ID: 1118983798

View in Genome Browser
Species Human (GRCh38)
Location 14:70736160-70736182
Sequence TTAAGATTCTTTCATGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 278}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118983798_1118983807 27 Left 1118983798 14:70736160-70736182 CCCACACCATGAAAGAATCTTAA 0: 1
1: 0
2: 0
3: 22
4: 278
Right 1118983807 14:70736210-70736232 GGCCCAGGACAAAGATCCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1118983798_1118983802 6 Left 1118983798 14:70736160-70736182 CCCACACCATGAAAGAATCTTAA 0: 1
1: 0
2: 0
3: 22
4: 278
Right 1118983802 14:70736189-70736211 GGTCCTGTTTAAGCCAAGACAGG 0: 1
1: 0
2: 1
3: 6
4: 98
1118983798_1118983804 12 Left 1118983798 14:70736160-70736182 CCCACACCATGAAAGAATCTTAA 0: 1
1: 0
2: 0
3: 22
4: 278
Right 1118983804 14:70736195-70736217 GTTTAAGCCAAGACAGGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 137
1118983798_1118983806 26 Left 1118983798 14:70736160-70736182 CCCACACCATGAAAGAATCTTAA 0: 1
1: 0
2: 0
3: 22
4: 278
Right 1118983806 14:70736209-70736231 AGGCCCAGGACAAAGATCCCTGG 0: 1
1: 0
2: 4
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118983798 Original CRISPR TTAAGATTCTTTCATGGTGT GGG (reversed) Intronic
902053017 1:13579022-13579044 CTGAGGTTCTTTCATGGTGAGGG + Intergenic
906401230 1:45506338-45506360 TTAAAATGCCTTCAAGGTGTTGG + Intronic
906501628 1:46345389-46345411 TTAAGATTCTTACTTGCTTTAGG + Intronic
906769121 1:48468337-48468359 TTGAGATTCATCCATGTTGTTGG + Intronic
907013093 1:50983332-50983354 TTAAGACTCCTTCATGGATTGGG + Intergenic
907089174 1:51708865-51708887 TTAAGTTTCTTACATTGTTTGGG - Intronic
907400080 1:54219732-54219754 TCAAGTTTCTTCCATGCTGTTGG + Intronic
907951785 1:59190194-59190216 TCAAGGTTCATTCATGCTGTAGG - Intergenic
908008654 1:59753000-59753022 TTAAAAAGCTTTCATTGTGTGGG + Intronic
908595166 1:65680950-65680972 TTAAGATTCATCCATGTTGTTGG - Intergenic
908967635 1:69785757-69785779 TTCAGATTTTTTCATTGTTTGGG - Intronic
908991852 1:70101101-70101123 TTAATCTTCTTTCATAATGTGGG - Intronic
908998884 1:70194349-70194371 TTAATACTATTTCATGGTTTCGG - Intronic
909863220 1:80634250-80634272 TTAAGATTTTCTCCTGGTGGAGG + Intergenic
910875337 1:91873139-91873161 TTAAGATTTTTTTATGGAGATGG + Intronic
913457753 1:119050971-119050993 TTAATATTCATTTTTGGTGTTGG + Intronic
916868974 1:168891637-168891659 TTGAGATTCGTCCATGTTGTTGG - Intergenic
918578797 1:186099905-186099927 TTAAGATTCTTCCATTGCCTTGG - Intronic
919451975 1:197783310-197783332 TTCAGATTCTGTGATGATGTAGG + Intergenic
921446357 1:215251353-215251375 TTAATATTCTTTCAAAGAGTGGG - Intergenic
922337724 1:224631334-224631356 TTCATATTCTTTCAAGGTTTTGG + Intronic
922636581 1:227179022-227179044 TCAAGATTCAGTCATGTTGTAGG - Intronic
924299154 1:242619466-242619488 TTGAGATTCATTCATGTAGTTGG + Intergenic
