 GGGCTCTCCCGTCGCCACCCCGG + Intergenic
1118752425 14:68816679-68816701 GAGCTCAGCCGCCGCAGCCCCGG - Intergenic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1119602510 14:75986005-75986027 GGGCTCCGCCGCTGCTGGCCTGG + Intronic
1119731445 14:76953710-76953732 GAGCTCCTCCGCCCCACCCCAGG - Intergenic
1119743142 14:77027048-77027070 GGGGGCCTCCGCCACCCCCCGGG + Exonic
1119775068 14:77243139-77243161 GGGCTCCACAGCCCCCTCCCAGG - Intronic
1121050438 14:90816329-90816351 AGGCCCCACCGCCGCCGCCGCGG + Exonic
1122221037 14:100239216-100239238 GGGCTCCGCCGCCACGGCCGCGG - Exonic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122558296 14:102592970-102592992 CGCCGCCTCCGCCGCCGCCTCGG + Exonic
1122631683 14:103110129-103110151 GGCCTCCGCACCCGCCGCCCCGG - Exonic
1123025537 14:105421936-105421958 GGGCCCCTCCGCCACAGCCTAGG - Intronic
1123041297 14:105491326-105491348 GCCCGCCTCCGCCGCGGCCCGGG - Exonic
1123173750 14:106398942-106398964 AGGCCCTTCCGCCACCGCCCGGG - Intergenic
1124247297 15:28081818-28081840 GAGCTCCACCGCCGGCGCGCCGG + Exonic
1124453700 15:29821977-29821999 GAGCGCCTCCGCGGCCGCCAGGG - Intronic
1124500373 15:30223085-30223107 GCCCTCCTCCGCCGCCTCCGGGG - Intergenic
1124743200 15:32315581-32315603 GCCCTCCTCCGCCGCCTCCGGGG + Intergenic
1125516427 15:40323715-40323737 GCGCTCCGCCGCCGCCTGCCCGG - Intergenic
1126070558 15:44861830-44861852 GGGCTTGGCCGCCGCCGCCATGG + Intergenic
1126087459 15:45023282-45023304 GGGCTTGGCCGCCGCCGCCATGG - Exonic
1128450752 15:67804712-67804734 GGGCCCCTCCCCCCACGCCCGGG - Intronic
1129666674 15:77583104-77583126 GGGCTCCTCCCCAGCCTCCCTGG + Intergenic
1130017963 15:80201967-80201989 GGGCTGCTCCTCCTCCGCCTCGG + Intergenic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132519822 16:381951-381973 GGTCCCCGCCGCCGTCGCCCCGG + Exonic
1132579064 16:676899-676921 GGGCCCCCCGGCCGCTGCCCCGG + Intronic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132589098 16:718602-718624 GGTCACCTCCAGCGCCGCCCTGG + Exonic
1132663865 16:1072990-1073012 GGGCTCTCCTGCCGCCGCCGGGG + Intergenic
1132767639 16:1542469-1542491 GGGCTCTTCTGCCTCTGCCCAGG - Intronic
1132799903 16:1746877-1746899 GAGCTCCTCTGCCGCCCACCGGG - Intronic
1132806218 16:1776291-1776313 GGGGTCCTCCCCCACCGCCCAGG - Exonic
1132850049 16:2020832-2020854 GGGCCCCTCCCTCGCCGACCAGG + Intergenic
1133188423 16:4116265-4116287 GGGCTCCCGCGACGCCGGCCGGG + Intergenic
1133220179 16:4316293-4316315 GGGCCCCCCCCCCCCCGCCCCGG - Intronic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1134163951 16:11915553-11915575 GGCCTCGGCCGCCGCCGCCAGGG + Exonic
1136239980 16:28937704-28937726 GGTGTCCTCCGCCTCCCCCCTGG - Intronic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136428113 16:30182921-30182943 GGGCTCCTCCTCCTTCCCCCAGG + Intronic
1136453961 16:30370106-30370128 CGGCCCCCTCGCCGCCGCCCCGG - Exonic
1136553283 16:30993090-30993112 GGGCTCCCCCGCCTACCCCCAGG + Intronic
1136666756 16:31819461-31819483 GGGCTCCTGGGACGCCCCCCGGG - Intergenic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1137531527 16:49281569-49281591 CAGCTCCGCCGCCGCCGCTCTGG + Exonic
1138478289 16:57284712-57284734 CGGCTCCGCCCCCGCCGCCGGGG + Intergenic
