ID: 1118983238

View in Genome Browser
Species Human (GRCh38)
Location 14:70732727-70732749
Sequence ACCAGGGGGTTGTGGGTACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118983238 Original CRISPR ACCAGGGGGTTGTGGGTACA TGG Exonic
901716086 1:11155705-11155727 CCCAGGGGGCTGTGGGTAATAGG - Intronic
903182217 1:21610528-21610550 ACAAGTGGGTTTTGGTTACATGG - Intronic
903221018 1:21869807-21869829 ACAAGAGGGCAGTGGGTACAAGG - Intronic
905782024 1:40720316-40720338 ACCAGGGGGGTGGTGGGACAGGG - Intronic
906057864 1:42930302-42930324 ACAAGAGGGTTTTGGGGACAGGG + Intronic
908047154 1:60183499-60183521 ATCAGTGGGTTGTGGTCACAGGG + Intergenic
911015030 1:93323196-93323218 ACTTGGGGATTTTGGGTACATGG + Intergenic
911320326 1:96406147-96406169 ATCAGTTGGTTGTAGGTACATGG + Intergenic
911469208 1:98295867-98295889 ACAAGTGGTTTTTGGGTACATGG + Intergenic
912781933 1:112558843-112558865 ACCAGGCGGCTGTGGGAAAATGG + Intronic
913304888 1:117417968-117417990 CCCAGGAGGTTGAGGCTACAGGG + Intronic
915291099 1:154883933-154883955 ACCAGAGGAGTGTGGGCACACGG + Intergenic
916167314 1:161975719-161975741 ACCTGGCTGTTGAGGGTACATGG + Intergenic
916185119 1:162124157-162124179 ACAAGTGGTTTGTGGTTACATGG + Intronic
916515183 1:165510085-165510107 AACAGGTGGTTTTGGTTACATGG + Intergenic
919296670 1:195710354-195710376 ATCATGAGGATGTGGGTACAGGG + Intergenic
920174142 1:204089688-204089710 ACCAGGGCTGTGTGGGTGCAGGG + Intronic
921961262 1:221036856-221036878 ACCAGAGGGTGGAGGGTACGGGG - Intergenic
922510324 1:226160741-226160763 AAGAGGGAGCTGTGGGTACAAGG - Intronic
922927940 1:229366028-229366050 ACCAGTGGTTTTTGGTTACATGG + Intergenic
923711959 1:236395250-236395272 CCCAGGGGGACGTGGGTACCGGG + Intronic
924272890 1:242352211-242352233 ACCAGAGGCTGGTGGGTAGAGGG - Intronic
1066711824 10:38244452-38244474 ACCAGAGGCTGGTGGGTAGAGGG + Intergenic
1067183982 10:44011741-44011763 ACCATGCTGTTGAGGGTACAGGG - Intergenic
1069929319 10:71871900-71871922 CCCAGGAGGTTGAGGCTACAGGG + Intergenic
1070126414 10:73625787-73625809 ACCTGGGTCCTGTGGGTACAGGG - Intronic
1071587774 10:86842047-86842069 AAAAAGGGGTTGTGGGTACCTGG + Intronic
1072171645 10:92868888-92868910 CCCAGGAGGTTGAGGCTACAAGG - Intronic
1073100703 10:101005077-101005099 CCCAGGGGGTTGAGGCTACAGGG - Intronic
1074078863 10:110152118-110152140 AGCAGGGGGTCGTTGGGACAAGG + Intergenic
1074416506 10:113271961-113271983 GCCAGGGGGTTGTGGGGTGAGGG + Intergenic
1076273174 10:129174521-129174543 GCCTGGGGGTTGGGGGGACAGGG - Intergenic
1076765596 10:132631276-132631298 ACCAGGGGCCTGTGGGAACCTGG + Intronic
1077711224 11:4539093-4539115 AGCGGGGGGTTTTGGTTACATGG - Intergenic
1077923614 11:6659326-6659348 AGCATGGGGTTGTGGATATAGGG + Intergenic