1062950882 10:1502325-1502347 TAAACCTTCTTTCCTGGTGTGGG - Intronic
1063791183 10:9449934-9449956 TAAAGATTCATGCATGCTGTTGG + Intergenic
1064122000 10:12627680-12627702 TTGAGCTTCATTCATGCTGTTGG + Intronic
1064383393 10:14866618-14866640 TTAATATTCTTCCATGGTAAAGG + Intronic
1064750088 10:18519633-18519655 TTAACATTTTTACATGGTGATGG - Intronic
1065148254 10:22795105-22795127 TTGAGGTTCATTCATGTTGTTGG + Intergenic
1065159165 10:22901195-22901217 TTAAGGTTCTTTTATTTTGTGGG + Intergenic
1067155354 10:43776719-43776741 TTAGGAAACTTTCATGGTGATGG + Intergenic
1069244740 10:66190143-66190165 TCAAGATTCTTTCTTTGTTTTGG - Intronic
1070362476 10:75704479-75704501 TTAAGAATTTGTCATGGTGCAGG + Intronic
1071308556 10:84322112-84322134 TCAAGATTCATTCATGTTGTAGG - Intergenic
1071898599 10:90092904-90092926 CTTATATTCTTTCATTGTGTTGG - Intergenic
1073638852 10:105229524-105229546 TGAAGATGTTTTTATGGTGTTGG + Intronic
1073718598 10:106139109-106139131 CAAAGATTCTTTCTTGGTTTGGG - Intergenic
1075275756 10:121091012-121091034 TTAAGAATGTTTCATGGGGCTGG + Intergenic
1075294191 10:121259014-121259036 TTAATATTCTTTCTTGATCTGGG + Intergenic
1078331702 11:10427747-10427769 TTGAGATTCTTTCAACATGTGGG - Intronic
1080090562 11:28343177-28343199 ATAATATTTTTTCATGGGGTGGG + Intergenic
1080193536 11:29580155-29580177 TAAATATTCTTTCAGGGTATGGG + Intergenic
1080696502 11:34607422-34607444 TTAATATTACTTCATGGTCTAGG + Intergenic
1080799592 11:35598070-35598092 TTAGGTTTCTTTCATGGTAGTGG - Intergenic
1081099136 11:38979826-38979848 TTAAAATTCTTTCTTAGTCTTGG - Intergenic
1082682630 11:56195394-56195416 TCCAGATTCATTCATGTTGTTGG - Intergenic
1086298117 11:85394798-85394820 TTAGGAGGCATTCATGGTGTTGG - Intronic
1087567281 11:99877504-99877526 TTTAGATTTTTTAATGCTGTGGG - Intronic
1088180989 11:107110283-107110305 TTGAGATTCCTTTATGTTGTTGG - Intergenic
1090597126 11:128331997-128332019 TGATGATTTTTTCAGGGTGTTGG - Intergenic
1092909314 12:13132510-13132532 TTGAGATTCACTCATGTTGTTGG - Intronic
1094661575 12:32474436-32474458 TTAAGATTCATCCATGTTGTAGG - Intronic
1094747755 12:33365496-33365518 TTAAGATTTATCCATGTTGTAGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099020782 12:77401549-77401571 TTAAGATGTTTACATGGAGTTGG + Intergenic
1099321730 12:81159339-81159361 TTATTATTCTTTCCTGGTTTTGG - Intronic
1104559774 12:129833294-129833316 GAAATATTCTTTAATGGTGTAGG - Intronic
1104566047 12:129884967-129884989 TTAATATTCTTACAAGTTGTTGG - Intronic
1105303881 13:19156076-19156098 TTAAAAATCTTTCATGGAGACGG - Intergenic
1105698418 13:22914553-22914575 TTAAGATTCATCCATGTTTTTGG - Intergenic
1105850079 13:24326793-24326815 TTAAGATTCATCCATGTTTTTGG - Intergenic
1106679841 13:31998656-31998678 TCCAGACTCTTTCAGGGTGTTGG + Intergenic