1138588206 16:57985159-57985181 GCGCTCATCCGCCCCCCCCCAGG - Intronic
1139403026 16:66696908-66696930 CGGCTCCTCAGGCCCCGCCCTGG + Intergenic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1141619269 16:85228167-85228189 GGGCTCCTCCGGCGGGGGCCGGG - Intergenic
1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG + Intergenic
1142567581 17:850627-850649 GGGCCCCCACGCCGCCCCCCTGG - Intronic
1142631585 17:1229417-1229439 CGGAGTCTCCGCCGCCGCCCCGG + Intergenic
1144339742 17:14301674-14301696 CGGCTCCTGCGCCGCCGCGCCGG + Exonic
1144447152 17:15341660-15341682 GGGCCACTCAGCGGCCGCCCCGG + Intergenic
1145018814 17:19414845-19414867 TGGTTCATCCGCCGCCTCCCTGG - Exonic
1145729050 17:27158678-27158700 GGCCTCCTCCGCCGTCTCCATGG + Intergenic
1146057698 17:29589437-29589459 AGGGGCCGCCGCCGCCGCCCGGG - Exonic
1147150267 17:38510188-38510210 CCGCTCCTCCGGCGCCGCCGGGG - Exonic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147971032 17:44219229-44219251 GGGCTCCTCCGCCAGCGGCCGGG + Intronic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148233038 17:45949201-45949223 GGGCTCCGCCGCCGCGCACCAGG - Intronic
1148664098 17:49361919-49361941 CGCCTCCGCCTCCGCCGCCCCGG + Intronic
1149556631 17:57578098-57578120 TGCCTCCTCCGCCCCTGCCCTGG + Intronic
1149634667 17:58157090-58157112 GCGCTCCTCCGCGGCCGCCTCGG - Intergenic
1150228649 17:63538022-63538044 GAGCTCCTCCGCGGCCCCACTGG - Intronic
1152240214 17:79157052-79157074 GGCCACCTCCACCGCCTCCCTGG - Intronic
1152617559 17:81345031-81345053 GGCCTCCTCGGACCCCGCCCAGG + Intergenic
1152798793 17:82321674-82321696 GGGCCCTTCCGCGGCAGCCCCGG - Exonic
1153900608 18:9614496-9614518 CCCCTCCTCCGCGGCCGCCCGGG + Exonic
1157613786 18:48975511-48975533 CGGCCCCTCCGCCGCCGTGCGGG - Intergenic
1157662749 18:49460266-49460288 GGGTCCCTTCGCCGCCGCCCCGG + Intronic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1159008590 18:63037199-63037221 GGGCCACCCCGCCCCCGCCCCGG + Intergenic
1160157004 18:76441927-76441949 GGGCCCCTCCGCCCCCTCCTCGG + Exonic
1160225606 18:77008757-77008779 GGGCTGCACCGCCGCGGGCCAGG - Intronic
1160454797 18:78992819-78992841 GGGCTCGGGCCCCGCCGCCCCGG + Exonic
1160501049 18:79401157-79401179 GGGCCCCTCTCCCGCTGCCCGGG + Intronic
1160518504 18:79491186-79491208 GGGCACCTCAGCAGCCACCCTGG + Intronic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160706345 19:531913-531935 GGGCCCCTCCGCCGCCGCCATGG + Exonic
1160853668 19:1206382-1206404 GGGCGTCTCCGGCGACGCCCCGG - Intronic
1160921802 19:1524151-1524173 CGACTCCTGCGCCGCCGCCGCGG - Intronic
1161175989 19:2842162-2842184 GGGCGTCTCCGCCCCCGCCGAGG - Intronic
1161265331 19:3361015-3361037 GCGCTCTTCCTCCGCCGCCCAGG - Intronic
1161400695 19:4065437-4065459 GGGCCCCCTCGCCGCTGCCCCGG - Intronic
1161778332 19:6275943-6275965 AGGCTCCTCCCCCTCCCCCCTGG - Intronic
1162013176 19:7830263-7830285 GGCCCCCTCAGCCGCCCCCCGGG - Intronic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162378319 19:10317718-10317740 GGGCTCCTGGGCCTCAGCCCCGG - Exonic
1162474593 19:10892407-10892429 GGGCTCCTCTGGCGCAGCCCTGG - Intronic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1163597078 19:18226388-18226410 GGGCCCCCCCGCGCCCGCCCCGG - Intronic
