ID: 1118987167

View in Genome Browser
Species Human (GRCh38)
Location 14:70766424-70766446
Sequence ACCATAGGGTTCAGCGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118987164_1118987167 -6 Left 1118987164 14:70766407-70766429 CCTGTACATAAATGGAAACCATA 0: 1
1: 0
2: 3
3: 13
4: 177
Right 1118987167 14:70766424-70766446 ACCATAGGGTTCAGCGCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118987167 Original CRISPR ACCATAGGGTTCAGCGCTCA AGG Intronic
901877820 1:12176978-12177000 TCCATTGGGCTCAGGGCTCAGGG - Intronic
906636079 1:47411639-47411661 ACCATAGGATCCAGCACCCAGGG + Intergenic
922871242 1:228903693-228903715 AACATAGGGTTTAGCTCTCCAGG - Intergenic
1073886836 10:108049346-108049368 ACCATAGGGTAAAGAGATCAAGG + Intergenic
1074786622 10:116847876-116847898 ACCACAAAGTTCAGCCCTCAGGG - Intergenic
1076765025 10:132628405-132628427 ACCATAGGGCACAGGGCTCCAGG - Intronic
1085020708 11:73205083-73205105 TCCATAGGGTTCTGCCCTCCTGG + Intergenic
1089587524 11:119519875-119519897 AGCTCAGGGTTCAGGGCTCAGGG + Intergenic
1095502757 12:42858827-42858849 ACCATAGCTTTCAGCTATCAAGG + Intergenic
1095860173 12:46907963-46907985 ACCATGGGCTACAGCGCTCTGGG + Intergenic
1101490729 12:105207024-105207046 AGCTTAGGTTTCAGCCCTCAGGG + Intronic
1103904599 12:124320941-124320963 ATCACAGGGCTCAGCCCTCACGG - Intergenic
1108796879 13:54042988-54043010 ACCATAGGGTTCAGGGATTTGGG + Intergenic
1110640846 13:77821995-77822017 GCCAGAGGGTTCAGTGCTGAGGG + Intergenic
1112695401 13:101942896-101942918 AGCATAGGCTTCAGCCCTCAGGG + Intronic
1118987167 14:70766424-70766446 ACCATAGGGTTCAGCGCTCAAGG + Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1132693993 16:1194072-1194094 ACCACAGGCCTCAGCGCCCACGG - Intronic
1146628515 17:34453275-34453297 ACTATAGGGTCCAGCACTGATGG + Intergenic
1147387535 17:40091029-40091051 ACCAGAGGGTGCTGGGCTCAGGG + Intronic
1149188461 17:54030128-54030150 ACCATAGGCTACAGCACTCAGGG + Intergenic
1154172975 18:12063947-12063969 CCCATAGGCTTCAGGGCTGAGGG + Intergenic
1158182139 18:54728400-54728422 ACCATGGGCTTCACCCCTCAGGG - Intronic
1167535017 19:50044461-50044483 ACCATAGGGTTCAACGAGGAGGG - Intronic
938080310 2:128366612-128366634 ACCACAGGGTCCATCCCTCAAGG - Intergenic
944117132 2:196200744-196200766 ACCATAGGTTTCCGCTTTCATGG - Exonic
948129357 2:235589093-235589115 CCTCTTGGGTTCAGCGCTCAGGG + Intronic
948818106 2:240523825-240523847 AGCATAGGATTCAGCCCTGATGG + Intronic
1183976843 22:41517316-41517338 GCCATGGGGATCAGAGCTCAGGG - Intronic
960846465 3:122008488-122008510 AGCATAGGGTTCAGTGATCTGGG - Intronic
966395991 3:179503719-179503741 AACATAGGCTTCAGCCTTCATGG + Intergenic
969121528 4:4914791-4914813 TCCATAGGCTGCAGCACTCAGGG - Intergenic
976557834 4:86469179-86469201 ATCATAGGGCTCAAGGCTCAAGG - Intronic
980063903 4:128161212-128161234 ACCATAGGGTTCAACCTTTAGGG + Intronic
988043133 5:25912902-25912924 TCCTCAGGGTTCAGCCCTCAAGG + Intergenic
1001579030 5:172785893-172785915 ACCACAGGGTCCAGAGTTCAAGG + Intergenic
1005057788 6:21746146-21746168 ACCACAGCATTCAGGGCTCAAGG - Intergenic
1006979665 6:38136853-38136875 AACATATGGTGCAGAGCTCAGGG - Intronic
1018530005 6:164752376-164752398 AGCATAGGGTTCACCACTCCTGG - Intergenic
1018850651 6:167588087-167588109 ACCATAGGGGTCATCTCTCCTGG - Intergenic
1022112607 7:27240590-27240612 ACGAGAAGGTTAAGCGCTCAAGG + Intergenic
1025160410 7:56654514-56654536 ACCATAGGCTAAAGCGCTCTGGG + Intergenic
1035461624 7:159042764-159042786 TCCATGGGGGTCAGGGCTCAGGG + Intronic
1036747764 8:11422214-11422236 ACCATTGGGTTCAGCGAAAATGG - Exonic
1046042788 8:108927221-108927243 ACCATAGGATTCAATGGTCAGGG - Intergenic
1053846319 9:42241120-42241142 ACCATAGTATTCATCTCTCAGGG - Intergenic
1057514132 9:95706698-95706720 TCCTTAGGTTTCAGAGCTCAAGG + Intergenic
1190302659 X:49065539-49065561 TCCATGGGGTTCGCCGCTCAGGG - Exonic
1192066664 X:67891990-67892012 TCCACAGGGCTCAGCTCTCATGG - Intergenic
1196854664 X:119971500-119971522 TCCATAGGATTCAGGGCCCAGGG + Intergenic
1197358903 X:125473241-125473263 GCCATAGGGTCCTGCCCTCAAGG - Intergenic