ID: 1118982010

View in Genome Browser
Species Human (GRCh38)
Location 14:70724764-70724786
Sequence CCCTGGGGCCCTCGCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 1, 2: 3, 3: 48, 4: 465}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118981999_1118982010 21 Left 1118981999 14:70724720-70724742 CCTGGCCTTGGACTTCAGTGAGC 0: 1
1: 0
2: 0
3: 15
4: 202
Right 1118982010 14:70724764-70724786 CCCTGGGGCCCTCGCTCCCCAGG 0: 1
1: 1
2: 3
3: 48
4: 465
1118982000_1118982010 16 Left 1118982000 14:70724725-70724747 CCTTGGACTTCAGTGAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 151
Right 1118982010 14:70724764-70724786 CCCTGGGGCCCTCGCTCCCCAGG 0: 1
1: 1
2: 3
3: 48
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118982010 Original CRISPR CCCTGGGGCCCTCGCTCCCC AGG Intronic
900296713 1:1955607-1955629 CCCTGGGCCCCTCAGCCCCCTGG + Intronic
900335376 1:2160570-2160592 CCCTGGGGCCTCCGCATCCCAGG - Intronic
900531482 1:3155587-3155609 GCCTGCGGCCCTCCCTCCTCCGG - Intronic
900803313 1:4751090-4751112 CCCAGTGCCTCTCGCTCCCCTGG + Intronic
901221973 1:7588376-7588398 CCCTGGGGCCATCCCCCGCCCGG - Intronic
902192389 1:14772930-14772952 GCCTGGGCCCCTCACACCCCAGG - Intronic
902508888 1:16954929-16954951 GCCTGGGGGCCTAGTTCCCCAGG + Intronic
902666143 1:17939927-17939949 CCCTGGGGCCGTCGCTACCGTGG + Intergenic
902916903 1:19644739-19644761 CCCTCGCTCCCTCTCTCCCCCGG - Intronic
903446301 1:23424649-23424671 CCCTGTGCCCCTCGCCCCGCCGG - Exonic
903576819 1:24344516-24344538 CCCTGTTGCCCTTGCTCCCTTGG + Intronic
904008799 1:27378351-27378373 CCCTGGGGCCCTTTCCCCCTTGG + Intergenic
905168697 1:36098134-36098156 CCAGGGGTCCCTGGCTCCCCTGG - Exonic
905168878 1:36098617-36098639 CCCTGTGGGCCCTGCTCCCCTGG + Exonic
905557659 1:38899878-38899900 CCTTGGGGCCCTCCTGCCCCAGG - Intronic
905734355 1:40315633-40315655 CCCGGGGGGCCCCGCTCTCCCGG + Exonic
905972691 1:42153631-42153653 CCCCGGGCCCCGTGCTCCCCCGG - Intronic
906056772 1:42924205-42924227 CCCTGGGGACGTAGCTCACCCGG - Intergenic
906568774 1:46818857-46818879 CCCTGGGCACCACCCTCCCCAGG + Exonic
907513761 1:54980704-54980726 GCCCGGGTCCCGCGCTCCCCTGG + Intergenic
908390854 1:63682399-63682421 GCCTGGCGCCCTGGCTACCCTGG + Intergenic
910205728 1:84747294-84747316 CACTGGTGCCCTCGCTCTACAGG + Intergenic
910277399 1:85464388-85464410 CCTCGCGGCCCTCGCTCCCTGGG + Intronic
910761944 1:90741529-90741551 CCTTGGGTCCCACTCTCCCCTGG - Intergenic
912831249 1:112955974-112955996 CCACGGTGCCCTCGCTGCCCTGG - Exonic
912893156 1:113557299-113557321 CCCTGGGGCACTCCATCCCAGGG - Intronic
914386184 1:147172287-147172309 CCCTGGAGCCCTCTCCCTCCTGG + Intronic
915604045 1:156939763-156939785 CCCTGGGACCCAGGCTCCCCAGG - Exonic
916542291 1:165768625-165768647 CCCCGGGGCCCTTCCTCCCGGGG + Intronic
919407255 1:197201043-197201065 TCCTGGGGCCGTCTCTCACCGGG - Intergenic
920459494 1:206128375-206128397 CCCTGGACCCCTCCCTCCACAGG - Intergenic
921160905 1:212471527-212471549 CCCTGGGGCCGGCACTCACCTGG + Intergenic
922505068 1:226121596-226121618 GCCTGGGTCCCGCGCTCCGCGGG + Intergenic
922748374 1:228059730-228059752 CCCTGGGGACGGGGCTCCCCTGG + Exonic
924359211 1:243218357-243218379 CACTGGGGCCCTTGCCCCTCTGG - Intronic
1063124479 10:3126791-3126813 GCCTGGGGCTCTCGCTCCCATGG + Intronic
1063460784 10:6213834-6213856 CCCTGGGCGCCTCTGTCCCCTGG + Intronic
1066221175 10:33336716-33336738 CTCTGCGGCGCTCACTCCCCCGG - Intergenic
1067142658 10:43669700-43669722 CCCTGTGGACCTGACTCCCCGGG + Intergenic
1070147568 10:73785860-73785882 CCATGGGGCCCGCACCCCCCGGG - Exonic
1070599748 10:77857361-77857383 CCCTTGGGCCCCAGCTGCCCTGG - Intronic
1071502243 10:86212248-86212270 CCCTGGAGGCATCGCTCCGCAGG + Intronic
1072806960 10:98429819-98429841 GCCTGGAGCCCTCACTCCACGGG - Exonic
1072891634 10:99329821-99329843 TCCTGGGGCCCTTGCGTCCCGGG + Exonic
1073147676 10:101291562-101291584 CCCTGGGACCCTAGAGCCCCGGG - Intergenic
1073363366 10:102917956-102917978 CCCTGGGGCCCGCGCTCCCCAGG - Intergenic
1073509557 10:104034698-104034720 CCCGGGGGCCCTCGAGGCCCTGG + Exonic
1075282013 10:121147341-121147363 CCCTGGGTCCCTCCCACACCTGG + Intergenic
1075584918 10:123650687-123650709 ACCCAGGGCCCTGGCTCCCCTGG - Intergenic
1075734281 10:124654577-124654599 CCCCGTGGCCCTCCCTGCCCAGG + Intronic
1075915399 10:126162220-126162242 CCCTTGGGCACCCCCTCCCCAGG - Intronic
1076022223 10:127083302-127083324 ACCTGGTGCCCTCCCTTCCCAGG + Intronic
1076595487 10:131622518-131622540 ACCTGGGGCCCTGGGTTCCCGGG - Intergenic
1076687575 10:132204969-132204991 CCCTGGGGCCCCCGCGGCCTCGG - Exonic
1076795009 10:132794141-132794163 CCCGGGGGCCCTCACCCCCCTGG - Intergenic
