ID: 1118974668

View in Genome Browser
Species Human (GRCh38)
Location 14:70666311-70666333
Sequence ATGGCAGGCAGGTCTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118974668_1118974673 -5 Left 1118974668 14:70666311-70666333 CCACCATGAGACCTGCCTGCCAT 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1118974673 14:70666329-70666351 GCCATAGCTTCCTCTTGCCTGGG 0: 1
1: 0
2: 3
3: 38
4: 177
1118974668_1118974672 -6 Left 1118974668 14:70666311-70666333 CCACCATGAGACCTGCCTGCCAT 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1118974672 14:70666328-70666350 TGCCATAGCTTCCTCTTGCCTGG 0: 1
1: 0
2: 1
3: 27
4: 166
1118974668_1118974675 4 Left 1118974668 14:70666311-70666333 CCACCATGAGACCTGCCTGCCAT 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1118974675 14:70666338-70666360 TCCTCTTGCCTGGGACACCTAGG 0: 1
1: 0
2: 1
3: 41
4: 321
1118974668_1118974679 26 Left 1118974668 14:70666311-70666333 CCACCATGAGACCTGCCTGCCAT 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1118974679 14:70666360-70666382 GTCTCTCATGTCCAGACATGTGG 0: 1
1: 0
2: 0
3: 17
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118974668 Original CRISPR ATGGCAGGCAGGTCTCATGG TGG (reversed) Intronic
900809125 1:4787729-4787751 AGGTCAGCCAGGTCTCAAGGAGG + Exonic
901422773 1:9162232-9162254 CTGGGGGGCAGGTCACATGGTGG - Intergenic
903165066 1:21514502-21514524 ATGACAGGCAGGTACCATGGTGG + Intronic
903288123 1:22289787-22289809 AGGAGAGGCAGGTCTCAGGGAGG - Intergenic
906125516 1:43424874-43424896 TTGGCAGGGAGGTGTCATGGGGG - Intronic
907407329 1:54261705-54261727 AAGGCATCCAGCTCTCATGGAGG - Intronic
908113061 1:60916051-60916073 AAGGCAAGCTGGTCTTATGGTGG - Intronic
913118507 1:115718417-115718439 ATGGCAGACAGGAATCATTGAGG + Intronic
915278534 1:154806686-154806708 ATGGCTGGCACATCTCAAGGAGG - Intronic
915844152 1:159246171-159246193 CTGTCAGGCAGGTCTAGTGGTGG + Intergenic
916454803 1:164959767-164959789 ATGGCAGGCCTGTGTCATGGAGG - Intergenic
919137616 1:193530597-193530619 AAGGCAGGCAGATCTCTTTGAGG - Intergenic
919268453 1:195305327-195305349 ATGCCAGGTAGATCTCATTGGGG + Intergenic
920104003 1:203537602-203537624 GTGGCAGGCAGGACTCCTGGGGG + Intergenic
921078988 1:211723923-211723945 ATGGTAGGGAGGCCTCAGGGAGG + Intergenic
922726434 1:227925079-227925101 AGGGCAGGCAGCACTCAGGGAGG + Intronic
922788939 1:228299249-228299271 CTGGCAGGCAGGGCTGGTGGAGG - Exonic
924666773 1:246081623-246081645 AAGGCAGGCAGGTCACTTGAGGG - Intronic
924730854 1:246710369-246710391 GGGGCAGGCATGTCACATGGCGG + Intergenic
1065238945 10:23686228-23686250 TTTGCTGGCAGGCCTCATGGGGG + Intergenic
1069535120 10:69247589-69247611 ATGGCAGGCAGCACTCACTGAGG - Exonic
1070437146 10:76404480-76404502 AGGGCAGAGAGATCTCATGGGGG - Intronic
