ID: 1118984022

View in Genome Browser
Species Human (GRCh38)
Location 14:70738294-70738316
Sequence ACGTCCGTCCCTTCTTCTTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118984009_1118984022 26 Left 1118984009 14:70738245-70738267 CCTTCATCTCCCGAGGCAAGCTC 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1118984022 14:70738294-70738316 ACGTCCGTCCCTTCTTCTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 92
1118984010_1118984022 17 Left 1118984010 14:70738254-70738276 CCCGAGGCAAGCTCCTTCTGACC 0: 1
1: 0
2: 1
3: 9
4: 159
Right 1118984022 14:70738294-70738316 ACGTCCGTCCCTTCTTCTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 92
1118984011_1118984022 16 Left 1118984011 14:70738255-70738277 CCGAGGCAAGCTCCTTCTGACCA 0: 1
1: 0
2: 2
3: 30
4: 185
Right 1118984022 14:70738294-70738316 ACGTCCGTCCCTTCTTCTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 92
1118984013_1118984022 4 Left 1118984013 14:70738267-70738289 CCTTCTGACCAAGCGTCCCTGGC 0: 1
1: 0
2: 2
3: 8
4: 109
Right 1118984022 14:70738294-70738316 ACGTCCGTCCCTTCTTCTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 92
1118984014_1118984022 -4 Left 1118984014 14:70738275-70738297 CCAAGCGTCCCTGGCCCCCACGT 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1118984022 14:70738294-70738316 ACGTCCGTCCCTTCTTCTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 92
1118984008_1118984022 27 Left 1118984008 14:70738244-70738266 CCCTTCATCTCCCGAGGCAAGCT 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1118984022 14:70738294-70738316 ACGTCCGTCCCTTCTTCTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118984022 Original CRISPR ACGTCCGTCCCTTCTTCTTT GGG Exonic
903162164 1:21496986-21497008 AGGCCAGTCCCCTCTTCTTTGGG + Intergenic
914348089 1:146816932-146816954 AGGTCTGTCAATTCTTCTTTGGG + Intergenic
915066136 1:153225597-153225619 ACATCTCTCCCTTCTCCTTTGGG + Intergenic
919866070 1:201783788-201783810 TCTTCCGTCTCTTCTTCTGTGGG - Exonic
924045987 1:240031108-240031130 AAGTGAGTCCCTTCTGCTTTTGG + Intronic
1063492709 10:6479593-6479615 ATATCCCTCCATTCTTCTTTTGG - Intronic
1063598421 10:7458493-7458515 ACCTCCGTCCCTTGTTGGTTGGG - Intergenic
1067464073 10:46481470-46481492 TCGTCTTTCCCTTCTTTTTTTGG - Intergenic
1067623122 10:47903181-47903203 TCGTCTTTCCCTTCTTTTTTTGG + Intergenic
1073895740 10:108155035-108155057 ACACCCTTCCCTTCTGCTTTGGG - Intergenic
1077528311 11:3082266-3082288 ACGTCTGTCCCTCCTCCTTTTGG + Intergenic
1080918784 11:36687920-36687942 ACATCAGTCCCTTCATCTGTAGG - Intergenic
1081335700 11:41863600-41863622 ACATGCTTCCCTTCTCCTTTTGG + Intergenic
1092318446 12:7444846-7444868 ATGTCCTGCCCTGCTTCTTTGGG + Intronic
1092640026 12:10495429-10495451 ACGGCCACCCCTTTTTCTTTTGG - Intergenic