1076872264 10:133199887-133199909 CCCTGTGGCCATCACTGCCCAGG - Intronic
1076991531 11:278595-278617 CCCTGGGGCCAGCACTCACCTGG - Exonic
1077053125 11:576615-576637 CCCTGGGGGCCCTGCTCCTCCGG + Intronic
1077190473 11:1254034-1254056 TGGTGGTGCCCTCGCTCCCCAGG - Intronic
1077232257 11:1463067-1463089 GCCTGGGCCCCTCACTCCCAAGG - Intergenic
1077273146 11:1691181-1691203 CCCTGGGGCCCTTCCCTCCCCGG + Intergenic
1077301049 11:1847144-1847166 CCCAGGGCCTCTCCCTCCCCTGG + Intergenic
1077391632 11:2303102-2303124 CCCTGGAGTCCTAGCTCCCCTGG + Intronic
1077496907 11:2890919-2890941 GCCAGGGGTCCTCACTCCCCAGG + Intronic
1078478735 11:11657642-11657664 CCCAGGGGCCCTGGCTTCCCTGG - Intergenic
1079752214 11:24213236-24213258 ACCTGGGTCCCTCCCTTCCCTGG - Intergenic
1083223585 11:61269327-61269349 CCCTGGAACCCTGGCTCACCAGG + Intronic
1083363578 11:62128160-62128182 CCCTGGGGCCGTCGTCCCCATGG - Exonic
1083425261 11:62581087-62581109 CCCTGGGACACTCACTCACCTGG + Exonic
1083721866 11:64607464-64607486 CCCGGCGGGCCCCGCTCCCCAGG + Exonic
1084483377 11:69434610-69434632 GTCTGGAGCCCTCCCTCCCCAGG - Intergenic
1084604061 11:70162311-70162333 CCCTGGGGTCCCCTCTGCCCAGG - Intronic
1084958266 11:72702968-72702990 CCCTGAGGCCCCCACGCCCCTGG - Exonic
1086398715 11:86443252-86443274 CCCTGGGTCCCTCACTTCCTGGG + Intronic
1086457311 11:86972101-86972123 ACCTGTGGCCCTAGCTCCTCAGG + Intergenic
1088685210 11:112279442-112279464 CCCCGGGCCCATGGCTCCCCAGG + Intergenic
1089011584 11:115136180-115136202 CCATGGGCCCCTCCCACCCCAGG + Intergenic
1089300035 11:117493001-117493023 CCCATGGGCCCCAGCTCCCCTGG - Intronic
1089340330 11:117752958-117752980 TCCTGGGGCCACAGCTCCCCTGG - Intronic
1089602764 11:119625418-119625440 CCCTGGGCCCCACGCAGCCCTGG - Intronic
1091239032 11:134040171-134040193 CTCTGGGGCTCCCGCTCCCTGGG - Intergenic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1091792925 12:3281712-3281734 CCTCGTGGGCCTCGCTCCCCAGG + Exonic
1092409712 12:8243639-8243661 CCCTGGGTCCCTCCCGCCACCGG - Intergenic
1094206501 12:27845727-27845749 CCCTGATGCTCTCCCTCCCCCGG + Intergenic
1095983558 12:47985798-47985820 CCACTGGGCCCTCGCTCTCCAGG + Exonic
1096390526 12:51225190-51225212 CCCTGGGGTCCCCTCTTCCCTGG + Intergenic
1097106519 12:56629529-56629551 GCTTGGGGCCCTCGCGTCCCGGG - Intronic
1097173051 12:57128217-57128239 GCCTGGGGCGCCCTCTCCCCTGG - Intronic
1101351183 12:103930827-103930849 CTCTGAGGCTCTGGCTCCCCCGG + Intronic
1102453393 12:113057180-113057202 CCCCGGGGCCCTCGCCCTGCCGG - Intronic
1102759196 12:115370701-115370723 CCCTGGCTCCCTCTCTCCCTTGG - Intergenic
1103034615 12:117646620-117646642 GCCTGGGGTCCTGGATCCCCGGG - Intronic
1103162769 12:118743931-118743953 CCCTAGGTCCCTCCCTCACCTGG - Intergenic
1103370262 12:120414059-120414081 CGCCGGGCCCCTCGCTCCCCAGG - Intergenic
1103764315 12:123270630-123270652 CCATGGCTCCCTCGGTCCCCTGG + Intronic
1103856343 12:123973163-123973185 GCGTGCGGCCCCCGCTCCCCCGG + Exonic
1103909634 12:124345153-124345175 CCCTGGTCCCCACGCTCCCTGGG + Intronic
1104604914 12:130180763-130180785 CCATGGGGCCCCCACTCTCCTGG + Intergenic
1104934040 12:132355122-132355144 CCGTGGGGCCGTCCCTTCCCCGG + Intergenic
1104964101 12:132501305-132501327 CCCTGTGGTCCTCGCGCCCCAGG + Intronic
1105011728 12:132761276-132761298 CCTTTGGGCCATCCCTCCCCAGG + Intronic
1105701924 13:22940485-22940507 CCCTGCGGCTCTCACTCCACAGG - Intergenic
1105704946 13:22962859-22962881 CCCTGGCTCCCTCTCTCTCCAGG - Intergenic
1105707844 13:22979583-22979605 CCCTGTAGCCCTCATTCCCCAGG - Intergenic
1110260129 13:73475321-73475343 GCCTGGGGCCCAAGATCCCCTGG - Intergenic
1110507103 13:76299568-76299590 GCCTGGAGCCCTGGCTGCCCAGG + Intergenic
1111919559 13:94396121-94396143 CCCTGGGGCCCCCTCTCCTGTGG + Intronic
1112271757 13:97976056-97976078 CCTTTGGTCCCTCGCTCCCTGGG - Intronic
1113423908 13:110192257-110192279 CCCTTGGCCCCTGGCTGCCCTGG + Exonic
1113464467 13:110503954-110503976 CCCTGGGGCCCCATCTCCCCCGG - Exonic
1113600759 13:111566686-111566708 TCCTGGGGCCCTGGGTCCTCCGG + Intergenic
1113607035 13:111616175-111616197 TCCTGGGGCCCTGCCACCCCAGG + Intronic
1113634322 13:111909552-111909574 CCCTGGGCCCCTCTGTGCCCAGG - Intergenic
1113674170 13:112196505-112196527 CCCTGGTTCCCTGGGTCCCCTGG + Intergenic
1113820656 13:113209872-113209894 CCCCGGCGCCCCCGCTCCCGGGG - Intronic
1113908448 13:113830844-113830866 CCCTGGGGCCCTCCTCCCCGGGG + Intronic
1114493697 14:23118743-23118765 CCCTGGGGTCGTAGCTCCCTGGG + Exonic
1115348211 14:32365554-32365576 CCCTGCAGCCCTGGCCCCCCAGG + Intronic
1118982010 14:70724764-70724786 CCCTGGGGCCCTCGCTCCCCAGG + Intronic
1119806438 14:77485308-77485330 CCCTGGGGGCCTTTCTCCTCTGG - Intronic