1078983084 11:16561077-16561099 AACAGGTGGTTTTGGTTACATGG - Intronic
1079395000 11:20054337-20054359 AGCAGGTGGTTTTGGTTACATGG + Intronic
1079738781 11:24031781-24031803 ATCAGATGGTTGTAGGTACATGG + Intergenic
1081618807 11:44606401-44606423 GCCAGGAGGTTGAGGCTACAGGG + Intronic
1082787254 11:57324058-57324080 ACCAGGGGGTAGAGGGTAGCAGG + Intronic
1084052181 11:66607140-66607162 CCCATGGGGATGGGGGTACAGGG - Intergenic
1085273507 11:75283834-75283856 AGCAGGGAGTTGTGGGGGCAGGG + Intronic
1086164795 11:83765067-83765089 ACCTGGGATTTGAGGGTACAGGG - Intronic
1087395734 11:97595362-97595384 AACAGGTGGTTTTGGTTACATGG - Intergenic
1089396800 11:118141421-118141443 GCCAGGGGGTGGAGGCTACATGG - Intronic
1089767257 11:120776982-120777004 ACGAGGGGGGTGTGAGTACCAGG + Intronic
1090152685 11:124402504-124402526 ACCAGGGGGTGCTGGTGACACGG + Intergenic
1090509794 11:127363056-127363078 AGCAGGGAGTAGTGTGTACAAGG + Intergenic
1091167105 11:133488924-133488946 ACCAGCTGGTTGCAGGTACATGG - Intronic
1094873945 12:34619820-34619842 GACAGGGGGTTGAGGGTATAGGG + Intergenic
1095404549 12:41853697-41853719 AACAGGTGGTTTTGGTTACATGG + Intergenic
1096725328 12:53556760-53556782 GCCAGGGGGCTGTGGGTGCTTGG + Intronic
1097894304 12:64809131-64809153 AACAGGTGGTTTTGGTTACATGG + Intronic
1100491907 12:95088343-95088365 ACCTGTGGGTTTTGGTTACATGG - Intronic
1101234653 12:102776318-102776340 AAGAGGGGGTTGTGGTTAGAGGG - Intergenic
1101686700 12:107030924-107030946 AGCTGGGGGTTGGGGGTACCTGG + Intronic
1102870611 12:116411163-116411185 ACCTGGGGCTTGCGGGTGCAGGG + Intergenic
1103996177 12:124831655-124831677 GGCAGGGGGTTGAGGGGACAGGG - Intronic
1104122421 12:125812103-125812125 ACCAGGTGGTGGTGGTTGCAGGG - Intergenic
1104554701 12:129789096-129789118 AACAGGTGGTTTTGGTTACATGG + Intronic
1104826278 12:131711576-131711598 ACCAGGAGGAGGTGGGGACAGGG - Intronic
1105428080 13:20312893-20312915 ACCATGGGGTAGGGGGTTCATGG + Intergenic
1107299908 13:38954909-38954931 TCCATGTGGTTGTGGGGACAGGG - Intergenic
1110433598 13:75455225-75455247 GCCAGCGGGCTGTGGGCACATGG - Intronic
1113050281 13:106203711-106203733 ACAAGCGGGTTTTGGTTACATGG + Intergenic
1113836465 13:113331311-113331333 ACCTGGGGGTTGGGGGCTCAGGG + Intronic
1114726343 14:24941662-24941684 CCCATGGGCTAGTGGGTACAGGG - Intronic
1115060615 14:29184797-29184819 AACAGGGAATTGTGGGTCCATGG + Intergenic
1115740399 14:36381676-36381698 ACAAGTGGGTTTTGGTTACATGG - Intergenic
1116334995 14:43646104-43646126 ACAAGTGGTTTGTGGTTACATGG - Intergenic
1118983238 14:70732727-70732749 ACCAGGGGGTTGTGGGTACATGG + Exonic
1119231252 14:72981618-72981640 ACCAGGATCTTGTGGGAACATGG + Intronic
1119844354 14:77817344-77817366 AGCAGAGGGATGAGGGTACAAGG + Intronic
1119892772 14:78195388-78195410 ACCATGGTGTAGTGAGTACAGGG + Intergenic