1106736822 13:32596331-32596353 TTGAGATTCATCCATGGGGTTGG + Intronic
1108207469 13:48105355-48105377 TTAAGATTCTTCCATGTCTTAGG - Intergenic
1108762212 13:53581988-53582010 TTGAGATTCTTTCAAGCCGTTGG + Intergenic
1109808427 13:67475135-67475157 TTAAAGTTCTTTCAGGATGTAGG - Intergenic
1109829465 13:67768650-67768672 TTCAGTTTGTTCCATGGTGTAGG - Intergenic
1110314617 13:74091779-74091801 TTAGGATTCACTCTTGGTGTTGG - Intronic
1111038427 13:82710112-82710134 TTATGGATCTTTGATGGTGTTGG - Intergenic
1112476972 13:99740210-99740232 CTATGATTCTTTAATGTTGTGGG + Intronic
1112741109 13:102473473-102473495 TCAAGATTCATCCATGTTGTAGG - Intergenic
1113251648 13:108459673-108459695 TTAACATTATTTAATGGTCTAGG + Intergenic
1114776189 14:25484614-25484636 TTCAGATTTTTGGATGGTGTAGG - Intergenic
1114894341 14:26968070-26968092 TCTAGATCCTTTCATGGTGATGG + Intergenic
1115870013 14:37789557-37789579 TTGATATTCATTAATGGTGTTGG + Intronic
1116162442 14:41286960-41286982 TTAAGATTGTTAGATAGTGTCGG - Intergenic
1116513949 14:45783732-45783754 ATAAGATTCTTATATTGTGTAGG + Intergenic
1117716554 14:58587449-58587471 TTAGGATTTGTTCATGGTGGTGG + Intergenic
1118703971 14:68462671-68462693 TTAAAATTCTTTGGAGGTGTCGG - Intronic
1118809668 14:69263741-69263763 TTAATATTCTGTCCTGCTGTCGG + Intronic
1118983798 14:70736160-70736182 TTAAGATTCTTTCATGGTGTGGG - Intronic
1121240848 14:92428870-92428892 TTAAGATTCGTCCATATTGTCGG - Intronic
1122840025 14:104454766-104454788 TTAAGATTCATCCATGTTTTTGG - Intergenic
1123811899 15:23935401-23935423 TTAAGAATTTTTCATGTTTTTGG + Intergenic
1125168207 15:36736384-36736406 TTGATATTCTTTCATGCTGGTGG + Intronic
1126356167 15:47798858-47798880 TTGAGATTCATTCATGTTGTGGG - Intergenic
1127338900 15:58020416-58020438 TTCAGATTTGTTCTTGGTGTGGG - Intronic
1127687126 15:61358468-61358490 TTAACATTCTTACATTGTTTGGG - Intergenic
1127715864 15:61648924-61648946 TTAAGATTTTTCCATGAAGTGGG + Intergenic
1128916569 15:71568036-71568058 TTAAGTTCCTTTCTTGGTATAGG + Intronic
1130771827 15:86931873-86931895 TTAAAATTCTTGAATGGTTTAGG + Intronic
1131711109 15:95057758-95057780 TTAAGATTCTTTCATTCGCTGGG + Intergenic
1132088258 15:98925457-98925479 TTAAGATTATTTCATGTTCATGG + Intronic
1134613997 16:15635539-15635561 TGAAGATTCTCCCATGGTATAGG - Intronic
1135001875 16:18783337-18783359 TGCAGTTTGTTTCATGGTGTAGG - Intronic
1135203495 16:20461214-20461236 CTAAGACTGTTTCATAGTGTAGG - Intronic
1135215508 16:20563723-20563745 CTAAGACTGTTTCATAGTGTAGG + Intronic
1137474577 16:48796421-48796443 TTATGGTTCTTTCATGGAATGGG + Intergenic
1138862652 16:60776641-60776663 TTGAGATTCATTCAAGTTGTTGG + Intergenic
1138949668 16:61896860-61896882 TTATGTTGCTTTCATTGTGTGGG - Intronic
1139037602 16:62966480-62966502 TAAATATTCTTCCATGGTGGTGG + Intergenic
1139935790 16:70570183-70570205 TTAAGGTTGTTTCTTGGTGCTGG + Intronic
