ID: 1118975920

View in Genome Browser
Species Human (GRCh38)
Location 14:70676687-70676709
Sequence TGTATGGGCGAGGAAAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118975920_1118975928 11 Left 1118975920 14:70676687-70676709 CCCTCATTTTCCTCGCCCATACA No data
Right 1118975928 14:70676721-70676743 TTTTGTTTTGTGTTCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118975920 Original CRISPR TGTATGGGCGAGGAAAATGA GGG (reversed) Intergenic
No off target data available for this crispr