1093059355 12:14587491-14587513 ACCTCAGTGCCTTCTCCTTTTGG - Intergenic
1094088845 12:26625837-26625859 AATTCCGTCCCTTTTTCTTGTGG + Intronic
1096160237 12:49370525-49370547 ATGTCCATCCCTTCTTTTCTGGG + Intronic
1103194853 12:119034775-119034797 ACTTTCGTCCCTGGTTCTTTTGG + Intronic
1105909127 13:24844418-24844440 ACCTCCCTCCTTCCTTCTTTGGG - Intronic
1106168208 13:27267819-27267841 ACTTCCTTCCCTTCCTGTTTGGG + Intergenic
1111811541 13:93097998-93098020 ACATCCTTTCCTTCTTGTTTTGG - Intergenic
1115648799 14:35388512-35388534 ACATCTCTCCCTTCTCCTTTGGG - Intergenic
1116525377 14:45897610-45897632 ACTCCCGTCCCTTCCTCCTTGGG + Intergenic
1118984022 14:70738294-70738316 ACGTCCGTCCCTTCTTCTTTGGG + Exonic
1118986094 14:70756100-70756122 AGGTCCTGCCCTTGTTCTTTCGG + Intronic
1119562968 14:75605640-75605662 ACTTCCTTCCCAACTTCTTTGGG + Intronic
1125929792 15:43592476-43592498 GGGTCCATCCCTTCTTCTTCTGG - Intergenic
1125932631 15:43611340-43611362 ACACCCTTCCCTTCTTCTTCAGG - Intronic
1125942959 15:43692308-43692330 GGGTCCATCCCTTCTTCTTCTGG - Intergenic
1125945729 15:43710802-43710824 ACACCCTTCCCTTCTTCTTCAGG - Intergenic
1132665815 16:1080889-1080911 GCGGCCGTCTCTTCTGCTTTGGG + Intergenic
1134477314 16:14586361-14586383 AAGTCCTTCTCTTGTTCTTTAGG - Exonic
1135207814 16:20497770-20497792 TTGTCCTTCCCTTCTTTTTTTGG - Intergenic
1135211085 16:20525930-20525952 TTGTCCTTCCCTTCTTTTTTTGG + Intergenic
1139985948 16:70898613-70898635 AGGTCTGTCAATTCTTCTTTGGG - Intronic
1142668948 17:1478570-1478592 ACGGCCCTCCCTTCTGCCTTGGG + Intronic
1149352680 17:55807452-55807474 CCGTCCTTCCCATCTCCTTTGGG + Intronic
1149619839 17:58035776-58035798 TCTTCCGTCACTTCTGCTTTTGG - Intergenic
1150723613 17:67634144-67634166 ACGTCCGTACCTCCTTCCCTGGG + Intronic
1152223223 17:79080730-79080752 ACGACCGTCCTTTCTTATTGCGG - Intronic
1158657185 18:59348494-59348516 TCTTCCCTCCCTTCTTCTCTGGG + Intronic
1158709512 18:59824846-59824868 ACATCTCTCCCTTCTCCTTTGGG + Intergenic
1159025262 18:63177754-63177776 ATCTCCGCCCCTTCTTCTTGGGG - Intronic
1160018360 18:75161471-75161493 AAGTCCGTACTTTCTGCTTTGGG + Intergenic
1166585458 19:43943285-43943307 ACCTCCTTTCTTTCTTCTTTTGG + Intergenic
928415830 2:31090777-31090799 ACTGCCTTCCCTTCATCTTTAGG - Intronic
931033933 2:58215567-58215589 ACTTCTGTTCCCTCTTCTTTAGG - Intronic
938656963 2:133444188-133444210 ACATCAGTCCTTCCTTCTTTTGG - Intronic
944614535 2:201447171-201447193 ACCTCCATCCCATCTTCCTTAGG + Intronic
1170402821 20:16006127-16006149 CCGCCCATCCCTCCTTCTTTAGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1175357855 20:58383032-58383054 ACCTCAGTGTCTTCTTCTTTTGG + Intergenic
1183004808 22:34892269-34892291 ACGTCCATCACTCCTTCTCTGGG - Intergenic