1120163474 14:81170021-81170043 CCCAGGGGGTTTTGTGTGCATGG + Intergenic
1121112568 14:91322211-91322233 CCCCAGGGGCTGTGGGTACAGGG + Intronic
1121279703 14:92689606-92689628 TCCAGGGGGCTGTGGGAGCATGG - Intergenic
1121664787 14:95664268-95664290 ATCAGGGAGTTGTGGGGACCAGG + Intergenic
1122470528 14:101963140-101963162 CCCAGGGGGTTGCTGGAACACGG - Intergenic
1125155450 15:36579826-36579848 ACCAGGAGGTGGCGGGAACAAGG - Exonic
1125225194 15:37388470-37388492 ACAAGTGGGTTTTGGTTACATGG + Intergenic
1126337895 15:47606382-47606404 TCCAGGGGTTTGAGGGAACAGGG + Intronic
1126910052 15:53408283-53408305 GCCAGTGGGATGTGGGTAGATGG + Intergenic
1128896402 15:71377515-71377537 ACCAGGGGGCTGTAGTGACAGGG + Intronic
1130809163 15:87358670-87358692 GCCAGGGGGTTGTGGATGCAGGG - Intergenic
1132215054 15:100056427-100056449 ACCAGGGGGTTGGGGGAAGTGGG + Intronic
1132931029 16:2459396-2459418 AGCAGGGGGGCGGGGGTACAGGG - Intergenic
1133549748 16:6842816-6842838 GTCAGGGGGTTGGGGGAACATGG - Intronic
1135045006 16:19148069-19148091 ACCAGTGGTTTTTGGTTACATGG + Intronic
1136680258 16:31956547-31956569 ACCAGGGGGTGCTCAGTACACGG + Intergenic
1136780602 16:32898092-32898114 ACCAGGGGGTGCTCAGTACACGG + Intergenic
1136889812 16:33961578-33961600 ACCAGGGGGTGCTCAGTACACGG - Intergenic
1137560126 16:49497070-49497092 AGCAGTGATTTGTGGGTACAGGG - Intronic
1138270473 16:55692363-55692385 ACTAGGGAGCTGTGGGCACAGGG - Intronic
1139115068 16:63941131-63941153 ATCAGGTGATTGTAGGTACATGG + Intergenic
1140416207 16:74775241-74775263 ACCAGTGGTTTTTGGTTACATGG + Intergenic
1140452447 16:75081593-75081615 AGCAGTGGGTTTTGGGTCCAAGG + Intronic
1141613308 16:85196170-85196192 ACTTGGGGGTTGTGGGTAGAGGG + Intergenic
1142178233 16:88654853-88654875 ACCAGAGGGTTGGGGAGACAAGG - Intronic
1142619971 17:1159021-1159043 ACCAGGCTGCTGTGGGTCCAAGG - Intronic
1143997777 17:11022949-11022971 ACCAGGTGTTTTTGGTTACATGG - Intergenic
1147561550 17:41512526-41512548 ACCAGGGGTTTGTGGGGAAGAGG + Intergenic
1147793957 17:43029583-43029605 CCCTGGGGGTTGTGGGGATAAGG + Intergenic
1148867610 17:50636960-50636982 ACCCCGGGGCTGTGGTTACAGGG + Intronic
1151507949 17:74541728-74541750 AACAGGGAGCTGTGGGGACACGG + Exonic
1151509481 17:74549535-74549557 AACAGGGAGCTGTGGGGACACGG + Intergenic
1152811996 17:82386583-82386605 TCCCGGGGGGTGTGGGTTCAGGG + Intergenic
1153154633 18:2134532-2134554 AGCAGGGGGCTGTGTGTGCAGGG - Intergenic
1153738213 18:8095213-8095235 ACCAGGGAGTGGTCAGTACAGGG + Intronic
1154341597 18:13507200-13507222 AACAGGTGGTTTTGGTTACATGG + Intronic
1156503878 18:37577007-37577029 ACCAGGGGGCTGTGGGCTGAGGG + Intergenic
1158536322 18:58311435-58311457 CCCAGGGGGTTGAGGGTGCAAGG - Intronic
1161095153 19:2386018-2386040 ACCAGGAGGTTGAGGCTGCAAGG - Intergenic