1121103382 14:91264775-91264797 ACCTGGGCCCCTCGAGCCCCGGG - Intergenic
1121648364 14:95536149-95536171 CCCTGGTGCCCTGGCCCCCTGGG - Intronic
1122140531 14:99660414-99660436 ACCTAGTGCCCTCGCGCCCCTGG + Intronic
1122208450 14:100159875-100159897 CCCTGGGTCCCTCGATGCGCGGG + Exonic
1122628594 14:103097268-103097290 CCCCGGGTCCCACTCTCCCCAGG - Intergenic
1122629913 14:103102934-103102956 CCGTGGGGCGCTCCCGCCCCAGG + Intronic
1122767439 14:104081956-104081978 TCCTGGCCCCCTGGCTCCCCAGG - Intergenic
1122788886 14:104176214-104176236 CCCTGGGGGCCCCCCTGCCCTGG + Exonic
1122803886 14:104247118-104247140 CCCTGTGGCCCCAGCTCCTCTGG - Intergenic
1122843369 14:104477343-104477365 CCCTGCGGCTCTTGCTCCACAGG - Intronic
1122859027 14:104573992-104574014 GGGTGGGGCCCTCCCTCCCCCGG + Intronic
1122912830 14:104841677-104841699 CCCTGGGGCCCTCACACCTCTGG + Intergenic
1123063750 14:105606078-105606100 CCCTGGGACCCTGGGTGCCCAGG + Intergenic
1123108338 14:105853285-105853307 CCCTGGGGCCTCCGCTCCCCAGG + Intergenic
1202903550 14_GL000194v1_random:56221-56243 CCCAGAGGCCCTCGCCCCCGAGG - Intergenic
1123412979 15:20074347-20074369 GCCTGGGGCCCCGGCTCCCGTGG + Intergenic
1123449159 15:20349539-20349561 CACTCAGGCCCTCGCTGCCCCGG - Intergenic
1123469516 15:20539728-20539750 CCCTTGGGCCCTCTGTCCCCAGG + Intronic
1123522321 15:21081460-21081482 GCCTGGGGCCCCGGCTCCCGTGG + Intergenic
1123648546 15:22460971-22460993 CCCTTGGGCCCTCTGTCCCCAGG - Intronic
1123729794 15:23134714-23134736 CCCTTGGGCCCTCTGTCCCCAGG + Intronic
1123747962 15:23332196-23332218 CCCTTGGGCCCTCTGTCCCCAGG + Intergenic
1124280329 15:28356048-28356070 CCCTTGGGCCCTCTGTCCCCAGG + Intergenic
1124302369 15:28555564-28555586 CCCTTGGGCCCTCTGTCCCCAGG - Intergenic
1124636197 15:31366421-31366443 CCCTGGGGCCCTCCCACCTGGGG + Intronic
1124706999 15:31974564-31974586 CCTTGGGCCGCTCCCTCCCCGGG - Intergenic
1125533364 15:40428474-40428496 CCCTGGTACCCTCCCTCCCTAGG + Intronic
1125600226 15:40911497-40911519 CTCTGAGGCCCTGGCTGCCCTGG - Intergenic
1126037063 15:44556464-44556486 ACCTGTAGCCCTCGCTACCCGGG - Intronic
1127322724 15:57863373-57863395 CCCTGTGGACCTTGCTCACCTGG + Intergenic
1127961812 15:63895827-63895849 TCCTGGGGCCCTCTCTCCCCAGG + Intergenic
1128756378 15:70186410-70186432 CCCTGCGGCTGTCTCTCCCCAGG + Intergenic
1129029122 15:72605640-72605662 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1129037044 15:72656654-72656676 CCCTTGGGCCCCCTGTCCCCAGG - Intronic
1129212843 15:74080571-74080593 CCCTTGGGCCCCCTGTCCCCAGG + Intronic
1129397559 15:75260515-75260537 CCCTTGGGCCCCCTGTCCCCAGG - Intronic
1129401169 15:75284792-75284814 CCCTTGGGCCCCCTGTCCCCAGG - Intronic
1129474761 15:75777493-75777515 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1129729980 15:77924891-77924913 CCCTTGGGCCCCCTGTCCCCAGG + Intergenic
1129885049 15:79031732-79031754 CCCTCGTGCTCTCTCTCCCCTGG - Intronic
1130260039 15:82347465-82347487 CCCTTGGGCCCCCTGTCCCCAGG + Intronic
1130472565 15:84237728-84237750 CCCTTGGGCCCCCTGTCCCCAGG - Intronic
1130480056 15:84352299-84352321 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1130484283 15:84389874-84389896 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1130491713 15:84435830-84435852 CCCTTGGGCCCCCTGTCCCCAGG + Intergenic
1130503328 15:84514870-84514892 CCCTTGGGCCCCCTGTCCCCAGG + Intergenic
1132145025 15:99424527-99424549 CCCTGGGGCACAGACTCCCCTGG + Intergenic
1132534460 16:471196-471218 CCCTGGGGGCCTCCTTCCCAGGG + Intronic
1132767075 16:1539856-1539878 CCCTGGGGCACGGGGTCCCCGGG - Intronic
1132826429 16:1907720-1907742 ACCTGGCTCCCTCCCTCCCCTGG - Intergenic
1132853007 16:2033235-2033257 CTCTGCGGCCCTGGCTCCCCGGG - Intronic
1133033841 16:3023904-3023926 CCCTGGGGGCCTCGCTGCAAGGG + Exonic
1133125159 16:3641733-3641755 CCATGGGCCCCAAGCTCCCCTGG - Intronic
1133192916 16:4147554-4147576 CCTGGGGGGCCTCGCTCTCCTGG - Intergenic
1133239443 16:4405594-4405616 CCCTGGTGCCCTCACTGCCCGGG - Intronic
1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG + Intergenic
1135572304 16:23558107-23558129 CCCTGGGGACCCCGCAGCCCAGG + Exonic
1136367301 16:29814685-29814707 CCTTGGGCCCATCCCTCCCCTGG + Exonic
1136497264 16:30651883-30651905 CCCGGGGGCCCCTTCTCCCCTGG + Exonic
1137044333 16:35642012-35642034 CCACGGGGCCCTGGCTCTCCTGG - Intergenic
1138009418 16:53363502-53363524 CCCTTGGGCCCTCTGTCTCCAGG + Intergenic
1138139728 16:54557805-54557827 CCCCTGGACCCTCTCTCCCCTGG - Intergenic
1138598575 16:58042128-58042150 CCCTTGGGCCCACCCTCACCTGG + Intronic
1138672926 16:58629902-58629924 CTCTGGGGCCATCCCTCCTCGGG - Intergenic
1139593075 16:67943887-67943909 GGCTGGGGCCCAGGCTCCCCAGG + Exonic