1074745190 10:116524997-116525019 GGGGCAGGCAGTTCTCATGATGG + Intergenic
1075457311 10:122593181-122593203 ATGCCTGGCCTGTCTCATGGGGG - Intronic
1075458382 10:122599676-122599698 ATGCCTGGCCGGCCTCATGGGGG - Intronic
1075779458 10:125007513-125007535 AAGGCAGGTAGATCTCAGGGAGG + Intronic
1076208269 10:128620568-128620590 AGGGCAGGGAGCTCTCTTGGGGG - Intergenic
1076855131 10:133112036-133112058 ATGGCAGGCAGGTGGTCTGGAGG - Intronic
1079114770 11:17634199-17634221 ATCGCAGGCAGCTCTCAGGGCGG - Exonic
1083293603 11:61703361-61703383 TTGGCAGGCAGGTCCCAGGAGGG + Intronic
1083485995 11:62983436-62983458 AGGGCAGGCAGGGCTCAGGAGGG + Intronic
1083495278 11:63046811-63046833 ATGGCAGGCAGGTGTCCAGATGG + Intergenic
1085315803 11:75544242-75544264 GTGCCAGGCAGCTCTCATGCTGG + Intergenic
1085640846 11:78191693-78191715 GTGGCAGGGAGGGCTAATGGAGG + Intronic
1087240264 11:95767064-95767086 TTGGCAGGCAGGGGTGATGGTGG + Intergenic
1089327043 11:117664421-117664443 ATGGCAGGGAGGTGTCAGAGGGG - Intronic
1089469382 11:118708578-118708600 AGGGCTGGCATGTCTCATGGAGG - Intergenic
1089512245 11:119006917-119006939 GTGAAAGGCATGTCTCATGGTGG - Intronic
1090517484 11:127444604-127444626 ATGGCAGGAAGGTCACCTGAGGG - Intergenic
1090954470 11:131502220-131502242 ATGGCAGAGAGGCCTCATGAAGG + Intronic
1091721942 12:2820263-2820285 CTGGGAGGAAGGTCTCCTGGAGG + Intronic
1091786610 12:3246781-3246803 ATGGCAGGCTGGTGGGATGGTGG - Intronic
1092984907 12:13836195-13836217 ATGGCAGGCAGGTTTGCTGTGGG - Intronic
1096183529 12:49564363-49564385 CTGGGAGGCAGGACTCCTGGAGG - Intronic
1100685840 12:96985537-96985559 ATGGCAGTGTGGTCTGATGGGGG - Intergenic
1101436953 12:104672185-104672207 AGGCCAGACAGGTCTCAGGGAGG - Intronic
1101810478 12:108103521-108103543 ATGCCAGGCAGGTTTCAACGTGG + Intergenic
1102262954 12:111456143-111456165 GTTGGAGGCAGGTGTCATGGAGG + Exonic
1109823304 13:67685755-67685777 AAGGCAGGCAGGCCTCCTTGAGG + Intergenic
1112303894 13:98255819-98255841 ATGTCAGGCAGAGCTCATGTGGG + Intronic
1113461303 13:110484448-110484470 ATGGAAGGGAGGTCTCCGGGGGG - Intronic
1113679869 13:112235806-112235828 GTGGCAGGCAGGACTCAGAGGGG - Intergenic
1117255697 14:53975274-53975296 ATGGCCACCAGGTCTCAAGGGGG - Intergenic
1118044987 14:61959794-61959816 TTGTAAGGCAGGTCTAATGGTGG + Intergenic
1118722190 14:68602180-68602202 CAGGAAGGCAGGTCACATGGTGG - Intronic
1118776804 14:68978691-68978713 CTGGCGGGCAGGTCTCCTTGGGG - Intronic
1118886921 14:69875366-69875388 TGGGCAGGAAGGTCTCATGATGG - Intronic
1118974668 14:70666311-70666333 ATGGCAGGCAGGTCTCATGGTGG - Intronic
1122600047 14:102916775-102916797 ATGGCAGGAGGGTCTCAGTGAGG - Intergenic
1132825636 16:1903967-1903989 ATGCCAGGCAGGGCCCACGGTGG - Intergenic
1133061670 16:3178882-3178904 AAGGCAGGCAGATCACCTGGAGG + Intergenic