1140399639 16:74660562-74660584 TTAATTTTCTTTCATAGTCTTGG - Intronic
1141009724 16:80386282-80386304 GAAGGATTCTTTCAGGGTGTAGG + Intergenic
1144110120 17:12022244-12022266 TTAAAATTATTTCATGGGGAGGG - Intronic
1145376355 17:22352343-22352365 TTGAGATTCTTTAATTGTATGGG - Intergenic
1146300014 17:31680539-31680561 TTAAGAATCTTTCATTGTTTTGG + Intergenic
1148410597 17:47463474-47463496 TTATTAGTCTTTCATGATGTCGG - Intergenic
1150178538 17:63089354-63089376 TTAAGATACTTTCATTCTGGAGG + Intronic
1150690234 17:67359886-67359908 CTAAGATTCTTTCATCTTTTAGG - Intronic
1151444555 17:74154692-74154714 TTAAGATTTTTTCATAGTTCTGG - Intergenic
1152370100 17:79881711-79881733 CTGAGATTCATTCATGCTGTTGG + Intergenic
1153132157 18:1866635-1866657 TTAAGGTTCATCCATGTTGTGGG - Intergenic
1153326222 18:3822978-3823000 TTAAGATTCTAGTATGATGTAGG + Intronic
1154961204 18:21310629-21310651 CTGAGATCCTTTCAGGGTGTCGG - Intronic
1157257062 18:46148951-46148973 TTAAGATACTTTCAAAGTGAAGG + Intergenic
1158740575 18:60137109-60137131 TTATGATTTTTTCATCTTGTGGG + Intergenic
1162509305 19:11107905-11107927 TTAATTTTTTTTCATGGGGTGGG - Intronic
1163219867 19:15911218-15911240 TTAAGCTTCTTCCATAATGTTGG + Intergenic
925757614 2:7148822-7148844 TTAAGATACTATGATAGTGTTGG + Intergenic
926325472 2:11781841-11781863 GCAAGATTCATTCATGTTGTTGG + Intronic
926764589 2:16313186-16313208 TTATGGTTCTTTCATTGTGTTGG + Intergenic
928557037 2:32437596-32437618 TTCAGATTCTTTTCTGGTTTTGG + Intronic
931189567 2:59987101-59987123 TTACAATTCTTTCCTGGGGTTGG + Intergenic
931785008 2:65610664-65610686 TTAAAATTCTGCCATGCTGTGGG + Intergenic
931823010 2:65971471-65971493 TGCACATTCTCTCATGGTGTGGG + Intergenic
931829973 2:66040636-66040658 GTAAGATTCCTTCAGAGTGTGGG + Intergenic
932164112 2:69490505-69490527 TTAAGGTTCATTCATGTTGTAGG - Intronic
932513634 2:72322265-72322287 TTGAGATTCATCCATGGTGTTGG - Intronic
933241974 2:79932029-79932051 TTCAGATTCTTTGATGAGGTTGG + Intronic
933932147 2:87163865-87163887 GTATGATGCTCTCATGGTGTTGG + Intergenic
934058846 2:88275382-88275404 TTAAGATTCTATGATGGTGGAGG + Intergenic
935015002 2:99173495-99173517 TTTAGCTTCTTTCATGATTTTGG + Intronic
935141357 2:100355694-100355716 ATAACATTGTTTCATTGTGTGGG + Intergenic
935612696 2:105042288-105042310 TTTAGATTCTTGCAGGCTGTCGG + Intronic
935717983 2:105955256-105955278 TTAAAATGGTTTCATGGAGTTGG - Intergenic
936360969 2:111801569-111801591 GTATGATGCTCTCATGGTGTTGG - Intronic
936894893 2:117416254-117416276 TTAACGTTCTTTCATGGTTTTGG + Intergenic
940394587 2:153173387-153173409 TTAGGATTCATTCAGGGTCTGGG + Intergenic
940448403 2:153806747-153806769 TTTAGACTCTTTAATGCTGTAGG + Intergenic
940747490 2:157584926-157584948 TTGAGATTCATTCATGTTGCTGG - Intronic
941209448 2:162618793-162618815 TTAAAATTAGTTCATTGTGTCGG - Intronic