1185004740 22:48269054-48269076 GCCTCCCTCCCTCCTTCTTTCGG - Intergenic
950398124 3:12749686-12749708 TCTTCTGTCCCTTCTACTTTTGG + Intronic
952473898 3:33685622-33685644 ATTTCCTTCCCTTCTTTTTTAGG - Intronic
962643419 3:137412127-137412149 ACATCCTTTCCTTCTTCTTCAGG - Intergenic
966556503 3:181267438-181267460 ATGTCCTTTCCTTCTTCTTCAGG - Intergenic
967091387 3:186137641-186137663 ACAACCGTCCCTTCTCCTCTTGG + Intronic
969041748 4:4303108-4303130 ACGTCCTTCCCTTCTGCCTGTGG - Intronic
969910462 4:10440132-10440154 AGCTCCATCCCTTTTTCTTTAGG - Exonic
971331833 4:25688072-25688094 ACTTCCGTTCCTTTTTCCTTGGG - Intergenic
971379258 4:26081652-26081674 ATGCCCTTCCCTTCTTCTTGGGG - Intergenic
979384384 4:120047100-120047122 AGGTTCGTCCCTACTCCTTTTGG - Intergenic
981029935 4:140114043-140114065 AAGTCCTTCCCATCTTCTCTGGG + Intronic
982610534 4:157568652-157568674 AGTTCTGTCTCTTCTTCTTTAGG - Intergenic
983552575 4:169032497-169032519 CCCTCTGTTCCTTCTTCTTTGGG + Intergenic
989549630 5:42719019-42719041 ACATCCCTGCCTTATTCTTTTGG - Exonic
993773414 5:91961299-91961321 TCATCCCTCCCTTTTTCTTTTGG + Intergenic
996574121 5:124963321-124963343 AGGCCCTTCCCTTCTTTTTTGGG + Intergenic
1006642124 6:35494933-35494955 TTGTCCTTGCCTTCTTCTTTGGG + Intronic
1011071641 6:83392005-83392027 ATGTTTGTCTCTTCTTCTTTTGG + Intronic
1021493101 7:21242021-21242043 ACGTCTTTCTCTTCTTCCTTAGG + Intergenic
1026463327 7:70633158-70633180 ATGTCTCTCCCTTCTGCTTTAGG - Intronic
1032292282 7:130599153-130599175 ACTTCCATCCCTTATTCTTAAGG - Intronic
1034941409 7:155232696-155232718 CCGTCCGTCCTTTCTGTTTTAGG + Intergenic
1036827032 8:11985564-11985586 ACGTTCGTCCATTTTTCTATTGG + Intergenic
1037427286 8:18770140-18770162 ACATCTGTCCCTTTTACTTTAGG + Intronic
1038160116 8:25028845-25028867 ACTTCCATCACTTCTACTTTGGG + Intergenic
1038496276 8:28005631-28005653 ACTTTCTTCTCTTCTTCTTTTGG - Intergenic
1041489546 8:58417442-58417464 AAGTCTGTCTCTTCTTCCTTTGG + Intronic
1041510837 8:58653272-58653294 CCTTCCTTCCCTTCTTCCTTTGG - Intronic
1043244609 8:77981745-77981767 ACATCCCTCCCTTCCTCTTGAGG + Intergenic
1046093208 8:109527706-109527728 ACCTCTGTCTCTTCTTCTCTTGG + Intronic
1057262437 9:93592632-93592654 TTGTCCGTCCTTTCTTCTCTTGG + Intronic
1059238288 9:112781034-112781056 AAGTCCTTCCCTTGCTCTTTTGG + Intronic
1060170331 9:121456092-121456114 CCCTCCGTCACTTCTTTTTTGGG - Intergenic
1060283646 9:122229676-122229698 ATGCCCATCCCTTCTTCTCTAGG + Intergenic
1191766481 X:64704482-64704504 AAGTCAGGCCCTTCTTCTGTAGG + Intergenic
1192540497 X:71966360-71966382 ACATCCTTGCCTTGTTCTTTGGG + Intergenic
1192639526 X:72848547-72848569 ACCTCTGTCCCTTACTCTTTTGG + Exonic
1192642185 X:72872258-72872280 ACCTCTGTCCCTTACTCTTTTGG - Exonic
1193478260 X:81994608-81994630 CCGTCCCTCCCTTCTTCCTATGG + Intergenic