1133224012 16:4332055-4332077 CTGGCCGGCAGCTATCATGGGGG - Intronic
1134064102 16:11215930-11215952 GGGGCAGGCATGTCACATGGCGG - Intergenic
1136234031 16:28903644-28903666 AAGGCAGGGAGGTGGCATGGGGG - Intronic
1137492951 16:48948328-48948350 TTGACAGGCAGGGCTCAGGGTGG - Intergenic
1138525018 16:57600234-57600256 AGGGAAGGCAGGTCTCAGGTGGG - Intergenic
1140797437 16:78452706-78452728 AAGGCAGGCCGATCACATGGAGG - Intronic
1141437989 16:84011732-84011754 AAGGCAGCCAGGTGTGATGGTGG + Intronic
1141454978 16:84135372-84135394 AGGTCAGGCATGCCTCATGGAGG + Intronic
1141845897 16:86608778-86608800 AAGGAAGGCAGGGCTCAAGGAGG - Intergenic
1143095539 17:4476658-4476680 CTGGCAGGCAGGTCTCAGGCGGG - Intronic
1144131351 17:12250409-12250431 CTGGCAGGCAGCCCTCTTGGTGG + Intergenic
1144471383 17:15545260-15545282 ATGGCATGGTGGCCTCATGGTGG - Intronic
1144925086 17:18799433-18799455 ATGGCATGGTGGCCTCATGGTGG + Intronic
1153146010 18:2033443-2033465 GTGGCAGGGAGGGCTCATGAGGG + Intergenic
1155907496 18:31469275-31469297 ATGGCAGGCCGCACTCAGGGAGG + Exonic
1156921179 18:42523982-42524004 AATGCTGGCAGGTCCCATGGTGG + Intergenic
1157208087 18:45717542-45717564 ATGGCAGTCAAGTCTCTTGGGGG + Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1160207438 18:76846435-76846457 CTGGCAGGAAGGTGTCAGGGTGG + Intronic
1160408580 18:78659750-78659772 CCGGCGGGCAGGTCTCGTGGAGG - Intergenic
1160589559 18:79935662-79935684 ATGGCGGCCAGGTCCCAAGGGGG - Intronic
1161314588 19:3611888-3611910 ACGGCAGGCAGGTGTCCTCGGGG - Exonic
1164939333 19:32240002-32240024 GGGGCAGGCACCTCTCATGGTGG - Intergenic
1165146519 19:33734591-33734613 ATGGCAGGGCGTTCTCCTGGGGG - Intronic
1166003073 19:39889757-39889779 ATGGCCGGCAGGTCTCATGCGGG + Exonic
1166005860 19:39906009-39906031 ATGGCCGGCAGGTCTCATGCGGG + Exonic
1166346678 19:42170745-42170767 ACGGCAGGCAGGATGCATGGTGG + Intronic
1166948612 19:46412199-46412221 ATGTCAGCCAGGTGTCCTGGGGG - Exonic
1167437804 19:49490034-49490056 GTGGCTGGCAGGTCTCAGAGCGG - Intronic
1168483261 19:56739361-56739383 ATGCCAGCCAGGTCTCAGGGTGG - Intergenic
926041336 2:9675707-9675729 ATGGCGGGGAGGTCGCAGGGCGG + Intergenic
926352584 2:12010265-12010287 TTGATAGGCAGGTCTCATGAAGG + Intergenic
927468792 2:23356935-23356957 ATGGCAGGCAGGAGTCCTGCGGG + Intergenic
927949563 2:27158562-27158584 ATCACAGGAAGGTCTCCTGGAGG + Intergenic
927954700 2:27200435-27200457 ATCACAGGGAGGTCTCCTGGAGG + Exonic
931751432 2:65334040-65334062 TGGGCAGTCAGTTCTCATGGTGG - Intronic
933503535 2:83147279-83147301 CTAGCAGGCATGTCTTATGGAGG - Intergenic
935017570 2:99198585-99198607 ACAGGAGGCAGGGCTCATGGAGG + Intronic
935106955 2:100053755-100053777 ATGTCAGGCAGATTTCATGCTGG - Intronic
935180175 2:100682126-100682148 ATGGCAGGCAGAGCCCATGCTGG - Intergenic