941761065 2:169244033-169244055 TTAATATAATTTCATGTTGTGGG - Intronic
941802904 2:169680610-169680632 TTGAGATTCATTCATGTTGTGGG - Intronic
942210874 2:173668574-173668596 TTGAGATTCATTCATGTTATTGG - Intergenic
942962512 2:181849003-181849025 TTAAGATGCTTGCAGGGTGGAGG + Intergenic
943704984 2:191025031-191025053 TTATGATTCTTTGGTGGGGTGGG + Intergenic
944573474 2:201068636-201068658 TTAAGAATTCTTCATGGAGTTGG - Intronic
945008341 2:205433799-205433821 TTAAGATTCATCCCTGCTGTTGG + Intronic
945585508 2:211656770-211656792 TTGAGATCCATCCATGGTGTTGG + Intronic
946526491 2:220526256-220526278 TTAAAATACTTTTTTGGTGTGGG + Intergenic
948477640 2:238230780-238230802 TTAATATTCTTTCAAGGTTAAGG + Intronic
948673367 2:239583014-239583036 TTCAGATTCTTTCCTGAAGTTGG + Exonic
948759058 2:240179353-240179375 TTAAGAGGCTGTCATGGTGATGG + Intergenic
948812811 2:240493498-240493520 TGAAGATGCATTTATGGTGTTGG + Intronic
949081449 2:242103827-242103849 TTAAGATTCATCCATGTTGTGGG - Intergenic
1170079946 20:12463689-12463711 TTAATATTCATGCTTGGTGTGGG - Intergenic
1170176442 20:13475292-13475314 TTAAGGTTCATTCATGCTGATGG + Intronic
1170650227 20:18232770-18232792 TTGAGGTTCATTCATGTTGTGGG + Intergenic
1170726196 20:18929192-18929214 TTATGATTCTTTCTTGTTCTGGG - Intergenic
1171359929 20:24580188-24580210 TGATGAGTCTTTCTTGGTGTTGG + Intronic
1171812621 20:29757440-29757462 TTAAAATTCTTCAATGGTGCAGG + Intergenic
1172430766 20:34889552-34889574 TTAAGATTGTCTAGTGGTGTGGG - Intronic
1181946358 22:26520716-26520738 TTAAACTTCATACATGGTGTTGG - Intergenic
1184624797 22:45716870-45716892 TACACATTCTTTCATAGTGTTGG - Intronic
951501891 3:23397676-23397698 TTAAGATTTATCCATGTTGTAGG + Intronic
951706557 3:25549801-25549823 TTACCATTCTTTCATGGTCATGG + Intronic
952093404 3:29919662-29919684 TTGGGATGCCTTCATGGTGTAGG + Intronic
952387024 3:32849218-32849240 TAAACATTGTTTCATGGTGAAGG + Intronic
953596285 3:44318027-44318049 TTCACATTATTTCATGGTGCAGG + Intronic
953796374 3:45989237-45989259 TTAACATTCTTTCTTGGTCAGGG - Intronic
955429983 3:58832748-58832770 TAAATATTATTTCATGGTATAGG + Intronic
957138012 3:76314317-76314339 TTTAGACTTTTTCATGGTGAAGG - Intronic
957223617 3:77415049-77415071 TAAATATTCTTTCCTGTTGTGGG - Intronic
957254901 3:77824600-77824622 TTAAGATTCTTTCCTTGGATTGG + Intergenic
958078048 3:88709676-88709698 TTGAGATTCATCCATGTTGTTGG - Intergenic
958107147 3:89090747-89090769 TTCAGATTCATTCATGTTGTTGG - Intergenic
961235758 3:125365418-125365440 TTTAGTTTCTTTCATGTAGTAGG - Intronic
961399192 3:126623175-126623197 TTCAGTTTCTTTAATGGTATAGG - Intronic
963080063 3:141383308-141383330 TTAAGATTTTTTAATGAGGTTGG - Intronic
965193503 3:165562679-165562701 TTAAGATTCCTTCATTATATGGG + Intergenic
966066406 3:175827245-175827267 TTAAGTATGTTTCATGGTGCAGG - Intergenic