1164643562 19:29843273-29843295 GGCCTCCTCCGCCGCCAGTCCGG + Intergenic
1164835081 19:31350766-31350788 CCGCTCAGCCGCCGCCGCCCGGG - Intergenic
1165061440 19:33207054-33207076 GGGCCCTCCCGCCGCCGCCTCGG + Exonic
1165460280 19:35940130-35940152 GGGCTCGCCCGCCTCTGCCCTGG + Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167055733 19:47111079-47111101 TGGCTACTCCGTCGCAGCCCTGG - Intronic
1167258253 19:48443546-48443568 GGGCGCCACCGCCTCCACCCTGG + Exonic
1167638406 19:50667823-50667845 GGGCCCCCCAGCCGCCTCCCAGG - Exonic
1168056973 19:53869459-53869481 CGCCTCCACAGCCGCCGCCCAGG + Exonic
1168644698 19:58052587-58052609 GGGCGCTTCGGCCTCCGCCCTGG - Exonic
1168694409 19:58396565-58396587 GGCCGCCGCCGCCCCCGCCCGGG + Exonic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
926332499 2:11837083-11837105 GGGCTCCTCGGCTGCTTCCCTGG - Intergenic
929966757 2:46542624-46542646 GGGCCCCTCCCGCGGCGCCCCGG - Intronic
930096513 2:47570499-47570521 GGGCGCCTCCGCCTCCTCCCCGG + Exonic
932239063 2:70142782-70142804 TGCCTCCTGCGCAGCCGCCCTGG - Intergenic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
933133462 2:78701802-78701824 GGGCTCGCCCCCCGCCCCCCCGG - Intergenic
934079114 2:88452454-88452476 CGCCGCCACCGCCGCCGCCCCGG - Exonic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
936278566 2:111120184-111120206 GGGCGTCTTCGCCGCCTCCCGGG - Intronic
937361363 2:121232074-121232096 GTGGTCCTGCCCCGCCGCCCTGG - Intronic
937996977 2:127701611-127701633 GGGCTCCTCCGCCTTCTCCGCGG - Exonic
938422245 2:131154800-131154822 AGCCTCCTCCACCGGCGCCCGGG - Intronic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
940775065 2:157876237-157876259 GGTCTCCCCCGCCGCCCCCGGGG - Intergenic
941102227 2:161308714-161308736 GGGCTCCTCCCTCGCGGCCCAGG - Intronic
941902982 2:170695342-170695364 GGGCTGCTCTGCAGCTGCCCAGG - Intergenic
944457616 2:199911540-199911562 GCGCGCCGCCGCTGCCGCCCGGG - Exonic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
947641162 2:231708602-231708624 GCGCGCCTCCTCCGCCGCCGCGG + Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948129825 2:235592216-235592238 AGGCTCCTCCTCCACTGCCCTGG + Intronic
948473720 2:238203410-238203432 GGGCGCCGCCTCAGCCGCCCCGG + Intronic
948732905 2:239978417-239978439 AGGCTCCTCTGCTGGCGCCCAGG + Intronic
948801564 2:240435641-240435663 CGCCTCCCCCGCCGCCGGCCCGG - Intergenic
948865962 2:240775011-240775033 GGACTCCCCTGCCCCCGCCCTGG + Intronic
948933804 2:241149649-241149671 GGGCGCCTCCGCCCCCGGGCCGG + Intronic
948953840 2:241272426-241272448 GGGCTCCCCCGCCTCCTCCCGGG - Intronic
948984022 2:241509014-241509036 AGGATCCACCGCGGCCGCCCAGG + Intronic
949060500 2:241953802-241953824 GGGCACCTCCGGCTCCTCCCTGG - Intergenic
1168777859 20:462591-462613 AGCCTCCCCCGCCGCCGGCCGGG - Intergenic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1170674521 20:18467006-18467028 CTCCTCCTTCGCCGCCGCCCGGG + Exonic
1170991251 20:21303541-21303563 GGGCTCCGCCGCCTGCCCCCGGG + Intronic
1172275021 20:33674553-33674575 GGGCGCCTCCCCCTCCGCCGTGG - Intergenic
1172661931 20:36574118-36574140 GGGCCCCCCCGCCGCCGAGCCGG + Intronic
1174276414 20:49407772-49407794 GGGCTTCTCAGCCTCCGCACTGG - Intronic
1175715823 20:61253410-61253432 CCGCCCCTCCGCCTCCGCCCAGG - Intronic
