ID: 1118972446

View in Genome Browser
Species Human (GRCh38)
Location 14:70648484-70648506
Sequence ACATGGGAGTGCCCCCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118972440_1118972446 26 Left 1118972440 14:70648435-70648457 CCAGGAACTCTTTAGGACATCTT 0: 1
1: 0
2: 1
3: 6
4: 118
Right 1118972446 14:70648484-70648506 ACATGGGAGTGCCCCCTCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 135
1118972444_1118972446 -9 Left 1118972444 14:70648470-70648492 CCTACAGCCAAAATACATGGGAG 0: 1
1: 0
2: 1
3: 9
4: 159
Right 1118972446 14:70648484-70648506 ACATGGGAGTGCCCCCTCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 135
1118972443_1118972446 -8 Left 1118972443 14:70648469-70648491 CCCTACAGCCAAAATACATGGGA 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1118972446 14:70648484-70648506 ACATGGGAGTGCCCCCTCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118972446 Original CRISPR ACATGGGAGTGCCCCCTCCA AGG Intronic
900558414 1:3291506-3291528 ACATGGAAGGGCCAGCTCCAGGG + Intronic
904269734 1:29342151-29342173 ACATGGGACAGCCCCCGCCTTGG + Intergenic
905035607 1:34916252-34916274 AGGTGGGAGTGTCCCGTCCAGGG + Intronic
905207822 1:36353003-36353025 ACAAGGCAATGCCCCCTCCCCGG + Intronic
907438630 1:54464971-54464993 ACAGGGGAGGGCCCGCCCCAGGG + Intergenic
908263600 1:62357783-62357805 ACTTGGGAGTGCCCCTTCAGTGG + Intergenic
914899010 1:151702150-151702172 ACAGGGGAGAGCCCCCGACAGGG + Intergenic
918462989 1:184795313-184795335 TCCTGGGAGCTCCCCCTCCATGG + Exonic
922414111 1:225404405-225404427 ACATGGGAGGGACCACGCCAAGG + Exonic
923267419 1:232328143-232328165 ACATCGGAGAGCCCACTCCTAGG + Intergenic
1063372734 10:5532314-5532336 GCATGGCTGTGCCGCCTCCAAGG - Intergenic
1064004767 10:11691060-11691082 AGGTGTGAGTGCCCCCTGCATGG + Intergenic
1067048483 10:42999139-42999161 ACCTGTGATTGGCCCCTCCAGGG + Intergenic
1067067356 10:43111462-43111484 TCATGTGAGTGCCTGCTCCAGGG + Exonic
1067526671 10:47043439-47043461 ACATTGGAATGCCTCCCCCATGG - Intergenic
1067527059 10:47045398-47045420 TGATGGGAGGGACCCCTCCAGGG + Intergenic
1067843365 10:49699606-49699628 AAACTGGAGTGCCCCCTGCAAGG - Intronic
1070915057 10:80148219-80148241 GCATGGGACCCCCCCCTCCAGGG - Intergenic
1070916716 10:80159794-80159816 ACATGGGAGTGGGCCCTGGAGGG - Intronic
1076033108 10:127175910-127175932 ACATGGCCGGGCCTCCTCCATGG + Exonic
1076722913 10:132400515-132400537 CCAGGGGAGCGCCTCCTCCAAGG - Intronic
1079384433 11:19966330-19966352 ACATTGGAGTGTCTGCTCCATGG + Intronic
1080037320 11:27722702-27722724 TCCTGGGAGAGCCCCCTCCGAGG - Intergenic
1085154937 11:74284780-74284802 ACATGGTAGTGGCTCCCCCATGG + Intronic
1088820741 11:113454642-113454664 ACATGGGTGTGCCTGGTCCAGGG - Intronic
1089515384 11:119028689-119028711 ACGTGGCAGTTCCCCCTCCCTGG + Intronic