1140669997 16:77269030-77269052 ACCTGGGGCCCTCCCACACCTGG + Intronic
1141587122 16:85041741-85041763 CCCAGGGTCCCTCCTTCCCCGGG - Intronic
1141592479 16:85077829-85077851 CCCTGGGGGCCACACTCCCTGGG + Intronic
1141616680 16:85213856-85213878 GCCTGGGGCCCTCTGTCCTCAGG - Intergenic
1141692128 16:85602439-85602461 CCCTTGGGCCCTGGCCGCCCTGG + Intergenic
1142156072 16:88533390-88533412 GCCTGGGGCCCAGGCTCTCCGGG - Exonic
1142185006 16:88690682-88690704 TCCTGGCGCCCTCCCTGCCCAGG - Intergenic
1142226631 16:88880841-88880863 CGCTGGGGCCCTCCCCACCCTGG + Intronic
1142264726 16:89058463-89058485 CCCTGGGGGCCTGGGTCCCAGGG - Intergenic
1142307288 16:89292893-89292915 CCCGGGGGCCGGCCCTCCCCAGG + Intronic
1143117099 17:4587273-4587295 CCCTTGAGCCCTGGCTCCCGGGG + Intronic
1143258932 17:5584144-5584166 CTCTGGGCTCCTCCCTCCCCTGG - Intronic
1143649797 17:8256440-8256462 GCCTGGGGCCTCCCCTCCCCGGG - Intronic
1143784950 17:9249072-9249094 CCCTGGAGCCCTCAGTCCCTAGG + Intergenic
1144672161 17:17138935-17138957 TCCTGGGGCTGTGGCTCCCCAGG - Intronic
1145065756 17:19760170-19760192 CCCTGCGGCCCTCCTTCCCAAGG + Intergenic
1145938052 17:28726489-28726511 CCCCGCTGCCCTCGCTCGCCTGG + Intronic
1145943945 17:28759307-28759329 CCCTCAGGCCCTGGCTCACCAGG - Exonic
1145990654 17:29077544-29077566 CACTGAGGTCCTCCCTCCCCTGG + Exonic
1146058832 17:29593978-29594000 CCCTGCAGCCCTCACTGCCCCGG - Intronic
1146901577 17:36592448-36592470 CCCTGTGGCCTTCTCGCCCCCGG + Intronic
1147740708 17:42669758-42669780 CCCTTGGGCCCTCACATCCCTGG - Intronic
1147867021 17:43559854-43559876 CCATGGGGCCATCACACCCCTGG + Intronic
1147994713 17:44354419-44354441 CCCCGCCGCCCTCGCCCCCCGGG + Exonic
1148284067 17:46372697-46372719 CCCCGGCGTCCTCGCTCCACAGG - Intergenic
1148306288 17:46590618-46590640 CCCCGGCGTCCTCGCTCCACAGG - Intergenic
1148833539 17:50452527-50452549 CCCTGATGCTCTCCCTCCCCCGG - Intronic
1148843121 17:50511835-50511857 CCCTGGGGCTCTTCCTTCCCTGG + Intronic
1150423049 17:65056123-65056145 CCGGGGTGCCCTCGCGCCCCAGG - Intronic
1150548958 17:66191831-66191853 CCCAGGGGCGCGCGCCCCCCAGG + Exonic
1151566911 17:74903781-74903803 CCCTGGGCGCCTCCCTCCTCTGG - Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152339491 17:79716325-79716347 CACTCAGGCCCTCGCTGCCCGGG + Intergenic
1152511828 17:80795163-80795185 CCCTGCACCCCTCGCTCCCCAGG - Intronic
1152528712 17:80904263-80904285 GCCTGGGGCACTGGTTCCCCAGG + Intronic
1152719854 17:81918120-81918142 CCCGGCTGCCATCGCTCCCCTGG + Exonic
1152743431 17:82028553-82028575 CCCTGGGGGCCCCCGTCCCCCGG - Intronic
1152840989 17:82568080-82568102 CCCTGAAGACCCCGCTCCCCGGG - Exonic
1154290315 18:13101084-13101106 CCCTGTGTCGCTCGCTACCCAGG - Intronic
1154308268 18:13246310-13246332 CCCTGGGGATCTCGCTGCCCTGG + Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1155910216 18:31497801-31497823 CCCTGCGACCCGCGCTACCCAGG + Intergenic
1156350481 18:36297801-36297823 CCCCGGGGCCCGCGCCCCCGCGG + Intronic
1156463142 18:37332845-37332867 CCCTGAGGCCCTCACTGCCAAGG + Intronic
1156582292 18:38392469-38392491 TCCTGAGGGCCTCCCTCCCCCGG + Intergenic
1157276137 18:46312176-46312198 GCCTGGGTCCCTCGCTTCCCGGG - Intergenic
1157660800 18:49441832-49441854 GCCTGGGGGTCTCTCTCCCCAGG + Intronic
1160680978 19:411494-411516 CCCTGAGGCCCCCTCTCCTCGGG - Intergenic
1160831964 19:1108402-1108424 CCCTGCGGCCCTCGCGCACCAGG - Exonic
1160864071 19:1249527-1249549 ACCTGGGTCCCGCGCCCCCCGGG + Intronic
1160980908 19:1816185-1816207 CCCTGGGGCCGTCCCTGCGCAGG - Intronic
1161038442 19:2097809-2097831 CACTGGGGCCCAGGCTCACCTGG - Intronic
1161051384 19:2165463-2165485 CCCTGGGGCTCTGGCTTCTCTGG + Intronic
1161171413 19:2814133-2814155 CCCTGGCGGCCCCACTCCCCTGG + Exonic
1161226461 19:3148784-3148806 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161226469 19:3148801-3148823 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161234305 19:3190297-3190319 CACAGGGGCCCACGCACCCCAGG - Intronic
1161770206 19:6226893-6226915 CCCCGGCGCCCTCCCTCCACTGG - Intronic
1161812650 19:6479426-6479448 CCCTGGGTCCCTGGGTCCCTGGG + Intronic
1162584243 19:11549466-11549488 CCCGGGGGCCCCCACTCACCTGG - Exonic
1163326027 19:16603761-16603783 CCCTAATGCCCTAGCTCCCCTGG - Intronic
1163374373 19:16921433-16921455 CCCAGGGGCCCTCCCTGCCCTGG + Intronic
1163553924 19:17982209-17982231 CCCTGGGCCCCTCCCGACCCTGG + Intronic
1163602486 19:18257446-18257468 CCCCGGGGCCCTCAGTGCCCTGG + Exonic
1163612377 19:18308171-18308193 CCCTGGGGCCCTCATCTCCCGGG - Intronic
1163783583 19:19262891-19262913 CGCGGGGGCCCACGCTCCCCTGG + Intergenic
1163799510 19:19356123-19356145 CCCTGGGGCACTGCCTGCCCTGG - Exonic