1175847302 20:62065541-62065563 GGGCGGCTCCGGCGCCGCTCCGG + Exonic
1176206557 20:63891780-63891802 GAGCTCCTCCTCCGCCTCCTGGG - Intergenic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1178351117 21:31873573-31873595 GGCTTCTCCCGCCGCCGCCCTGG - Exonic
1178493852 21:33070948-33070970 GGCCGCCTGCGCCGCCGCCGGGG - Exonic
1178992480 21:37367197-37367219 AGGAGCCGCCGCCGCCGCCCGGG + Intronic
1179674987 21:42974965-42974987 AGGCGCCGCCGCCGCCGCGCTGG + Intronic
1180071778 21:45440400-45440422 GGGCTCCTCAGGCCCTGCCCAGG + Intronic
1180189470 21:46155578-46155600 GTGCTCCGCAGCCGCCGCCAGGG + Intronic
1181478271 22:23181463-23181485 GGGCTTCTCGGCGTCCGCCCCGG - Exonic
1181852975 22:25763127-25763149 TGTCTCCTCCGCCCCCTCCCAGG + Intronic
1182236912 22:28883501-28883523 GGCCTCCGCAGCCGCCGCCGTGG - Intergenic
1182585387 22:31341749-31341771 GGGCTCCTCCTACTCTGCCCGGG + Intronic
1183095794 22:35551611-35551633 GGGCAGCTCCGCCGCCTCCTTGG - Exonic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1183486184 22:38088887-38088909 TGGCGCCCCCGCCGCCGCCCGGG + Exonic
1184228274 22:43143199-43143221 GGGCGCCTCCTCCTCCGCCCCGG + Exonic
1184676298 22:46045105-46045127 GGGCTCCTCGGCCGCTGCACCGG + Intergenic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1184859524 22:47165292-47165314 GGGCTCCTCTGCCACCTCCCAGG + Intronic
1185129766 22:49032329-49032351 GGGCTCCTACGCACCCTCCCTGG - Intergenic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
1185313795 22:50170389-50170411 GGTGCCCCCCGCCGCCGCCCCGG + Intergenic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
949260512 3:2098893-2098915 GGGAGCTTTCGCCGCCGCCCCGG + Intronic
951217700 3:20040420-20040442 AGGCGCCGCCGCCGCCGCCAGGG - Exonic
955721657 3:61888357-61888379 GGGCTCTTCCTCTGTCGCCCAGG + Intronic
956326609 3:68059909-68059931 GGGCTCCCCAGCTGCCTCCCAGG - Intronic
956677974 3:71753533-71753555 GGGCGCCTCCGCAGCAGCCGCGG - Intronic
958785549 3:98593399-98593421 GGAGCCCTCCGCCGCCGCACTGG + Exonic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961013414 3:123449850-123449872 GGCCGCCTCCGCCCCCGGCCTGG + Intergenic
962263178 3:133927704-133927726 CCGCCCCTCCGCCGCGGCCCGGG - Intergenic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
964801632 3:160565019-160565041 GGCCTGCTCCGCCTCCGCCGGGG - Intronic
967055619 3:185826086-185826108 GGCTTTCGCCGCCGCCGCCCGGG - Intergenic
967142246 3:186570836-186570858 AGCCTCCTCCGCCGCCGCGTCGG - Exonic
968258308 3:197298387-197298409 GGGCTCCTCCAGGGCCACCCCGG - Intronic
968509583 4:989536-989558 GGGCTCATCCGCCACAGCCGCGG + Exonic
968659642 4:1793711-1793733 GCCCGCCGCCGCCGCCGCCCAGG - Intronic
969565103 4:7972662-7972684 GGGCTCCCCCGCCACTGTCCTGG + Intronic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
971327857 4:25658669-25658691 GGGCTCCCCCGCTGCCACACTGG - Intronic
972396658 4:38664107-38664129 GGGAGCCGCCGCGGCCGCCCGGG - Intergenic
976390018 4:84497707-84497729 GCCCGCCGCCGCCGCCGCCCGGG - Exonic
976431241 4:84966002-84966024 GGGAGCCGCCGCCGCCGCCAGGG - Intronic
978126964 4:105146613-105146635 GGCCTCCTCCCGCTCCGCCCCGG - Exonic
978126972 4:105146634-105146656 GGCCTCCTCCTGCTCCGCCCCGG - Exonic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