1092564329 12:9648493-9648515 AGAGGGGAGTGCCCCCTGGACGG + Intergenic
1092720147 12:11433165-11433187 ACCTGGGAATGCCTCCTTCAGGG - Intronic
1094472758 12:30818747-30818769 AGATGGGAGTTCCCCATCTAGGG - Intergenic
1096305880 12:50474813-50474835 AAATGGGAGTGGCCTCTCAATGG - Intronic
1097877104 12:64653691-64653713 ACATGGGAGTGCCAGCTACTAGG - Intronic
1100675639 12:96863698-96863720 ACATGGGGGACCCCCTTCCATGG - Intronic
1105856820 13:24381766-24381788 GCATGAGAATGCCTCCTCCAAGG + Intergenic
1112186916 13:97136629-97136651 ATGTGGGAGTGCCCACTGCAGGG - Intergenic
1112797592 13:103072975-103072997 AAATGGGAGTTCCCCGTACATGG - Intergenic
1113152016 13:107274434-107274456 GCATGGCAGTGCCAACTCCATGG + Intronic
1117684338 14:58238056-58238078 ACTTGGGAGTGCTCCATCGATGG - Intronic
1118972446 14:70648484-70648506 ACATGGGAGTGCCCCCTCCAAGG + Intronic
1121121156 14:91376709-91376731 CCATGGGAGGGCACCATCCAGGG - Intronic
1122804668 14:104250381-104250403 AAATGGCAGTGCCCCCACCTGGG + Intergenic
1132404728 15:101535465-101535487 ACACGGAAGTGCGCCCTCCATGG - Intergenic
1132874678 16:2131110-2131132 TCTTGGGGGTGCCACCTCCATGG - Intronic
1133774413 16:8886009-8886031 GGGTGGCAGTGCCCCCTCCAGGG + Intergenic
1134553620 16:15149943-15149965 TCTTGGGGGTGCCACCTCCATGG - Intergenic
1138513280 16:57521192-57521214 ACATGGGGGTGAGCCCACCAAGG + Intronic
1140211870 16:72976930-72976952 ACATGGGAGTCACCCATCAAAGG + Intronic
1141651816 16:85396843-85396865 AGATGGGGGTGCCCTCTCCAGGG + Intergenic
1142204679 16:88777293-88777315 ACAAGGGCGTGCACCCACCAAGG + Intronic
1143258793 17:5583549-5583571 ACATGGAACTGCCCTCTCAAAGG - Intronic
1145250271 17:21293540-21293562 ACCTGGCAGCGCCCCCTCCCCGG - Intronic
1145866661 17:28246316-28246338 AGATGGGAGGGCCAGCTCCAAGG + Intergenic
1147200971 17:38800754-38800776 ACAGGAGAGTGGCCCCTCGAGGG + Exonic
1149003875 17:51784212-51784234 ACATGGGTTTGCCAGCTCCATGG - Intronic
1152516762 17:80829645-80829667 ACATGGCAGTGCCGCGTGCATGG + Intronic
1152587730 17:81196511-81196533 AGACAGGAGTGCCCTCTCCAGGG + Intronic
1156109609 18:33709619-33709641 ACTTGGAAGTGCTCCCTCCCAGG - Intronic
1159015684 18:63100161-63100183 ACCTGGAAGTGCCCCATCCCAGG + Intergenic
1159880848 18:73857259-73857281 ACAGAGAACTGCCCCCTCCAGGG + Intergenic
1161994418 19:7703688-7703710 CCCTGGGACTGCCTCCTCCATGG + Intergenic
1164532465 19:29058739-29058761 CCATGGGAGTCCCGCCTGCACGG - Intergenic
1168267877 19:55232105-55232127 ACAGAGGGGTGGCCCCTCCACGG + Exonic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
927036122 2:19178358-19178380 ACATGAGAGTGATGCCTCCAGGG + Intergenic
928312738 2:30223984-30224006 TCATGGGAGTGCCTCTCCCAAGG + Intergenic
929982893 2:46698431-46698453 ATATGGAAGGGCCCCCTCCCTGG - Intergenic