1164148027 19:22524576-22524598 CCCTTGGGCCCCCTGTCCCCAGG + Intronic
1164155976 19:22597423-22597445 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1164828288 19:31300543-31300565 TCCTGGGGCCATCCCTCCCTAGG - Intronic
1164908392 19:31985853-31985875 CCCTGGTGCACTCACTCCCAGGG - Intergenic
1165378736 19:35462587-35462609 TCGTGGAGCCCTCGTTCCCCAGG + Intergenic
1165914327 19:39248380-39248402 CCCTGGGACCCTGGCCCCACCGG - Intergenic
1166214178 19:41325102-41325124 CCCTGGGGCCCACCACCCCCAGG - Intronic
1166718214 19:44982622-44982644 CTCTGGGGCTCTCCCTTCCCTGG + Intronic
1166965879 19:46529096-46529118 GCCTGGGGCCCTGTGTCCCCAGG - Intronic
1167311625 19:48740541-48740563 CCCGGAGGCCCTGGCTCCACTGG + Exonic
1167408979 19:49333942-49333964 CTCTGGGGCCTCCGCTCCTCGGG + Intergenic
1167610500 19:50505770-50505792 CCCTGGGGCTCACGCTCCTCCGG - Intergenic
1167756401 19:51416002-51416024 CCCTGGGGCCCTAGACCCCTGGG - Exonic
1168149438 19:54436783-54436805 CCCTGCTGTCCTCTCTCCCCCGG + Intronic
1168307216 19:55442317-55442339 CCCCGGGGCCCTCGCCCCCGCGG + Exonic
1168644964 19:58053877-58053899 CCCGGGGGCCCTTGCTCCGGGGG - Exonic
925390692 2:3491946-3491968 TCCTAGGGCCCTCGCTGGCCAGG + Intergenic
925715255 2:6779108-6779130 CCCTGGTGCTCTCCCTCCACTGG - Intergenic
927285647 2:21354285-21354307 ACCTGGGGCCCTCCCCCACCTGG - Intergenic
927786882 2:25980789-25980811 CCTTGGGGTCCTCGTTCACCCGG + Exonic
927936190 2:27078276-27078298 CTCTGGGGCCCTCTCCCCCAGGG + Intergenic
928080777 2:28310390-28310412 CCCTCAGGCCATCTCTCCCCAGG + Intronic
928313683 2:30230907-30230929 CCCGTGGGCACTCGGTCCCCCGG + Intergenic
929158796 2:38811390-38811412 TCCTGGGCCCCTCTCTTCCCAGG - Intronic
929952721 2:46428826-46428848 CCCTGGGGCCCTCCAAACCCTGG + Intergenic
931356135 2:61538697-61538719 CCCTGCGGCCCTCTCCCTCCCGG + Intergenic
932440422 2:71731285-71731307 CGCTGGGCCCCAGGCTCCCCTGG - Intergenic
933437025 2:82261151-82261173 ACCTGGGGCCCTCCCACACCTGG + Intergenic
934503112 2:94874201-94874223 CCCGGAGGCCCTCGCCCCCGAGG + Intronic
936152629 2:110030045-110030067 CCCTCTGGCCCCTGCTCCCCCGG - Intergenic
936192051 2:110341367-110341389 CCCTCTGGCCCCTGCTCCCCCGG + Intergenic
936398362 2:112147564-112147586 CCCTGGAGCCCAGACTCCCCCGG + Intronic
936519325 2:113201856-113201878 CCTTGGGGCTGTGGCTCCCCTGG - Exonic
937066811 2:119023777-119023799 CCTTGAGGCCCTCATTCCCCAGG + Intergenic
937205105 2:120231319-120231341 CCCTGTGGCCCTTGTTCCCAAGG + Intergenic
937982184 2:127622264-127622286 CCCTGGGGCTCGGCCTCCCCAGG + Intronic
938291072 2:130150814-130150836 CACTGCTGCCCTCGCTCCCCAGG + Intergenic
938370014 2:130762906-130762928 CCCTGGGAACCTTGCTCTCCAGG - Exonic
938405747 2:131032234-131032256 CCCTGGGGACATCTGTCCCCAGG - Intronic
938465479 2:131522145-131522167 CGCTGCTGCCCTTGCTCCCCAGG - Intergenic
939099600 2:137880660-137880682 CCCTGGGGGACTCGGTGCCCTGG + Intergenic
942460342 2:176163881-176163903 TAAAGGGGCCCTCGCTCCCCAGG + Intronic
943111463 2:183611326-183611348 CCCTAGGGCTCTCCCTTCCCTGG - Intergenic
945714196 2:213337065-213337087 GCCTGGGTCCCTCCCACCCCTGG - Intronic
945950500 2:216034740-216034762 CCCTGGAGCGCCCACTCCCCTGG - Intronic
946365818 2:219248399-219248421 CCCTGGGCTCCTCCCTCCACAGG + Exonic
948468343 2:238162753-238162775 CCCTGGGCCTCCCGGTCCCCAGG + Exonic
948674420 2:239588662-239588684 CCCAGGGGCCCAGGCTCCCATGG + Intergenic
948890936 2:240906811-240906833 GCCCTGGGCCCTCTCTCCCCAGG - Intergenic
948920448 2:241063799-241063821 CCCTGGGGGTCCCTCTCCCCAGG - Intronic
948975152 2:241459331-241459353 CCCTGTCACCCTGGCTCCCCAGG - Intronic
948979405 2:241485389-241485411 CCCTGTGGTCCTCCCTCCCTGGG + Intronic
948979456 2:241485545-241485567 CCCTGGGGTCCTCCTTCCCTAGG + Intronic
948979503 2:241485696-241485718 CCCTGGGGTCCTCCTTCCCTAGG + Intronic
948979520 2:241485748-241485770 CCCTGTGGTCCTCCCTCCCTGGG + Intronic
949027694 2:241774134-241774156 CCCTGGGGCCCTGGGGCCCTGGG + Intergenic
1170038630 20:12017128-12017150 CCCTGGGGCCTTCATTCCCCAGG - Intergenic
1172916949 20:38450410-38450432 ACCTGGGGTCCCAGCTCCCCTGG + Intergenic
1173527364 20:43743512-43743534 CTCTGGGGTCCTCCCTTCCCTGG - Intergenic
1173741711 20:45406601-45406623 CCCAGGGCCCGTCGGTCCCCCGG + Intronic
1175394838 20:58650993-58651015 GCCTGGGGGCCACGCTCCCCAGG + Intergenic
1175404624 20:58718111-58718133 GCCTGGTGCCGCCGCTCCCCTGG - Intronic
1175899201 20:62353414-62353436 CCCTGGGGAGCCCTCTCCCCTGG - Intronic
1175964242 20:62652458-62652480 CCCCGGGGCTCTTGCTCCTCCGG + Intronic
1175966093 20:62660918-62660940 CCCTGCAGCCCTCGCAGCCCCGG - Intronic
1176414317 21:6466387-6466409 CCCTGGAGCCCTCTCTCGCAAGG + Intergenic