937059725 2:118971960-118971982 ATGGGAGGCAGGTGTCATGGAGG + Intronic
938100576 2:128495303-128495325 GTGGCAGGCAGGGCTGCTGGGGG - Intergenic
939750508 2:146039442-146039464 AGGGAAGGCAGGACTCAGGGAGG - Intergenic
940156026 2:150658078-150658100 ATGGCTGGCATGTCATATGGTGG - Intergenic
941617124 2:167733326-167733348 ATGGCCCGCAGGCCTCATGCAGG + Intergenic
943850909 2:192721559-192721581 GCGGCAGGCATGTCACATGGTGG - Intergenic
947356267 2:229299333-229299355 ATGGGCTGCTGGTCTCATGGTGG - Intergenic
948270134 2:236667761-236667783 AGGCCAGGCAGGTCACAGGGAGG + Intergenic
949047075 2:241877096-241877118 AGGGCAGGGAGGTCGCAGGGAGG + Intergenic
1169171576 20:3470004-3470026 ATGGAAGACATGTCTCATTGAGG + Intergenic
1169190994 20:3659333-3659355 ATGCCAGGCAGGGCACAGGGTGG + Intronic
1170413346 20:16113902-16113924 ATGACAGGCAAGTCACATGAGGG + Intergenic
1173361796 20:42351126-42351148 AGGGAAGGGAGGTCTCATGAAGG - Intronic
1173715313 20:45198932-45198954 CTGGCAGGCATGCCTCATGCTGG - Intergenic
1175471626 20:59234050-59234072 AAGTCAGCCAGGGCTCATGGTGG + Intronic
1176140051 20:63541069-63541091 AGGGCAGGCAGATGACATGGGGG - Intronic
1176379351 21:6104082-6104104 ATGCCTGGCAGATCCCATGGAGG - Intergenic
1178247299 21:30965899-30965921 ATGGGAGGCAGGTCTGCAGGGGG + Intergenic
1179744122 21:43434155-43434177 ATGCCTGGCAGATCCCATGGAGG + Intergenic
1179827048 21:43971973-43971995 AACCCAGGCAGGTCTCTTGGTGG + Intronic
1181169763 22:21001507-21001529 GTCGCAGGGAGGTCTCGTGGCGG - Intronic
1182093534 22:27611804-27611826 AAGGCAGGCAGCTCTGATGTGGG - Intergenic
949844130 3:8353089-8353111 GAGGCAGGCAGGCCTCATGGAGG - Intergenic
950657206 3:14443983-14444005 ATGGCAGGCTGACCTCATGGAGG - Intronic
950900554 3:16493588-16493610 AGGGCAGGCCTGTCTCAAGGGGG - Intronic
951838265 3:27005386-27005408 AGGGCAGGTATGTCTGATGGTGG + Intergenic
953234137 3:41091449-41091471 ATGGCTCGCAGTTCTGATGGAGG + Intergenic
955044002 3:55342843-55342865 ATGACAGGTAAGTCACATGGAGG - Intergenic
955955644 3:64286618-64286640 ATAGCAGGGATGTCTCATGAGGG - Intronic
960359409 3:116693115-116693137 ATGGCAGGGAGTTCTGATGGAGG + Intronic
961551046 3:127670927-127670949 AGGGCATGCAGGCCACATGGGGG - Intronic
963859624 3:150295279-150295301 AGGGCAGCCAGCTCTCAGGGTGG - Intergenic
964389249 3:156180781-156180803 GTGTCATGCAGGTCTCAGGGAGG + Intronic
970211102 4:13710776-13710798 TTGTCCGGCAGGCCTCATGGCGG + Intergenic
970413990 4:15838500-15838522 AGGGGAGGCAGGTCATATGGGGG - Intronic
973096636 4:46210189-46210211 ATGGAAGGCAGGGCACATGCTGG + Intergenic
973959911 4:56099576-56099598 ATGGGAGCCAGGTCTCATTAGGG - Intergenic
977725043 4:100286754-100286776 ATGGCAGGCAGGTACCTGGGAGG + Intergenic
982036657 4:151352729-151352751 ATGGCAGGCAGTCCTGGTGGTGG - Intergenic
