ID: 1118981077

View in Genome Browser
Species Human (GRCh38)
Location 14:70717629-70717651
Sequence GCCTCACTCATTGACCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118981075_1118981077 4 Left 1118981075 14:70717602-70717624 CCCACTGCATCTTACTGTCATAA No data
Right 1118981077 14:70717629-70717651 GCCTCACTCATTGACCTGTCTGG No data
1118981071_1118981077 25 Left 1118981071 14:70717581-70717603 CCTTTCCTTACAGCACCATTCCC No data
Right 1118981077 14:70717629-70717651 GCCTCACTCATTGACCTGTCTGG No data
1118981074_1118981077 5 Left 1118981074 14:70717601-70717623 CCCCACTGCATCTTACTGTCATA No data
Right 1118981077 14:70717629-70717651 GCCTCACTCATTGACCTGTCTGG No data
1118981073_1118981077 10 Left 1118981073 14:70717596-70717618 CCATTCCCCACTGCATCTTACTG No data
Right 1118981077 14:70717629-70717651 GCCTCACTCATTGACCTGTCTGG No data
1118981072_1118981077 20 Left 1118981072 14:70717586-70717608 CCTTACAGCACCATTCCCCACTG No data
Right 1118981077 14:70717629-70717651 GCCTCACTCATTGACCTGTCTGG No data
1118981076_1118981077 3 Left 1118981076 14:70717603-70717625 CCACTGCATCTTACTGTCATAAG No data
Right 1118981077 14:70717629-70717651 GCCTCACTCATTGACCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118981077 Original CRISPR GCCTCACTCATTGACCTGTC TGG Intergenic
No off target data available for this crispr