981061184 4:140427234-140427256 GTGCTCGTCCGCCCCAGCCCGGG + Intronic
982745860 4:159103586-159103608 GGGCGCCTCGGCCGCCGGTCGGG - Intergenic
985025807 4:185737900-185737922 GTGCCCCTCCGCCTCCTCCCTGG - Intronic
985782190 5:1877085-1877107 GGGCTCCCACGCCCCCCCCCGGG + Intergenic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
990825429 5:59893356-59893378 CGCCGCCCCCGCCGCCGCCCGGG - Exonic
991198050 5:63959368-63959390 GGGTTCCTCCGCCTACGCTCTGG - Intergenic
992042452 5:72848763-72848785 GGGGCCCCCGGCCGCCGCCCGGG + Intronic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
995206588 5:109487803-109487825 GGGCAGCTCCGCCTGCGCCCTGG - Intergenic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
998366832 5:141637465-141637487 GATCGCCTCCGCAGCCGCCCTGG - Exonic
998517707 5:142770714-142770736 GCGCGCCTCCGCCGGGGCCCGGG - Exonic
1000014692 5:157266441-157266463 CGGCTCCCCCGCCGCCGCGCCGG - Intronic
1001823043 5:174724751-174724773 GCGCTCCTCCGCGGCCCCCTCGG - Exonic
1001826672 5:174751166-174751188 GGGCTCCCCCGACCCCGCCCTGG + Intergenic
1002029303 5:176416298-176416320 GTCCTCCTCCGCCGCCTCCGGGG + Exonic
1002166604 5:177351565-177351587 GGGCTTCTCGGCCCCGGCCCTGG - Exonic
1002456027 5:179345695-179345717 GCGCTTCTCTGCCGCCGCCTCGG - Intergenic
1002484077 5:179522996-179523018 GGGCTCATCAGCCGCCTTCCTGG + Intergenic
1002500488 5:179644485-179644507 GGGCTCATCAGCCGCCTTCCTGG - Intronic
1002559474 5:180071775-180071797 GCGCGCTCCCGCCGCCGCCCGGG - Exonic
1002691398 5:181053070-181053092 GGGCGCCACCGCAGCCGCCTGGG - Intronic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003139183 6:3456837-3456859 GGGCTCGGCAGCCGGCGCCCGGG - Intronic
1003418914 6:5938438-5938460 GGGCTCCTCCGCTGAAGCCTGGG - Intergenic
1004720429 6:18264162-18264184 CCGCTCCGCCGCCGCCGTCCAGG + Intronic
1004864287 6:19837912-19837934 CGGCTCGTCGGCCGCCGCCTCGG - Exonic
1006725402 6:36196504-36196526 AGGCGCCGCCGCCGCCGCCACGG - Intergenic
1007385450 6:41517431-41517453 GGGCTCCTGCCCAGCTGCCCTGG + Intergenic
1007451140 6:41941081-41941103 GGGCTCGGCCGCCCCCGCCCGGG - Intronic
1008649068 6:53544948-53544970 GGGGTCCGCCGCCGCCGCATCGG - Exonic
1011195067 6:84772964-84772986 GGGCTCCGCCGCGGGAGCCCGGG + Intergenic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1013538774 6:111087631-111087653 GGGCTCCGCCGCCCTCGCCTCGG + Exonic
1014230367 6:118895250-118895272 GTCCTCCTCGGCCGGCGCCCGGG + Intronic
1015785872 6:136921669-136921691 GGGTTCCTCCTCCGATGCCCGGG + Intergenic
1016936314 6:149451312-149451334 GGGCTCCTGCGGAGCCGCCCGGG + Exonic
1016949447 6:149566256-149566278 GCGCCTCTCCGCGGCCGCCCGGG + Intergenic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1017877404 6:158536416-158536438 GCGCCCATCCGCCGCCGCCCCGG - Exonic
1019104880 6:169660041-169660063 GGCCTCCTCGGCGGCCTCCCGGG - Intronic
1019305614 7:333001-333023 GGGCTCCAGGGCCGCCTCCCCGG - Intergenic
1019366406 7:635600-635622 GGACTCCTCCGCTGCCTCCCAGG + Intronic
1019686306 7:2384023-2384045 GGGCTCCCCAGCCCCCTCCCTGG + Intergenic
1020106106 7:5423141-5423163 GGGCTCCCCCGCCGCCTGCTGGG + Intronic
1020461386 7:8433649-8433671 CGGCTCCCCCGCCTCCGGCCCGG + Intergenic