1163125857 19:15243811-15243833 ACCTGGGGGATATGGGGACAGGG - Intronic
1163223701 19:15939816-15939838 ACCAAGAGGATATGGGTACAAGG + Intergenic
1163513150 19:17747937-17747959 AGCAGGGGGTTGGGGCTACGCGG + Intronic
1163529989 19:17843334-17843356 CCCAGGGGGTTGGGGGTCCAAGG - Intronic
1166348119 19:42179379-42179401 ACCAGGGGAAGGTGGGCACAGGG + Intronic
1166348860 19:42184496-42184518 ACCAGGGGGCAGTGGCCACATGG - Intronic
1166771841 19:45288150-45288172 CCCAGGAGGTTGAGGCTACAGGG + Intronic
1167417839 19:49386545-49386567 ATCAGGGGCTTGAGGGCACATGG + Intergenic
1167462931 19:49635851-49635873 ACCTGGGGGTAGGGGGGACACGG + Exonic
1168671344 19:58243594-58243616 ACAATGGGGGTGTGGGGACAAGG - Intronic
926706002 2:15838018-15838040 ACCAGGTGGTAGTGAGGACAGGG - Intergenic
927088206 2:19690696-19690718 ACCAGGGGGTTTTGGATCAAGGG - Intergenic
928994084 2:37267924-37267946 ACCCAGAGTTTGTGGGTACATGG - Intronic
930253355 2:49060802-49060824 GCCGGGGGGGAGTGGGTACATGG - Intronic
930402930 2:50913727-50913749 ATCATGGGGTCGTAGGTACATGG + Intronic
931239445 2:60439343-60439365 ACCTGGGGGTTCTGGGTGAAGGG - Intergenic
932487562 2:72093845-72093867 CTCAGGGGGCTGTGGGTAGAGGG - Intergenic
933545482 2:83706063-83706085 ACCAGAGGGTGGAGGGTAGAAGG - Intergenic
936680038 2:114759619-114759641 ACCAGAAGGTTGTGGGGACAAGG + Intronic
936733435 2:115410776-115410798 AACAGGTGGTTTTGGTTACATGG - Intronic
937470138 2:122167610-122167632 GCCAGGGGGAGGTGGGGACAGGG - Intergenic
937775536 2:125771035-125771057 ACCAGGGAAGTGTGGGTAGAAGG - Intergenic
939106162 2:137951041-137951063 ACAAGTGGGTTTTGGTTACATGG + Intergenic
939179146 2:138783661-138783683 AATAGGGAGATGTGGGTACAAGG + Intergenic
941852356 2:170196438-170196460 CCCAGGAGGTTGAGGCTACAGGG + Intronic
943076716 2:183204651-183204673 AGCAGCCTGTTGTGGGTACAGGG + Intergenic
944793863 2:203162097-203162119 CCCAGGAGGTGGTGGTTACAGGG - Intronic
946124548 2:217550920-217550942 AGCAGGGGGCTGGGGCTACAAGG + Intronic
947077147 2:226357295-226357317 ACCAAGGGGTTTTAGGTAGATGG - Intergenic
947438424 2:230094096-230094118 ACCATGGCTTTGTGGGAACATGG + Intergenic
948403284 2:237700004-237700026 GACATGGGGTGGTGGGTACACGG + Intronic
949030833 2:241796613-241796635 AACAGTGGGATGTGGGGACATGG - Intronic
1169083242 20:2810477-2810499 ACCAGCGGTTTTTGGTTACAGGG + Intergenic
1170352086 20:15452718-15452740 GCCAGGGGCTTGTGGGTAGGTGG + Intronic
1170969190 20:21102365-21102387 AGCAGGGGGTTGTGGGTATGCGG - Intergenic
1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG + Intronic
1172940517 20:38650791-38650813 CCCCGGTGGTTGTGGGTTCAAGG - Intronic
1174334008 20:49844722-49844744 CCCAGGAGGTTGAGGCTACAGGG + Intronic
1175547879 20:59791019-59791041 ACCAGGGAGGTGAGGGTAGAAGG + Intronic