1176566650 21:8391774-8391796 CCCGGGTGCGCTCGCTTCCCGGG + Intergenic
1176622917 21:9070989-9071011 CCCAGAGGCCCTCGCCCCCGAGG - Intergenic
1176706780 21:10123861-10123883 CCCAGGGACCCTGGCTTCCCTGG + Intergenic
1177356172 21:20010903-20010925 GCCTGTGGCCCTCGCTGCTCAGG - Intergenic
1177388200 21:20433791-20433813 GCCTGGGTCCCTCCCTCACCTGG - Intergenic
1178589741 21:33899200-33899222 ACATGGGGCCCTCCCTTCCCAGG + Exonic
1178741661 21:35207157-35207179 CCCTGGGGCCCGGGCTCTCTGGG + Intronic
1179178688 21:39027100-39027122 CCCTGGGGTCCTGGCTCCAAAGG - Intergenic
1179689815 21:43074709-43074731 CCCTGGAGCCCTCTCTCGCAAGG + Intronic
1179899246 21:44380415-44380437 CCCTGGAGCCCTCTCTCTGCTGG + Intronic
1180180794 21:46117907-46117929 CCTTGGTCTCCTCGCTCCCCTGG - Exonic
1180181314 21:46119820-46119842 CCTTGGGGCCATCGCTGCCTGGG - Exonic
1180258685 21:46651336-46651358 CCCCAGGGCCCTCCCTACCCCGG - Intronic
1181040084 22:20187972-20187994 GCCTGGGGTCCTTGCTCACCAGG - Intergenic
1181050188 22:20234660-20234682 GGCTGGGGCCCTGGCTCCCAAGG + Intergenic
1181513961 22:23401184-23401206 CCCTGGGGACCTCTCCCCTCAGG - Intergenic
1182117981 22:27768323-27768345 CCCTGGGGGCCTGGTTCTCCAGG - Intronic
1182148839 22:28014392-28014414 CCCTCGGCCCTTCCCTCCCCAGG - Exonic
1182549176 22:31091757-31091779 CCCTGGGACCCTGGCTCGGCTGG + Exonic
1183211755 22:36455453-36455475 CCCTGGGGCCTGCCTTCCCCAGG + Intergenic
1183322855 22:37175792-37175814 CCCTGGGGCCATTTCTTCCCTGG - Intergenic
1183746298 22:39693988-39694010 CCCTGGGGACCGCTCTGCCCAGG - Intergenic
1183931406 22:41237996-41238018 CCCTGGGACCTGCGCTGCCCTGG - Exonic
1184146461 22:42614509-42614531 CCCTGGGGCCCCCGCGTTCCGGG - Intronic
1184273445 22:43397621-43397643 AACAGGGGCCCTCGCTCTCCAGG + Intergenic
1184389146 22:44192866-44192888 CCCTGGGCCCATCCCTCTCCAGG - Intronic
1184523561 22:45009122-45009144 CCCTCGGGCCCCCGCGCCCCGGG - Intronic
1184733876 22:46386501-46386523 CCGTGCCGCCCTCGCTCCGCTGG + Exonic
1184796827 22:46737868-46737890 CCCTGGCGCCTGCGCTCCCAGGG + Intronic
1184856310 22:47148623-47148645 CCTGGGGTCCCTCCCTCCCCTGG + Intronic
1184856342 22:47148703-47148725 CCTGGGGTCCCTCCCTCCCCTGG + Intronic
1184856367 22:47148764-47148786 CCTGGGGTCCCTCTCTCCCCTGG + Intronic
1184876746 22:47281134-47281156 CCCTTGGGCCCTCGCCCCCCAGG + Intergenic
1184879365 22:47295296-47295318 CCATGGGGCCCTCACTCCTGGGG - Intergenic
1185288736 22:50013802-50013824 CCCTGCCGCCTTCCCTCCCCTGG - Intergenic
1185317478 22:50185319-50185341 CCCTGGGGCCCGACCTTCCCGGG + Intergenic
949105614 3:197519-197541 CACCGCGCCCCTCGCTCCCCTGG + Intronic
949414497 3:3800252-3800274 CCCCGGGCACCTCCCTCCCCTGG - Intronic
950162483 3:10771004-10771026 CCCTGGGGCACCCAGTCCCCAGG - Intergenic
950465096 3:13148913-13148935 CCCTGTAGCCTTGGCTCCCCTGG - Intergenic
950544864 3:13632263-13632285 CCCTCGGCCCCTCGGTCCCTTGG + Intronic
950580034 3:13856005-13856027 ACCTTGGGACCTCCCTCCCCAGG + Intronic
951981864 3:28575547-28575569 CCCTGGTCCCCTCCCTCTCCCGG - Intergenic
953412863 3:42699906-42699928 TCCTGATGCCCTCGCTCCCCAGG - Intronic
954710616 3:52503537-52503559 GCCTGGGACCCTGGCTCACCTGG - Exonic
959546134 3:107598952-107598974 GCCTGGGGCCCTCTGGCCCCAGG + Intronic
961013550 3:123450271-123450293 CCTTGAGGCACTCGCTGCCCAGG - Intergenic
961470152 3:127106319-127106341 CCCAGGGGCCCTCTCTCTCTTGG + Intergenic
961484393 3:127206986-127207008 CTCTTGGGCTCTGGCTCCCCTGG + Intergenic
962267767 3:133955625-133955647 CCCTGGGGCTCTGGGCCCCCAGG + Intronic
962650141 3:137480210-137480232 CCCTGTGCCCCTAGATCCCCTGG + Intergenic
964590876 3:158361017-158361039 CCCTGTGGCCCTGGCTCTCAGGG + Intronic
965844562 3:172946569-172946591 CCCTGGGGCCACTGCTACCCAGG - Intronic
967991474 3:195134680-195134702 AGCTGGGGCCCTGGCTTCCCCGG + Intronic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
968878459 4:3286540-3286562 CCCTGTGGGCCCTGCTCCCCCGG + Intergenic
969625055 4:8298075-8298097 CACCGGGGCACTCGCTGCCCTGG + Intronic
969651651 4:8471652-8471674 TCCTGTGGCCCTCGCCCCACGGG + Intronic
970432369 4:16000892-16000914 CCCTGGAGCTGTCCCTCCCCAGG - Intronic
971272152 4:25160197-25160219 CCCCGGGGCTCTGGCTCCGCCGG - Intronic
972300487 4:37780997-37781019 TCCGGGGGCACTCTCTCCCCAGG - Intergenic
977231137 4:94452240-94452262 CCCTGGGGTCCCCGCAGCCCGGG + Intronic
977368374 4:96102081-96102103 CCCCTGGCCCCTCCCTCCCCTGG - Intergenic
978366630 4:107989810-107989832 CCCTGCAGCCCGCGCGCCCCCGG - Exonic
980274586 4:130633197-130633219 CCCTGGGGACATAGCTCCACTGG + Intergenic
981391381 4:144195643-144195665 CTCTGTGGCCCTGGTTCCCCAGG - Intergenic
984823889 4:183906910-183906932 CCCCGCGGCCTTCGCGCCCCAGG + Exonic