937482623 2:122278030-122278052 GCATTGGAGTTTCCCCTCCACGG - Intergenic
938601006 2:132838837-132838859 ATATGGGAGTACCCTCTCCTTGG + Intronic
941150530 2:161908868-161908890 ACATGGGATTGCAACCTCCCAGG + Intronic
942491035 2:176490200-176490222 ACCTGTGTGTGCCTCCTCCAGGG + Intergenic
944114359 2:196171354-196171376 TCCCGGGACTGCCCCCTCCAGGG + Exonic
945826746 2:214729858-214729880 CCATGGGGGTGTGCCCTCCAGGG + Intronic
947714207 2:232331733-232331755 ACATGGGAGGGGCCCCAGCAGGG - Intronic
947733417 2:232443112-232443134 ACATGGGAGGGGCCCCAGCAGGG - Intergenic
1170707930 20:18762200-18762222 CCATGGCAGTGCCACCTCCATGG - Intronic
1174164759 20:48576776-48576798 ACAAGGGGGTGCCCCTTCCTGGG + Intergenic
1174185807 20:48705138-48705160 TCATGGGAGTACCCCCGTCATGG - Intronic
1174834216 20:53840667-53840689 AGATGGCAGTCCTCCCTCCAAGG - Intergenic
1175980372 20:62735697-62735719 ACACGGGAGTCCCCCCGACACGG + Intronic
1180164143 21:46011677-46011699 TCACGGGAGTGACCTCTCCAAGG + Intergenic
1180500196 22:15923326-15923348 GCATGGGACTACCTCCTCCAGGG - Intergenic
1181390780 22:22579401-22579423 AAATGGGGGTGCCCACCCCATGG - Intergenic
1183431093 22:37766161-37766183 TCATAGGAGTGCCTCCTCCCTGG + Intronic
1183465408 22:37977894-37977916 ACATGGGGGAGCCCTCTCCTGGG + Exonic
1183664232 22:39238138-39238160 ACATAGGAGATGCCCCTCCAAGG + Intronic
1184105867 22:42367289-42367311 GCATGGGACCACCCCCTCCATGG - Intergenic
1184753546 22:46502995-46503017 AGTTGGAAGTGCCCACTCCATGG + Intronic
1184786216 22:46673240-46673262 GCCTGGGAGTGACCACTCCATGG + Intronic
949775082 3:7623691-7623713 ACATGGGAGTTCAGCCTTCAAGG + Intronic
953844500 3:46416703-46416725 ACATGGGACAGCCCACCCCAAGG - Intergenic
954594146 3:51811000-51811022 GGCTGGGAGTGCCTCCTCCATGG + Intergenic
954613325 3:51957558-51957580 ACCTGGCAGTGCCCCCTCTTTGG + Exonic
955582383 3:60438186-60438208 ACATGTGCATGCTCCCTCCAGGG - Intronic
956194541 3:66638976-66638998 ACATGCGAGTTCTCCTTCCAAGG - Intergenic
964770305 3:160217998-160218020 ACAGGGAAATGCACCCTCCAGGG + Intergenic
965071993 3:163925886-163925908 GCAGGAGAGTGCCCCCGCCAAGG - Intergenic
966819661 3:183914777-183914799 CCAGGGGAGAGCCCCTTCCATGG + Intergenic
967270687 3:187729709-187729731 ACATGGGAGTGCCCGCTCCTTGG + Exonic
967688873 3:192449803-192449825 CCATGGGCATGCCCTCTCCAAGG + Intronic
968234317 3:197022846-197022868 ACATGCCACTTCCCCCTCCACGG + Intronic
968764049 4:2458973-2458995 ACCTGGGAGTGCCTCCCTCAAGG - Intronic
969618189 4:8265726-8265748 TCTTGGGAGAGCCCCCTCCCTGG + Intergenic
969658082 4:8509519-8509541 AGCTGGGAGTGCCCCCTGCAAGG - Intergenic
974920345 4:68231295-68231317 CCATGGCCATGCCCCCTCCAGGG + Exonic
975563039 4:75724980-75725002 GCATGTGGATGCCCCCTCCATGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