982086536 4:151841755-151841777 TTGGCGGGCAGGTGTCCTGGTGG - Intergenic
982564827 4:156972822-156972844 ATGCCAAGCAGGGCTTATGGTGG + Intergenic
983779960 4:171656564-171656586 ATCTCAGGCAGGTCCCTTGGTGG - Intergenic
985646387 5:1086662-1086684 ATGCCAGGCACGCCTCACGGAGG + Intronic
985851195 5:2390004-2390026 CTGGAAGGCATGCCTCATGGTGG + Intergenic
986331051 5:6716305-6716327 CTTGCAGGCAGGTTTCAGGGTGG - Intronic
987456036 5:18147898-18147920 ATGGCAGGTAGGACCTATGGCGG + Intergenic
988498230 5:31762682-31762704 ATGGAAGCCATGTGTCATGGCGG + Intronic
988633925 5:32960955-32960977 GTAGCAGCCAGGTCACATGGTGG + Intergenic
990323984 5:54656626-54656648 ATAGCTGGCAGCTCCCATGGAGG - Intergenic
991085654 5:62646470-62646492 AGAGCAGGCATGTCACATGGTGG + Intergenic
995096710 5:108244482-108244504 ATGGCATGCAGGTCTTCTGAAGG - Intronic
995922516 5:117330984-117331006 ATGGCAAGCTGGTCTCCTTGAGG - Intergenic
996400816 5:123060222-123060244 ATGCCAGGCAGGGCTTTTGGGGG + Intergenic
996633506 5:125664803-125664825 ATGGCAGGTAGCTATTATGGGGG + Intergenic
997459004 5:134039682-134039704 ATAGCAGCCAGGTCTCATTCTGG - Intergenic
1003877811 6:10453719-10453741 AGGGCAGACAGGTCTGATGAAGG + Intergenic
1004484307 6:16051539-16051561 AAGGCTGGCAGGCCACATGGGGG - Intergenic
1004698600 6:18057530-18057552 CTGGGAGGGAGGTCTCAAGGTGG + Intergenic
1005339214 6:24827730-24827752 AAGGCAGGTAGGTAACATGGTGG - Intronic
1005392613 6:25349124-25349146 CTGGCAGGCAGGGCGCAAGGTGG + Intronic
1005454365 6:26005091-26005113 ATAGCATGCAGGTCCCATGGGGG - Intergenic
1006310028 6:33250807-33250829 ATGACCGGCAGATCTCAGGGCGG + Exonic
1006985773 6:38174764-38174786 AAATCAGGCAGGTCTCAAGGGGG - Exonic
1007037355 6:38688652-38688674 TTAGCTGGCAGGCCTCATGGGGG + Intronic
1008320571 6:50107403-50107425 ATGGTAGGAAGGTCTGAAGGTGG + Intergenic
1008378546 6:50818901-50818923 ATGGCAGCCTGGTCTCTAGGAGG - Exonic
1009394834 6:63187517-63187539 ATGGAAGGCAGGTGTCAATGAGG + Intergenic
1012040184 6:94194240-94194262 ATGGCAGCCAGGGGTCATGAGGG + Intergenic
1013508250 6:110820466-110820488 AAGGCAGGCAGCTCACCTGGAGG - Intronic
1013509359 6:110830452-110830474 CTGGTAGGCATGTCTTATGGAGG - Intronic
1014487411 6:122016584-122016606 ATGGCTGGGAGGCCTCAGGGAGG + Intergenic
1017653566 6:156605214-156605236 GAGGCAGGCAGGTCTCCTTGAGG - Intergenic
1018741044 6:166728815-166728837 CCGCCAGGCAGGTCTCATGTGGG + Intronic
1018838915 6:167505340-167505362 ATTGCAGGCAGGCCTGCTGGTGG - Intergenic
1018924199 6:168195094-168195116 ATGGCAGGGTGGGGTCATGGTGG - Intergenic
1019423641 7:963149-963171 GTGGCAGGCAGGTGTCAGCGGGG + Intronic
1019431104 7:1000269-1000291 GGGGCAGGCACGTCTCCTGGGGG - Intronic
1019431154 7:1000434-1000456 GGGGCAGGCACGTCTCCTGGGGG - Intronic
1019684937 7:2376457-2376479 ATGGCAGGCCTCTCTCATGAAGG - Intronic