1176110526 20:63408657-63408679 ACCAGGGGGCAGTGGGTGCCAGG + Intronic
1176695646 21:9973902-9973924 ACAAGGGTTTTGAGGGTACAGGG + Intergenic
1177641296 21:23847405-23847427 ACAAGGGTGGTGTGAGTACAAGG - Intergenic
1179586476 21:42376756-42376778 ACCAGGGGGGTGAGGGAACGAGG + Intronic
1182067527 22:27441427-27441449 AGCAGGGGTCTGTGGGGACAGGG - Intergenic
1182518973 22:30874660-30874682 CCCAGGGGTTTGAGGGAACAAGG + Intronic
1183378383 22:37478345-37478367 CCCAGGGGGTCCTGGGGACAGGG + Intronic
1183451764 22:37899961-37899983 ACCAGGGGCTGGTGGGTAGGGGG - Intergenic
1183689923 22:39382747-39382769 ACCAGGGGGATGTGGGTGGAGGG - Exonic
1184145115 22:42605552-42605574 TCCAGTGGGTTCTGGGTAGAAGG + Intronic
1184173592 22:42773278-42773300 TACAGGGGGTTGAGGGAACAGGG - Intergenic
1185373790 22:50472887-50472909 CCCAGAAGGTAGTGGGTACAGGG + Intronic
950117117 3:10458308-10458330 ACCATGGGGTTGAGGTTACTGGG - Intronic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
951821576 3:26819725-26819747 ACAAGTGGTTTTTGGGTACATGG + Intergenic
953028961 3:39163855-39163877 CCCAGGGGGTTTTGGTTTCATGG + Intergenic
953478812 3:43231044-43231066 ACAAGTGGGTTTTGGTTACATGG - Intergenic
953716324 3:45319625-45319647 AACAGGGGGTGGTGTGTACATGG - Intergenic
953869802 3:46616370-46616392 ACAAGTGGGTTTTGGTTACATGG + Intronic
954494531 3:50943192-50943214 ACCAGGGGTTGGTGGGTAAATGG + Intronic
954678089 3:52326639-52326661 CCTACGGGGTTGTGGGGACAGGG - Intronic
955957157 3:64302767-64302789 ACCAAGGGGTCTTGGGTACATGG + Intronic
963007593 3:140740605-140740627 ACCAAGAGGCTGTGGATACAAGG + Intergenic
963127344 3:141827797-141827819 GCAAGGGGCTTGTGGCTACAGGG + Intergenic
963546425 3:146664563-146664585 AGCAAGGGGTTGTGGATTCAAGG + Intergenic
965578679 3:170244577-170244599 AGGAGGGGGTTGTGGGTGTAGGG + Intronic
968899197 4:3423026-3423048 ACCAGCAGGTGGTGGGCACACGG - Intronic
969513433 4:7632676-7632698 GCCGGGGGGCTCTGGGTACAGGG - Intronic
970950046 4:21744226-21744248 ACCAAGGGGTTGTAGGCAGAGGG - Intronic
973774082 4:54229929-54229951 ACCAGGGGGAGGTGGGGAGAGGG + Intronic
975565536 4:75750360-75750382 GACAGGAGGTTGTGGCTACAGGG + Intronic
975721103 4:77249507-77249529 ACCAGGGGGTAGAGGGTATTTGG - Intronic
977270299 4:94909842-94909864 TCCAGGTGGCTGTGGTTACATGG + Intronic
977763338 4:100766895-100766917 AACAGGTGGTTTTTGGTACATGG - Intronic
978114023 4:104997542-104997564 ACCAGATGGTTGTAGGTGCATGG + Intergenic
980368268 4:131834135-131834157 ACAAGGGTTTTGAGGGTACAGGG + Intergenic
983368410 4:166826002-166826024 AACAGGTGGTTTTGGTTACATGG - Intronic
983385764 4:167058844-167058866 ACCAGGTAGTTGTAGATACATGG - Intronic
984944750 4:184962197-184962219 ACCAGTGGTTTTTGGTTACATGG + Intergenic