985486690 5:155892-155914 TCCTGGGGCCCACCCTCCCTGGG + Intronic
985549201 5:524598-524620 CCCTGGTGCCCACCCTCCCCCGG + Intergenic
985575901 5:673417-673439 CCCTGTGACCCTGGCCCCCCAGG - Intronic
987057055 5:14203725-14203747 ACAAGGGGGCCTCGCTCCCCTGG + Intronic
988453468 5:31366029-31366051 ACCTGAGGGCCTGGCTCCCCAGG - Intergenic
988727940 5:33942403-33942425 ACCAGGGGCCCTGGCTGCCCAGG - Intergenic
992627681 5:78649221-78649243 CCCCGGGGCCCGCTCTCCGCCGG - Intronic
994316555 5:98339686-98339708 CCCTGGTGCCGTTGCTCCTCTGG + Intergenic
996818003 5:127595032-127595054 CCCTGAGACCATCCCTCCCCAGG + Intergenic
997302065 5:132813592-132813614 CCCTGGGTTCCTGGCTCCCGGGG - Exonic
997476633 5:134146308-134146330 CCCCGGGTCCCCAGCTCCCCAGG + Exonic
999251538 5:150185328-150185350 ACCCGGGGCCTTCTCTCCCCGGG + Intergenic
999262032 5:150244397-150244419 CCCTGGGGCCCTCGCCAGGCAGG + Intronic
999318891 5:150601226-150601248 CCCCGAGGCCCCCTCTCCCCTGG - Intronic
1001406796 5:171482344-171482366 CCCGGGGCCCCTCCCTGCCCAGG - Intergenic
1001713301 5:173794880-173794902 CCCAGGGGCCCACACACCCCTGG - Intergenic
1002570327 5:180136328-180136350 CCCTGGGTCCCTCCCGTCCCAGG - Intronic
1002866862 6:1129597-1129619 CCCTGGGGCCTTTGCCCCCTTGG + Intergenic
1002876546 6:1215761-1215783 TCCTGGAGCCCTCCATCCCCAGG - Intergenic
1003278698 6:4674066-4674088 CCCTGGGACCATGCCTCCCCGGG - Intergenic
1006180917 6:32152970-32152992 ACCTGGGGCAGTCGCTCTCCCGG + Intronic
1006441367 6:34055717-34055739 CCCTAGGGCCCCCGCCCCCTAGG - Intronic
1006909865 6:37556943-37556965 CCCTGGCTCCCTCCCTCCTCTGG - Intergenic
1007274060 6:40660735-40660757 CCCTGGCCACCTCACTCCCCAGG + Intergenic
1008854115 6:56060916-56060938 CCCTGAGGACCTGGATCCCCAGG + Exonic
1013980351 6:116121331-116121353 CCTTCTGGCCCTCGTTCCCCAGG + Exonic
1015441454 6:133251701-133251723 GCCAGGGACCCTCCCTCCCCTGG + Intronic
1016806203 6:148214923-148214945 CTCTGGGGCCATCCCTGCCCTGG + Intergenic
1016871327 6:148819985-148820007 CCATGGGGGCCTCTCTCTCCGGG + Intronic
1017161424 6:151369301-151369323 TCCTTGGGCCCTCGCATCCCTGG - Intronic
1017765393 6:157603028-157603050 CCGTGGGGCCATCGTCCCCCTGG + Intronic
1018793537 6:167168901-167168923 CCCTGGGGGTCTCTCTGCCCAGG - Intronic
1018823178 6:167389477-167389499 CCCTGGGGGTCTCTCTGCCCAGG + Intergenic
1019058742 6:169241073-169241095 CCCTGCCGCCCTCCCTGCCCTGG + Intronic
1019088428 6:169502702-169502724 CACTGGGGCCCTGGGTCACCCGG + Intronic
1019147414 6:169984211-169984233 CCCAGGGGCCCTCGTCACCCTGG - Intergenic
1019176093 6:170160273-170160295 CCCTGGACCACTCTCTCCCCGGG + Intergenic
1019287533 7:231221-231243 TCCAGGGGTCCTCGCTGCCCCGG - Intronic
1019342910 7:516995-517017 CCCTTGGGGCCTCGCTCCGCGGG + Intronic
1019573797 7:1726527-1726549 CCCGGGGTCCCTGGATCCCCTGG + Intronic
1019642660 7:2112694-2112716 CCCTGGGGCCCTGACACACCCGG + Intronic
1019647234 7:2137552-2137574 GCCTGGGCCCCTCACTCACCTGG - Intronic
1020015959 7:4832057-4832079 CCCTCGGGACTTGGCTCCCCCGG + Intronic
1020021345 7:4871415-4871437 CCCTGCGGCCCGCACACCCCTGG + Intronic
1020092710 7:5350289-5350311 CCCCGGGGCCCATGTTCCCCTGG - Intronic
1020669999 7:11094663-11094685 CCCTGGGGCTGTGGCTCCCAAGG + Intronic
1021668707 7:23013786-23013808 CCCTGGGGCCGCGGCTCCACTGG - Intronic
1022814926 7:33904948-33904970 CCCTGGGGCCCTGGCCTCCCTGG + Exonic
1023904678 7:44513732-44513754 CCCTGGGACCCTTCCTGCCCTGG - Intronic
1023940589 7:44766354-44766376 CCAAGGGGCCCTGTCTCCCCAGG + Intronic
1026894687 7:74003228-74003250 GTTTGGGGCCCTCTCTCCCCTGG - Intergenic
1026894703 7:74003276-74003298 ATCTGGGTCCCTCTCTCCCCTGG - Intergenic
1026894721 7:74003353-74003375 ATCTGGGGCCCTCCCTTCCCTGG - Intergenic
1026894737 7:74003431-74003453 ATCTGGGGCCCTCTCTCCTCTGG - Intergenic
1026894753 7:74003508-74003530 ATCTGGGGTCCTCTCTCCCCTGG - Intergenic
1028376358 7:90149583-90149605 CCCTGGGGGCCCCACTCACCTGG + Intergenic
1029489986 7:100865882-100865904 CCCCCGGGCCCTCAATCCCCAGG + Exonic
1029545304 7:101207408-101207430 GCCTGGCGCCCTCCCTCCCCTGG + Intronic
1029546174 7:101211759-101211781 CCCTGGGCACCGGGCTCCCCAGG - Intronic
1029974248 7:104817624-104817646 CCCTGAGGCCCTCACATCCCTGG + Intronic
1032710807 7:134458802-134458824 ACCGGGGGCCTTGGCTCCCCGGG - Intronic
1033608006 7:142941510-142941532 CCTTGGGGCACTTGATCCCCTGG - Intronic
1034274137 7:149816719-149816741 CCCGGGGTCCCTGGTTCCCCGGG + Intergenic
1034487211 7:151373568-151373590 CCCTGGAGTCCTTGCTCCCCAGG + Intronic
1035079212 7:156202333-156202355 CCTTGGGGCCATCTCTCTCCTGG - Intergenic
1035260563 7:157659209-157659231 CCCTGCGGCCCCCACTCTCCAGG + Intronic