1022903612 7:34834630-34834652 ATTTCAGGGAGGTCACATGGGGG - Intronic
1024050839 7:45622314-45622336 AGGGGAGGCAGGTCTAGTGGAGG + Intronic
1026879155 7:73897767-73897789 ATGGGATGCAGGGCACATGGGGG - Intergenic
1032017330 7:128388514-128388536 AGGGCAGGCTGATCTCAGGGTGG - Intergenic
1032403722 7:131641085-131641107 AAGGCAGGGGGGTCCCATGGAGG - Intergenic
1033598115 7:142870788-142870810 AGGGCAGGCAGGTCTCTGGTGGG - Exonic
1034611224 7:152370972-152370994 TTGTAAGGCAGGTCTAATGGTGG - Intronic
1034937981 7:155211961-155211983 AGGGCAGTGAGGGCTCATGGGGG + Intergenic
1035289412 7:157828023-157828045 AAGGCAGGCAGGTCCCACGGTGG - Intronic
1035759282 8:2057484-2057506 ATGGTAGGAGGGTCTCAGGGTGG + Exonic
1038081991 8:24149084-24149106 TTGGAAGGCAAGTCTGATGGCGG + Intergenic
1038241260 8:25809703-25809725 AAGGCAGGCAGGTCACTTTGAGG - Intergenic
1038678527 8:29645253-29645275 ATGGCAGGCAAGTATCTTTGTGG + Intergenic
1039892627 8:41695372-41695394 AAGGCAGGCAGGGCACAGGGAGG + Intronic
1040886190 8:52266495-52266517 ATGGCAGGCAGATCTCACAGGGG + Intronic
1041428359 8:57749130-57749152 ATGGGAGCCAGGCATCATGGTGG - Intergenic
1042392722 8:68254692-68254714 ATGACAGGCAGGTCTCTTAGGGG + Intergenic
1043380695 8:79698881-79698903 TTGGCTGGAATGTCTCATGGAGG - Intergenic
1044028387 8:87202921-87202943 TTAGCTGGCAGGCCTCATGGGGG - Intronic
1044717438 8:95113375-95113397 CTGGGAGGGAGGTCTCATGGAGG + Intronic
1045264523 8:100607947-100607969 ATGGCAGGCAGGTTGCTTGTTGG + Intronic
1047096504 8:121631884-121631906 ATGGCAGGCAGTTCTTTTGCTGG - Intronic
1047311955 8:123699467-123699489 ATGGCAGGCTGGGGTCATGGTGG - Intronic
1047731351 8:127731458-127731480 AGAACAGGCAGGTCTCCTGGAGG - Intergenic
1050725873 9:8647959-8647981 CTGGCAGGGAAGTCCCATGGTGG - Intronic
1052292701 9:26862162-26862184 ATGACTGGCAGGTCCCAAGGAGG + Intronic
1055653349 9:78430016-78430038 ATGCCAGGCAGGTCACACAGAGG - Intergenic
1057545642 9:96018836-96018858 ATGGCAGAAAGGTATCATGTTGG - Intergenic
1058705151 9:107631723-107631745 ATGGAAGGCAGGTCTCACCAGGG - Intergenic
1058910372 9:109515344-109515366 ACAGCAGGTAGATCTCATGGAGG - Intergenic
1059772210 9:117437832-117437854 ATGGCTGGGAGATCCCATGGAGG + Intergenic
1060547652 9:124470464-124470486 AGGGCAGGCAGGGCTGACGGGGG - Intronic
1061783458 9:133008816-133008838 AACACAGGCAGGTCTCCTGGGGG + Intergenic
1061897750 9:133657260-133657282 CAGTCAGGCAGGCCTCATGGGGG + Intronic
1190516322 X:51227123-51227145 ATGGCAGGCAAATTTCATGCTGG + Intergenic
1190894386 X:54602437-54602459 CCAGCAGGCAGGTATCATGGAGG - Intergenic
1191720147 X:64222471-64222493 ATGGCAGGCAGGGCTAGGGGTGG + Intergenic
1192108570 X:68341032-68341054 ATGTGAGGCAGGCCACATGGTGG - Intronic
1198448676 X:136744196-136744218 ATGGGAGGCAGATTTTATGGAGG - Intronic