985882479 5:2649361-2649383 GTCAGGGGGTTGGGGGCACACGG - Intergenic
986624972 5:9715405-9715427 ACCAGGAGGCTGTGGGTATGAGG + Intergenic
987167007 5:15209611-15209633 ATCAGGGGCTTGAGGTTACAGGG - Intergenic
987544613 5:19297206-19297228 ATCAGGGGGTTCAGGGTTCAGGG - Intergenic
988890021 5:35605677-35605699 AACAGGTGGTTTTGGTTACATGG - Intergenic
990091639 5:52058350-52058372 ATCAGGTGGTTGTAGGTATATGG + Intronic
990379662 5:55210500-55210522 CCCAGGAGTTTGTGGTTACAGGG - Intergenic
990828968 5:59935015-59935037 ACCTGGTGGTTGTGGGCAGATGG + Intronic
992247981 5:74847293-74847315 ACCAGGGGGTGGTGGGGGGAAGG - Intronic
992458004 5:76933891-76933913 ACCAGGTGGTTGGGGGAAGAAGG - Intergenic
994204829 5:97023069-97023091 ACCAGGGGCTGGTGGGGAGAGGG - Intronic
995550896 5:113280257-113280279 ACCTGGGGGTGGTGGGTTCCAGG + Intronic
996996750 5:129705989-129706011 AGCAGGAGGTTTTGGTTACATGG + Intronic
999779539 5:154837940-154837962 GCAAAGGGGTTGTGGGTAAAAGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006457495 6:34140305-34140327 ACCAGGGGGCAGTGGGGAGAGGG + Intronic
1007303488 6:40886581-40886603 ACCAAGGGGGTGTGGATAGAAGG + Intergenic
1007634036 6:43287410-43287432 ACCAGGGTGTTGTTGGTCCTGGG - Exonic
1007677453 6:43608602-43608624 CCCAGGAGGTTGAGGCTACAAGG - Intronic
1007722851 6:43895548-43895570 AGGAGGGGGGTGTGGGGACAGGG + Intergenic
1007842259 6:44726411-44726433 GCCAGGGGGGTGGGAGTACAGGG + Intergenic
1007957816 6:45933236-45933258 ACCAGGAGGTGGTGGGAACTAGG + Intronic
1008215087 6:48778540-48778562 GCCTGGGGGTGGTGGCTACAAGG + Intergenic
1009511739 6:64559906-64559928 ACCTGAGGGTAGAGGGTACAAGG - Intronic
1011594252 6:89001264-89001286 CCCAGGGGTTTGAGGTTACAGGG - Intergenic
1013381012 6:109570532-109570554 ACAAGTGGGTTTTGGTTACATGG - Intronic
1013523908 6:110957326-110957348 CCCAGGAGTTTGAGGGTACAGGG + Intergenic
1013837217 6:114346593-114346615 AGCATGGAGATGTGGGTACAGGG - Intergenic
1014014210 6:116511145-116511167 ACAAGTGGGTTTTGGTTACATGG - Intronic
1014193979 6:118531199-118531221 ATCAGGTGGTTGTGGGTGAATGG - Intronic
1015524236 6:134160218-134160240 TCCAGGGGTCTGAGGGTACATGG + Intergenic
1016473108 6:144396360-144396382 ACCAGGGGCTGGTGGGTATGGGG + Intronic
1017045684 6:150345255-150345277 ACCTGGGGGTTGATGGTGCAGGG - Intergenic
1017695564 6:157012346-157012368 ACCAGGCAGTTGTGAGAACATGG + Intronic
1017913747 6:158817327-158817349 ACCTGGGGGTTGTAGGCACAAGG - Intronic
1018829477 6:167432304-167432326 TCCAGGAGTTTGTGGTTACAAGG - Intergenic
1020561413 7:9732379-9732401 AATAGAGGGTTTTGGGTACATGG - Intergenic
1024045313 7:45581646-45581668 ACAAGGGGGTTATGTGGACATGG - Intronic
1026369059 7:69680606-69680628 ACCAGGGGCTGGAGGGAACAAGG - Intronic
1027737409 7:81951381-81951403 AACAGGTGGTTTTGGTTACATGG + Intronic