1035381956 7:158446074-158446096 CCCTGGTGCCCCAGCACCCCAGG + Intronic
1035640195 8:1178938-1178960 ACCTGGGGCCCACGCCGCCCTGG + Intergenic
1036654927 8:10671826-10671848 CCCAGGACCCCTGGCTCCCCAGG - Intronic
1036798095 8:11770095-11770117 CCCTCCGGCCCTCCCTGCCCGGG - Exonic
1039821665 8:41140607-41140629 CCGTGCGGCTCTCACTCCCCAGG - Intergenic
1039907537 8:41797772-41797794 CCCAGGAGGCCCCGCTCCCCAGG + Intronic
1040065521 8:43141051-43141073 CCCTGAGGGCCTCGCCCCCGAGG + Intronic
1041098530 8:54373473-54373495 CCCTGGGGTGCTGGCTCCCCGGG - Intergenic
1041474633 8:58249532-58249554 TCCTGGGTCCCTCCCTTCCCTGG - Intergenic
1044058454 8:87601719-87601741 CTCTGGGGTCCCAGCTCCCCAGG - Intronic
1044693804 8:94903233-94903255 CCCTGTGGCCCTAGCTACTCAGG + Intronic
1045734859 8:105283101-105283123 CCCAGGGGCCCTAGGTCCCCAGG + Intronic
1048992102 8:139766440-139766462 CTCTGGGAGCCTCTCTCCCCAGG + Intronic
1049181967 8:141227600-141227622 CCCTGGGGGCCCGGCTCCCCCGG - Intronic
1049343926 8:142128521-142128543 CCCAGGGGCCCTCACTGCTCAGG - Intergenic
1049483951 8:142841734-142841756 CTCTGGTGCCCTCTCTCCCCAGG + Intronic
1049661248 8:143820570-143820592 TGCTGGGGACCTTGCTCCCCTGG - Intronic
1050552310 9:6758593-6758615 CCTCGGGGCCCTCCCTTCCCTGG + Intronic
1053644499 9:40112620-40112642 CCCAGGGACCCTGGCACCCCTGG + Intergenic
1053761483 9:41352231-41352253 CCCAGGGACCCTGGCACCCCTGG - Intergenic
1054324932 9:63708234-63708256 CCCAGGGACCCTGGCTTCCCTGG + Intergenic
1054540077 9:66263349-66263371 CCCAGGGACCCTGGCACCCCTGG - Intergenic
1056991921 9:91421252-91421274 CCCTGGCTCCCTGGCTCCCGCGG + Intronic
1057180120 9:93025210-93025232 CCCTGAGTACCTGGCTCCCCAGG - Intronic
1057195617 9:93114479-93114501 ACCTGAGGCCCTGACTCCCCAGG + Intergenic
1057218188 9:93241092-93241114 CCCTGGGGCCCTCCCAGGCCAGG - Intronic
1057353564 9:94318715-94318737 CCCTGGGGTCCTCTCCCTCCTGG + Exonic
1057568344 9:96184549-96184571 GCCTGGGACCCTCGGTCACCAGG - Intergenic
1057654187 9:96938877-96938899 CCCTGGGGTCCTCTCCCTCCTGG - Exonic
1057852965 9:98579423-98579445 CCCTGTGGTCATCTCTCCCCTGG + Intronic
1059406086 9:114098838-114098860 CCCTAGGCCCCGCGCTCCCCCGG - Intronic
1060002178 9:119968788-119968810 CCCTGTGGCCCCAGCTCACCAGG - Intergenic
1060282055 9:122221403-122221425 CCCTGGGACCCTCGCTTTGCGGG + Intronic
1060358305 9:122931354-122931376 CCCTGGGGCCCTGGATCAACCGG - Intronic
1060736521 9:126069788-126069810 CACTGGAGCCCTGGCTTCCCTGG - Intergenic
1060742227 9:126106885-126106907 CACTGGGGCCATAGCTCTCCAGG - Intergenic
1060799030 9:126532122-126532144 CCCTGGGCCTTCCGCTCCCCGGG + Intergenic
1061028603 9:128066627-128066649 CCCTGTGGCCCTCGGACCCTCGG - Exonic
1061065240 9:128273805-128273827 CCCTTGGGCCCCCTGTCCCCAGG + Intronic
1061404573 9:130386210-130386232 CTCTGGGGACCTCCCTCCCTGGG - Intronic
1061898951 9:133663160-133663182 CCTTGAGCCCCTCGCTCACCAGG - Intergenic
1062024893 9:134335766-134335788 CCTCGGGGCCCTGGCTCCCAGGG + Intronic
1062283982 9:135764972-135764994 ACCGGGAGCCCTCGCTCCCCAGG + Intronic
1062365645 9:136207768-136207790 CCCTGGGGCCTACGCTCCCAAGG + Exonic
1062383806 9:136300241-136300263 CCCTGGAGAGCTCGCGCCCCTGG + Exonic
1062457563 9:136646706-136646728 CCCTGGGGTCCTGGCTGCCCTGG + Intergenic
1062718747 9:138023853-138023875 CGCTGGGGCCCGCGCCGCCCCGG - Intronic
1203745586 Un_GL000218v1:39234-39256 CACTGAGGCCCGCGCTCCCTGGG - Intergenic
1203746104 Un_GL000218v1:41416-41438 CCCAGAGGCCCTCGCCCCCGAGG - Intergenic
1203564004 Un_KI270744v1:78065-78087 CCCGGAGGCCCTCGCCCCCGAGG + Intergenic
1185983437 X:4804890-4804912 ACCTGGGGCACTCTCTCCCAGGG - Intergenic
1190214861 X:48473267-48473289 CACTGTGTCCCTCCCTCCCCTGG - Intergenic
1190971889 X:55357324-55357346 ACCTGGGCCCCTCCCACCCCTGG - Intergenic
1192274600 X:69616357-69616379 CCCTGGCTCCCTCGCTCCCGCGG - Exonic
1192944296 X:75949284-75949306 CCCTGAGCCCCTCCCACCCCTGG + Intergenic
1193094162 X:77528248-77528270 CCCTGGGGAGCTCCCTCCCATGG - Intronic
1196782978 X:119399549-119399571 CCCTGTGGCCCACGGTCCCCGGG - Exonic
1196868228 X:120088142-120088164 CCCTGGGGCTCTAGTCCCCCAGG + Intergenic
1197831211 X:130645619-130645641 CCATGGGGCCCGCGCCCGCCTGG + Intronic
1198310635 X:135424105-135424127 CCCTGGGCCCCTCTCTCCCTTGG - Intergenic
1198683553 X:139205237-139205259 CCCGCGGGCCCTCCCTGCCCCGG - Intronic
1200101730 X:153691817-153691839 GCCTGGAGCCCACGATCCCCTGG - Intronic
1201151841 Y:11099026-11099048 CCCAGGGACCCTGGCTTCCCTGG - Intergenic
1202047974 Y:20753227-20753249 GCCTGAGGCCCTGGTTCCCCCGG - Intergenic
1202366600 Y:24170056-24170078 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1202504182 Y:25500067-25500089 CCCTTGGGCCCCCTGTCCCCAGG + Intergenic