1022207590 7:28179741-28179763 GGGCCCCTCGGCCGCCTCCCAGG + Intronic
1022410341 7:30135019-30135041 GGGCTCCTCCGGGGCCGGGCTGG - Exonic
1023705906 7:42941650-42941672 GGGCTTCTCTCCCTCCGCCCTGG + Intronic
1023881883 7:44325418-44325440 GAGCCCGTCCGCCGCCGCCATGG - Exonic
1023999212 7:45179927-45179949 AGGCTCCCCCACCGCAGCCCTGG + Intronic
1026911196 7:74092916-74092938 AGGCTCCTCAGCCTCGGCCCTGG - Intronic
1029248612 7:99220369-99220391 GGGCTCCTGCTCCCCAGCCCTGG + Intergenic
1029298249 7:99558617-99558639 GGGCCCCCCCTCCTCCGCCCAGG - Intronic
1029351447 7:100015790-100015812 GGGCTCCGCAGCTGCGGCCCTGG + Intronic
1029711119 7:102300568-102300590 TGGCCCCGCCGCAGCCGCCCCGG + Exonic
1029927086 7:104329240-104329262 GGGGTCCTCCGCCTCCGCGGAGG - Intronic
1031406722 7:121395929-121395951 GGGGTTCCCGGCCGCCGCCCCGG - Intronic
1032345187 7:131110136-131110158 GAGCTCCTCCAGAGCCGCCCGGG + Intronic
1033299992 7:140176911-140176933 GGCCACCGCCGCCGCCGCTCCGG + Exonic
1033477127 7:141702013-141702035 GGGCGGCTCCGCGGCCGGCCGGG + Exonic
1033477131 7:141702033-141702055 GGGCGCCCCCGCCGCCGCCCCGG + Exonic
1034306376 7:150048051-150048073 AGCCTCCTCCGCCCCCTCCCCGG + Intergenic
1034347649 7:150397202-150397224 GGGCGCCCCCGCGGCGGCCCCGG - Exonic
1034800470 7:154052591-154052613 AGCCTCCTCCGCCCCCTCCCCGG - Intronic
1034977739 7:155457987-155458009 GGGCTCCGGCGCCGCCGCCTGGG - Intergenic
1034983163 7:155491107-155491129 GGGCTCCACCCCCCGCGCCCTGG + Intronic
1035123062 7:156585199-156585221 GGGCTCCTGCCCTGCAGCCCCGG - Intergenic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1037986665 8:23294634-23294656 GGGCTGCTCCGACACCGCCCTGG - Intronic
1038035408 8:23682629-23682651 GGCCTCCTCCGGCGCGGCGCGGG + Exonic
1039702624 8:39978169-39978191 GGGCTCCTCCAGCGCAGGCCCGG - Intronic
1043053355 8:75407967-75407989 AAGTTTCTCCGCCGCCGCCCGGG + Intronic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044666555 8:94639532-94639554 GGGCTCCTCTCCCCCCTCCCGGG + Intergenic
1045047574 8:98294086-98294108 GGACTCCGCCTCGGCCGCCCTGG - Exonic
1045063453 8:98426917-98426939 GCGTGCCTCGGCCGCCGCCCGGG - Intronic
1045737921 8:105318457-105318479 CGGCGCCGCCGCCGCCGCTCCGG - Intronic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049145890 8:141000978-141001000 GGTCTCCGCCGCATCCGCCCCGG + Intronic
1049354374 8:142180255-142180277 GGGCTCCCCTGTCACCGCCCGGG - Intergenic
1049867885 8:144950656-144950678 GCGCGGCTCCGCCCCCGCCCGGG + Intronic
1049905801 9:215172-215194 CGGCTCCACCGCCGCAGCCTCGG - Exonic
1053011793 9:34637791-34637813 GCGCTCCCCCGCCACCGCCGTGG + Intronic
1053055183 9:34989747-34989769 CGGCTCCGCCGCCTCCACCCGGG - Exonic
1053239945 9:36487408-36487430 GCCCCCCACCGCCGCCGCCCCGG - Intronic
1053240049 9:36487765-36487787 GGGCTCCTCAGCCGCGGCTCCGG + Intergenic
1053306211 9:36986348-36986370 GGGCCCCGCCGCGGCCGCGCCGG + Intronic
1054842626 9:69759823-69759845 GCGCGCCTCCGCCGCCTCCGAGG - Intronic
1057361146 9:94374747-94374769 GGGCACCGCCGCCGCCTCCGCGG + Exonic
1057463769 9:95292418-95292440 AGGAGCCTCCGCCGCCGCCTCGG + Intronic
1057662215 9:97013417-97013439 GGGCACCGCCGCCGCCTCCGCGG - Exonic
1057773160 9:97984461-97984483 GGGCGCCGCCGCCGCGGCACAGG - Intronic