966218446 3:177526911-177526933 TGAAGATTGTTTCAAAGTGTTGG - Intergenic
966411680 3:179652396-179652418 TCAAGATTTTTTCAGGGCGTCGG - Intergenic
967711134 3:192709642-192709664 TTAAGACTCTATTATGGTGCTGG + Intronic
967822116 3:193848003-193848025 TTAAGATTCATTCATGGGCCTGG + Intergenic
968402616 4:311684-311706 TTATGATTATTTCAGGGGGTGGG + Intergenic
972037611 4:34546370-34546392 TTAAGATTCCTTCAAAGTTTGGG + Intergenic
973018228 4:45167940-45167962 TTGAGCTTTTTTCATGTTGTTGG + Intergenic
973129183 4:46628739-46628761 TTATGATTTTTTCTTGGTCTGGG - Intergenic
973297894 4:48546298-48546320 GTGAGATTCTTTCATGTTTTAGG - Intronic
974638789 4:64602011-64602033 TTAAGATTCATCCACAGTGTTGG - Intergenic
974849148 4:67384780-67384802 TTAATATCCTTTCCTGGTTTTGG - Intergenic
975797211 4:78019811-78019833 TCAAGATTATTCCATGGTGTGGG + Intergenic
977755018 4:100659026-100659048 GTAAGTTTATTTCATGTTGTTGG - Intronic
978182856 4:105822214-105822236 TTAAGATGTTTTTATGTTGTGGG + Intronic
979121363 4:116906036-116906058 TTAAGCTTCTTACAATGTGTTGG - Intergenic
979287110 4:118938495-118938517 TTAAGATGCTTACATATTGTAGG + Intronic
979582310 4:122375159-122375181 TTAAGATTCATCCACGTTGTTGG - Intergenic
979905855 4:126291158-126291180 TCAAGCTTCATTCATGTTGTAGG + Intergenic
980535137 4:134110322-134110344 TTAGGATACTTTGATAGTGTAGG + Intergenic
980675506 4:136073995-136074017 ATAACATTCTTTAATGATGTTGG + Intergenic
980677136 4:136100178-136100200 TTTCGTTTCTTTCATGTTGTTGG - Intergenic
980825268 4:138064458-138064480 CTAAGATACATTCATGGTGTTGG - Intergenic
982053062 4:151522639-151522661 TTAAGCTTGTTTGATGGTTTTGG - Intronic
982751861 4:159171694-159171716 TTAAGAATCTTTCATGGGATAGG + Intronic
983235707 4:165177007-165177029 TTAAGATTCTTTCCTATAGTAGG - Intronic
984356931 4:178672662-178672684 TTAAGATCCATTCATGTGGTGGG + Intergenic
984878692 4:184391544-184391566 TTAAGTTTCTTGCAGGTTGTTGG - Intronic
987533964 5:19161176-19161198 TTAAGATTCTTGCTTTTTGTTGG + Intergenic
988026782 5:25704413-25704435 CTAATTTTCTTTCATTGTGTTGG + Intergenic
988290905 5:29284934-29284956 TTAAACTTCTCTCATGGTTTTGG + Intergenic
989488533 5:42022000-42022022 TTTGGTTTCTTTCATGGTCTGGG + Intergenic
990686850 5:58313520-58313542 TTGAGAATCTTTCATGTTGCAGG - Intergenic
991329309 5:65476181-65476203 TTTAGTTTCTTGCATGCTGTTGG - Intronic
991513868 5:67412237-67412259 TTAAGATACTTTCATGTTTAGGG - Intergenic
992061691 5:73056335-73056357 TTAGGGTTCATTCTTGGTGTTGG + Intronic
995401205 5:111743921-111743943 TAATTATTCTTTCATGTTGTTGG - Intronic
995795103 5:115932743-115932765 TTGAGATTCCTCCATGTTGTTGG - Intergenic
995976868 5:118047176-118047198 TCAAGATTTTTTCATTGTTTTGG - Intergenic
996433813 5:123411806-123411828 TTAGGTTTCTCTCTTGGTGTTGG - Intronic
997168913 5:131694436-131694458 GTAAGATTCTTCCTTGGTGGTGG - Intronic
