ID: 1118974668

View in Genome Browser
Species Human (GRCh38)
Location 14:70666311-70666333
Sequence ATGGCAGGCAGGTCTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118974668_1118974672 -6 Left 1118974668 14:70666311-70666333 CCACCATGAGACCTGCCTGCCAT 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1118974672 14:70666328-70666350 TGCCATAGCTTCCTCTTGCCTGG 0: 1
1: 0
2: 1
3: 27
4: 166
1118974668_1118974673 -5 Left 1118974668 14:70666311-70666333 CCACCATGAGACCTGCCTGCCAT 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1118974673 14:70666329-70666351 GCCATAGCTTCCTCTTGCCTGGG 0: 1
1: 0
2: 3
3: 38
4: 177
1118974668_1118974679 26 Left 1118974668 14:70666311-70666333 CCACCATGAGACCTGCCTGCCAT 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1118974679 14:70666360-70666382 GTCTCTCATGTCCAGACATGTGG 0: 1
1: 0
2: 0
3: 17
4: 140
1118974668_1118974675 4 Left 1118974668 14:70666311-70666333 CCACCATGAGACCTGCCTGCCAT 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1118974675 14:70666338-70666360 TCCTCTTGCCTGGGACACCTAGG 0: 1
1: 0
2: 1
3: 41
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118974668 Original CRISPR ATGGCAGGCAGGTCTCATGG TGG (reversed) Intronic