1028015435 7:85705308-85705330 ACAAGTGGTTTGTGGTTACATGG + Intergenic
1028179612 7:87703533-87703555 ACCAAGGGGTTGTAGCAACAAGG + Intronic
1028913394 7:96232430-96232452 ACCAGAGGGTGGAGGGTAGAAGG + Intronic
1031508659 7:122620980-122621002 CCCAGGAGGTTGAGGGTACATGG - Intronic
1032633329 7:133678684-133678706 CCCAGGAGGTTGAGGATACAGGG - Intronic
1035543770 8:462857-462879 ACAAGTGGGTTTTGGTTACATGG - Intronic
1037118622 8:15256164-15256186 CCCAGGAGGTTGAGGATACAGGG + Intergenic
1037416716 8:18659109-18659131 ACTAGGGGGTTGTGGGGAGGTGG + Intronic
1040364430 8:46700563-46700585 ACCAGATGGTTGTAGATACATGG + Intergenic
1041932039 8:63297387-63297409 AACAGGGGGTGGTGGGGACTGGG + Intergenic
1042084584 8:65093627-65093649 AACAGGTGGTTGTTGTTACATGG - Intergenic
1044074903 8:87808422-87808444 AACAGGTGGTTTTGGTTACATGG - Intergenic
1046973906 8:120252221-120252243 ACAAGGGGTTTTTGGTTACACGG + Intronic
1048429327 8:134354275-134354297 ACCAGTTGGTTGTGGGTATGTGG + Intergenic
1050045680 9:1542349-1542371 ACAAGTGGTTTCTGGGTACATGG + Intergenic
1050571376 9:6942939-6942961 ACCAGGAGGTTGGGGCTACAAGG - Intronic
1050677402 9:8071506-8071528 ACCAGGGGGTTTTGTGCACAGGG - Intergenic
1050840230 9:10139733-10139755 ATCAGATGGTTGTAGGTACAGGG - Intronic
1051115797 9:13693104-13693126 ACCAGGTGGTTGTAGGTATGTGG + Intergenic
1053057149 9:35000063-35000085 ACCAGGGGGTCTTGCTTACAAGG + Intergenic
1053632630 9:39959859-39959881 ACAAGGGTTTTGAGGGTACAGGG + Intergenic
1053773130 9:41503672-41503694 ACAAGGGTTTTGAGGGTACAGGG - Intergenic
1054211258 9:62290838-62290860 ACAAGGGTTTTGAGGGTACAGGG - Intergenic
1054313720 9:63558008-63558030 ACAAGGGTTTTGAGGGTACAGGG + Intergenic
1055337283 9:75245827-75245849 ACCAGGTGGTTGTAGGTATGTGG + Intergenic
1055931088 9:81560473-81560495 ACCTGAGGGTGGTGGTTACATGG + Intergenic
1057151725 9:92801872-92801894 ACAAGTGGGTTTTGGCTACATGG + Intergenic
1059582765 9:115569153-115569175 ACCAGTGGTTTTTGGTTACATGG - Intergenic
1059681299 9:116589112-116589134 TCCAGGGGGGTGTGGTCACAGGG + Intronic
1060894205 9:127207301-127207323 ACCAGGAGCTTGTGGGAACCTGG - Intronic
1061522083 9:131124701-131124723 CCCAGGAGGTTGAGGCTACAGGG - Intergenic
1185940501 X:4313719-4313741 ACAAGTGGGTTTTGGTTACATGG - Intergenic
1186411077 X:9344794-9344816 ACCAGGGAGTTGGAGGTTCAAGG - Intergenic
1187085123 X:16034660-16034682 CCCAGGAGGTTGAGGCTACAGGG - Intergenic
1187934381 X:24321617-24321639 ACCTGGGACTTGTGGGTAAATGG + Intergenic
1189158676 X:38787338-38787360 AAAACTGGGTTGTGGGTACATGG - Intergenic
1189584658 X:42446104-42446126 ACCGGTGGGTTTTGGTTACATGG - Intergenic
1200948318 Y:8867637-8867659 ACCAGGTGCTTGAGGGAACAGGG - Intergenic
1201723158 Y:17125033-17125055 CCCAGGTGGTTGAGGCTACAGGG + Intergenic