998823471 5:146077820-146077842 TTCATTTTCTTTCATGGTCTTGG + Intronic
999487423 5:152012232-152012254 TGAAGATTCTTCCATGTTGTAGG + Intergenic
1000167128 5:158661545-158661567 TTAAGATTCTCTCATTGTCTTGG - Intergenic
1000583314 5:163061703-163061725 TTAATATTCATTAATGGCGTTGG - Intergenic
1001445385 5:171778786-171778808 TTAGAATTCTTTCATGGCATTGG + Intergenic
1001905718 5:175471349-175471371 TTGAGATTTATCCATGGTGTTGG - Intergenic
1003666147 6:8113309-8113331 TAAAAATACTTTCATGGTGGAGG + Intergenic
1003801934 6:9679978-9680000 TTAAGATTAATCCATGTTGTAGG + Intronic
1004567154 6:16808563-16808585 TTAAGATTCTTTGTGGGGGTTGG - Intergenic
1005217640 6:23550394-23550416 CTAAGATTCTTTCATTATTTTGG + Intergenic
1007334471 6:41142760-41142782 TCAAGGTTCATTTATGGTGTAGG + Intergenic
1007649075 6:43406318-43406340 TGAAGTTTCATTCAAGGTGTTGG - Intergenic
1010146716 6:72678921-72678943 TGAAGATTCTTTCATTTTATTGG - Intronic
1010160907 6:72853691-72853713 TTAAGCTTCATTCCTGCTGTTGG - Intronic
1010957752 6:82109769-82109791 TTAACATTCCTTCATGATGAAGG + Intergenic
1012009218 6:93759222-93759244 TTAAAATTACTTCCTGGTGTTGG - Intergenic
1013743295 6:113314825-113314847 TGAAGATTCTTTCAGAGTGTGGG - Intergenic
1014354738 6:120392709-120392731 TTATGTTTCTTTCATGGTAGTGG - Intergenic
1015273643 6:131362527-131362549 TTTATATTCTTTCATGATTTGGG - Intergenic
1016625839 6:146167186-146167208 TTGAGATTCCTTCATGCTGTTGG + Intronic
1017555662 6:155563932-155563954 TTAGGATTCTCTCTTGGTGTTGG + Intergenic
1018293882 6:162324129-162324151 TTAAAATTTTTTCATGTTGCTGG - Intronic
1019648464 7:2143433-2143455 TTATGAGTCTTTCCTGCTGTTGG - Intronic
1023974471 7:45017872-45017894 CTTAGAATTTTTCATGGTGTAGG + Intronic
1025141867 7:56473586-56473608 TCAAGATTGTTTCATGCTTTTGG - Intergenic
1031238333 7:119206405-119206427 TTAAGAAACTGTCATGGGGTAGG - Intergenic
1031468496 7:122143254-122143276 TTAACATTTTTTGATGTTGTGGG - Intronic
1032620237 7:133522810-133522832 TTAAAATGCTTTCATTCTGTGGG + Intronic
1032662665 7:134003050-134003072 TTTAGATTCTTTCCAGGTTTAGG - Intronic
1033019205 7:137705416-137705438 CTGAGATTCATTCATGTTGTTGG - Intronic
1036538035 8:9671450-9671472 TTAAGTTTCGTCCATGTTGTTGG - Intronic
1038460487 8:27712265-27712287 TTAAGATTCTTCCATGTGGCCGG + Intergenic
1038467942 8:27783270-27783292 TTAAGGTTCATCCATGTTGTTGG + Intronic
1038876944 8:31560900-31560922 TTTTGATTTTGTCATGGTGTTGG - Intergenic
1038918921 8:32060407-32060429 TTCACATTCTTTTATGGTGGAGG - Intronic
1040700018 8:50051933-50051955 TTAAAAATATTTCATGGTGATGG + Intronic
1042021232 8:64372664-64372686 TTAAGTCTCTTTTATGGGGTGGG - Intergenic
1043188015 8:77179776-77179798 TTTAGATTGTTACATGGTCTGGG + Intergenic
1044021435 8:87110481-87110503 TTGAGATTCTTTCTTTGTGATGG + Intronic