985827624 5:2204797-2204819 ACACGGGAGTGTCCACTCCCTGG - Intergenic
993995368 5:94716077-94716099 AGATGTGTGTGCCTCCTCCAAGG + Intronic
1002330218 5:178435775-178435797 GGATGGGGGTGCCCTCTCCAGGG - Intronic
1002535492 5:179873438-179873460 ACAGGGCAGTGCCCCCGACAAGG + Intronic
1002946235 6:1763899-1763921 AAATGGCACTGCTCCCTCCAAGG - Intronic
1002956944 6:1875079-1875101 ACATGGGACTGCCCCCTATTTGG + Intronic
1004797445 6:19103380-19103402 ACATGTATGTGCTCCCTCCATGG + Intergenic
1005461507 6:26073770-26073792 TGATGGGAGTGCCCACTCCCTGG - Intergenic
1011576393 6:88805408-88805430 ACATGAGAATGCCCCCACCTTGG + Intronic
1016885957 6:148959875-148959897 AGATGGAAGTGCCCACTGCAGGG + Intronic
1019107829 6:169683716-169683738 AGATGGGACTTCCCCCTGCAAGG + Intronic
1022762159 7:33366243-33366265 CCATGGAAGTTCCCACTCCACGG + Intronic
1023056234 7:36292141-36292163 ACATGTGAGTGCCCCGTGCCAGG + Intronic
1023089639 7:36605703-36605725 GCCTGGGAGTGCACCCTACATGG + Intronic
1023259698 7:38345884-38345906 TTGTGGGACTGCCCCCTCCAAGG - Intergenic
1023260166 7:38350209-38350231 CTATGGGACTGCCCCCTCCAAGG - Intergenic
1023261146 7:38359363-38359385 CTATGGGACTGCCCCCTCCAAGG - Intergenic
1025260281 7:57413808-57413830 AGATGGGACTGAACCCTCCAGGG + Intergenic
1025951789 7:66151160-66151182 ACATGGGAGGCCTCCCTGCAGGG + Intronic
1029733831 7:102454681-102454703 ATAGGGAAGTGCCCGCTCCAAGG - Exonic
1034200930 7:149282367-149282389 ACAGGGGAGAGACCCCGCCAGGG - Exonic
1034255721 7:149723751-149723773 TCAGGGGATTGTCCCCTCCAGGG + Exonic
1035411554 7:158647376-158647398 ACATCACAGTGCCCCCTGCAGGG + Intronic
1036064042 8:5358062-5358084 TAATGAGAGTGCCCCCTACATGG - Intergenic
1038328174 8:26588098-26588120 ACATGGGAGTGCTCACTACTGGG - Intronic
1040581164 8:48699678-48699700 CCATGTGAGCCCCCCCTCCAGGG - Intergenic
1041992977 8:64016943-64016965 GCATGGAAGTGCTCCCTCCTTGG - Intergenic
1043789517 8:84446782-84446804 GAATGGGAATGCCCCCTGCATGG - Intronic
1049358900 8:142202497-142202519 GCAGGGCAGGGCCCCCTCCATGG + Intergenic
1049721066 8:144115828-144115850 ACATGGTGGTGCCACCTCCGCGG + Exonic
1052391328 9:27881796-27881818 ACATGGGATTGCCTTCACCATGG - Intergenic
1053415405 9:37944193-37944215 ACATCTCAGAGCCCCCTCCATGG - Intronic
1055116041 9:72606439-72606461 ACATGGGAGTGAACCATACAGGG + Intronic
1057999059 9:99847056-99847078 ACATGAGACTGTTCCCTCCAGGG - Intronic
1060462293 9:123868460-123868482 AAATGGGAGTGCACCATGCATGG - Intronic
1062489619 9:136798976-136798998 CCAGGGGGATGCCCCCTCCATGG - Intronic
1187770386 X:22689430-22689452 TCATGGGAGAGGCTCCTCCAAGG + Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1192313551 X:70035227-70035249 ACATGGCACTGCCCCATCCATGG + Intronic
1193054919 X:77139679-77139701 AAATGGGAGTGTCATCTCCATGG - Intergenic