1058467620 9:105244850-105244872 GGGCTCCTTCGGCCCCGCCATGG + Exonic
1059313034 9:113401375-113401397 GGGCTCCTCCGCTCCAGCCGCGG + Intergenic
1060139943 9:121201431-121201453 GGACACCTCCGCCCCCGCCCAGG + Intronic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060209098 9:121699480-121699502 GGTCCCCCGCGCCGCCGCCCCGG + Intronic
1060403356 9:123361032-123361054 AGGCACCTCCCCCGCCCCCCAGG + Intronic
1060584477 9:124777447-124777469 CGGCTCCTCCGCCCTGGCCCCGG - Intronic
1060770205 9:126326905-126326927 CGGCCCCTCCCGCGCCGCCCGGG + Exonic
1060811771 9:126614365-126614387 GCTCTCCGCCGCCGCGGCCCTGG - Intergenic
1060833159 9:126732583-126732605 GGTCTCCTGCTCTGCCGCCCAGG + Intergenic
1061320043 9:129823180-129823202 GGACTCTTCCGCAGCCGACCAGG - Intronic
1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG + Intergenic
1062435731 9:136545874-136545896 GGGACCGTCCGCCGCCGCCCCGG - Intergenic
1062476015 9:136727954-136727976 CGGCGCCTCCTCCGCGGCCCGGG + Intergenic
1062620373 9:137417818-137417840 GGCCTCCCCCGCAGGCGCCCTGG - Intronic
1062626019 9:137441757-137441779 AGGCGCTTCCGCCCCCGCCCCGG - Intronic
1062637465 9:137499040-137499062 GGGCTCCTCCTCCACCCCCAGGG - Intronic
1186480914 X:9895537-9895559 GGGCTGCTCCGCGGGAGCCCAGG + Exonic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1187915600 X:24149968-24149990 GCGCGCCTCCGCCGCCGCTCGGG - Intronic
1189333060 X:40154735-40154757 TGGCTCTTCTGCCGCGGCCCTGG - Intronic
1190231554 X:48586243-48586265 GGGCTCAACCTCCGCCTCCCAGG + Intergenic
1192584157 X:72306757-72306779 GGCCGCCACCGCCACCGCCCCGG - Intronic
1192630806 X:72776911-72776933 GGGCTAAGCCTCCGCCGCCCGGG - Intergenic
1192650904 X:72943893-72943915 GGGCTAAGCCTCCGCCGCCCGGG + Intergenic
1196950869 X:120875005-120875027 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196951706 X:120931398-120931420 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196952390 X:120936259-120936281 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196953075 X:120941120-120941142 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196953760 X:120945980-120946002 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196954445 X:120950841-120950863 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196955128 X:120955701-120955723 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196955815 X:120960584-120960606 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196956497 X:120965445-120965467 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196957179 X:120970305-120970327 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196957861 X:120975165-120975187 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196958543 X:120980025-120980047 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1196959224 X:120984885-120984907 GGCCTCCTCCGCGGGCTCCCTGG + Exonic
1200129006 X:153830923-153830945 GCGCCCCTCCCCCGCCGCCGTGG - Intergenic
1200292504 X:154886395-154886417 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200339348 X:155382135-155382157 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200347122 X:155458558-155458580 GGCCGGCGCCGCCGCCGCCCAGG + Exonic
1200418302 Y:2935619-2935641 GCGCACCTCCGCAGCCGCTCAGG - Exonic