1044840500 8:96333015-96333037 TCAAGAGTCTTTCCTGATGTCGG + Intronic
1048262759 8:132959474-132959496 TTAAGATTCATTAATGATGCTGG + Intronic
1050199095 9:3123064-3123086 TTAATTTTCTTTCATTTTGTAGG + Intergenic
1051456179 9:17261247-17261269 TGTAGATTCCTTCATGGAGTAGG + Intronic
1052546242 9:29884039-29884061 TCAAGGTTCATTCATGTTGTAGG - Intergenic
1053107151 9:35420355-35420377 TTAATGTTCTTTCCTGGTTTTGG - Intergenic
1053256306 9:36618790-36618812 TTAAGAGTGTCTCATAGTGTAGG + Intronic
1053338283 9:37298474-37298496 TTAAGATTCATCCCTGTTGTTGG - Intronic
1053878266 9:42565618-42565640 TTGAGGTTCATTCATTGTGTAGG - Intergenic
1053894394 9:42728749-42728771 TTGAGGTTCATTCATTGTGTAGG + Intergenic
1054233427 9:62536076-62536098 TTGAGGTTCATTCATTGTGTAGG + Intergenic
1054346294 9:63968630-63968652 TTCAGATTCTTTCATCCTATGGG + Intergenic
1056717911 9:89048368-89048390 TCAAGATTCACTCATGTTGTAGG - Intronic
1058142225 9:101369122-101369144 GTAAGTTTCTTTCAGTGTGTGGG - Intronic
1058160135 9:101561288-101561310 TAATGATTCTTTCATGATATGGG - Intronic
1060003401 9:119978741-119978763 TTAAGATAACTTCAAGGTGTTGG - Intergenic
1060082737 9:120666837-120666859 TTAAGATTCATCCATGTTCTTGG - Intronic
1203637698 Un_KI270750v1:128379-128401 TTAAGGTTCATGCATGTTGTAGG + Intergenic
1185709358 X:2290463-2290485 TTAAGAATCTTTAATGGTCTAGG + Intronic
1186328666 X:8508748-8508770 TTAAGATTGTTTACTGTTGTTGG + Intergenic
1190390468 X:49926160-49926182 TTAAAAATGTTTCATTGTGTTGG + Intronic
1192130996 X:68549874-68549896 TTAAGATTCATCCATGTTATTGG + Intergenic
1192423029 X:71050926-71050948 TCAAGGTTCATTCATGTTGTAGG - Intergenic
1192739574 X:73879942-73879964 TTAAGATTTTTTCTTGGGCTGGG - Intergenic
1193289980 X:79761702-79761724 TTCAGATTCTTTCATCTTGCAGG + Intergenic
1195778888 X:108438851-108438873 TTTAGAGTCTTTCAAGGTTTTGG - Intronic
1197034413 X:121856335-121856357 ATAAGATTTTTTCTTGTTGTAGG + Intergenic
1197122485 X:122908121-122908143 TTAAGATTCTTTCATCAGTTTGG - Intergenic
1197167504 X:123394064-123394086 TTAAGATTCATTTATTGTCTGGG + Intronic
1197461462 X:126747179-126747201 TCAAGATTCATCCATGTTGTAGG + Intergenic
1197684627 X:129426776-129426798 TGAAGATGCATTTATGGTGTTGG + Intergenic
1197896092 X:131317266-131317288 TCAAATTTCTTTCATGTTGTAGG - Intronic
1198551049 X:137745047-137745069 TTCAGTTTCTTTCATTTTGTAGG + Intergenic
1199267814 X:145848736-145848758 TTATTACTCTTTCATGGTGAAGG - Intergenic
1200314169 X:155114302-155114324 TCAGGGTTCTTTCATGCTGTAGG - Intronic
1200315254 X:155125636-155125658 TTAATATTCATTTATCGTGTGGG - Intronic
1201322944 Y:12720404-12720426 TTAAGAATCTTTTTTGGGGTGGG - Intronic
1201433628 Y:13932017-13932039 TTAAGATTGTTTATTGTTGTTGG - Intergenic
1202349981 Y:23979056-23979078 TATAGATTCTTTCATGTTGGGGG - Intergenic
1202520798 Y:25691065-25691087 TATAGATTCTTTCATGTTGGGGG + Intergenic