ID: 1118989837

View in Genome Browser
Species Human (GRCh38)
Location 14:70787862-70787884
Sequence GTAGCAGCCCAGGTGTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 145}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118989837_1118989841 -2 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989841 14:70787883-70787905 ACATGCGAAGTCCTATACTAGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1118989837_1118989846 23 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989846 14:70787908-70787930 GATGTGAGGGGAGACAGAGATGG 0: 1
1: 0
2: 7
3: 95
4: 937
1118989837_1118989840 -3 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989840 14:70787882-70787904 TACATGCGAAGTCCTATACTAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1118989837_1118989844 10 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989844 14:70787895-70787917 CTATACTAGGGATGATGTGAGGG 0: 1
1: 0
2: 2
3: 5
4: 137
1118989837_1118989847 24 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989847 14:70787909-70787931 ATGTGAGGGGAGACAGAGATGGG 0: 1
1: 0
2: 7
3: 43
4: 552
1118989837_1118989845 11 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989845 14:70787896-70787918 TATACTAGGGATGATGTGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1118989837_1118989850 27 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989850 14:70787912-70787934 TGAGGGGAGACAGAGATGGGGGG 0: 1
1: 1
2: 3
3: 88
4: 1018
1118989837_1118989848 25 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989848 14:70787910-70787932 TGTGAGGGGAGACAGAGATGGGG 0: 1
1: 0
2: 5
3: 78
4: 699
1118989837_1118989849 26 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989849 14:70787911-70787933 GTGAGGGGAGACAGAGATGGGGG 0: 1
1: 1
2: 7
3: 117
4: 913
1118989837_1118989843 9 Left 1118989837 14:70787862-70787884 CCACCAAACACCTGGGCTGCTAC 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1118989843 14:70787894-70787916 CCTATACTAGGGATGATGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118989837 Original CRISPR GTAGCAGCCCAGGTGTTTGG TGG (reversed) Intronic
901462684 1:9400938-9400960 GTAGCAGCCCAGGGGCCTGGGGG + Intergenic
903330425 1:22594349-22594371 GTACCAGCCATGGTGTGTGGGGG - Intronic
904375823 1:30081859-30081881 GTAGCAGCCCAGAGGTCTGCAGG - Intergenic
906164110 1:43672869-43672891 GTTGGAGCCCACGTGTTTGGAGG + Intronic
906607234 1:47181080-47181102 GAAGGAGCACAGGTGTCTGGAGG + Intergenic
907518075 1:55006025-55006047 GTCACAGCCCAGGGGGTTGGTGG - Intronic
910569645 1:88684818-88684840 GTGGCAGGCCAGGGCTTTGGCGG - Intronic
911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG + Intronic
912704748 1:111903743-111903765 GGAGCAGCCCATGGGTCTGGGGG - Intronic
912716036 1:111984277-111984299 GTGGCAGCTCAGGAGTTTGAGGG - Intronic
914704156 1:150157791-150157813 GTAGTACCGCGGGTGTTTGGAGG + Intronic
917215577 1:172674908-172674930 GTTGCAGCCCTGGCTTTTGGTGG + Intergenic
918647161 1:186918128-186918150 GTACCAGGTCAGGTGTTTGAGGG + Intronic
918802361 1:188987378-188987400 CTAGAAGCCGTGGTGTTTGGAGG - Intergenic
921330624 1:214031913-214031935 GGAGCAACTCATGTGTTTGGTGG - Intronic
923139195 1:231147069-231147091 GTTGCTGCCCAGGTGTTAGAAGG + Intergenic
1064826346 10:19406978-19407000 GAAGCAGCACATGTGTTTGGTGG - Intronic
1066484840 10:35833392-35833414 GGAATAGCCCAGGTGTTTGGGGG - Intergenic
1067305439 10:45059916-45059938 GGAATAGCCCAGGTGCTTGGCGG - Intergenic
1067944086 10:50679561-50679583 ATGGCTGCCCAGGTGGTTGGGGG + Intergenic
1068939666 10:62668576-62668598 GCAGCAGGCCAGATGTTTTGGGG + Intronic
1069568592 10:69480184-69480206 GTGGCAGCTCTGGTGTTTGGGGG + Intronic
1070865580 10:79706431-79706453 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1070879373 10:79844562-79844584 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1071632481 10:87228652-87228674 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1071645930 10:87360870-87360892 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1072349526 10:94543799-94543821 GTGCCAGCACATGTGTTTGGTGG + Intronic
1073102143 10:101011983-101012005 GAAGCGGCCCAGGTCTGTGGGGG + Intronic
1076379870 10:130017621-130017643 GCAGGAGCCCAGGTGATGGGGGG - Intergenic
1079959381 11:26904237-26904259 GTAGCACCCCAGCTGTTTTGTGG + Intergenic
1080824998 11:35840552-35840574 CAAGCAGCCATGGTGTTTGGAGG + Intergenic
1081401366 11:42646958-42646980 GTGCCAGCCCAGGTGTTTAGTGG - Intergenic
1082090783 11:48088088-48088110 GTCCCAGCACAGGTCTTTGGAGG + Intronic
1083966016 11:66044218-66044240 GTTGCAACCAAGGTGTTTGCTGG - Intronic
1084983925 11:72850800-72850822 GTTTCAGGCCAGGTGTGTGGTGG + Intronic
1085426701 11:76411209-76411231 GGAGCAGCCCTGCTGTCTGGAGG + Intronic
1088651483 11:111961112-111961134 GGAGGAGCCCAGGAGTTTGCAGG + Intronic
1089098141 11:115936900-115936922 GTAGCAACCCAGGAGAGTGGTGG - Intergenic
1089349735 11:117815612-117815634 GTAGCAGCCGCGGTGACTGGCGG + Intronic
1095837675 12:46655983-46656005 GTAGCATCCCACATATTTGGGGG + Intergenic
1101029222 12:100643651-100643673 GTACCAGTTCAGGTGTTTGAGGG + Intergenic
1102137711 12:110589019-110589041 GATGCAGGCCAGGTGTGTGGTGG - Intergenic
1104872997 12:132014144-132014166 GTAGCTGCCCACGTGTAGGGTGG + Intronic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1107815570 13:44241715-44241737 GGGGCAGCTCAGGTGTTTGCTGG - Intergenic
1109803030 13:67402147-67402169 GTACCAGGTCAGGTGTTTGAGGG - Intergenic
1112003266 13:95231574-95231596 GAAGCAGCCCACGTGTGAGGAGG + Intronic
1114438246 14:22726099-22726121 GGAGCAGCCCATGTGTTGGGAGG - Intergenic
1115108943 14:29797671-29797693 GTAGCAGTGCAGGTGCTTCGAGG - Intronic
1118867902 14:69717808-69717830 GAGGCAGCCTAGGTGTCTGGGGG + Intergenic
1118989837 14:70787862-70787884 GTAGCAGCCCAGGTGTTTGGTGG - Intronic
1119434255 14:74587502-74587524 GAAACTGCCCAGGTCTTTGGGGG - Intronic
1119814967 14:77557839-77557861 GTAGCAGCCAAGTTGTTTCCAGG - Intronic
1122032550 14:98924063-98924085 GTTGCAGCCACGGTGTATGGTGG + Intergenic
1122240717 14:100365036-100365058 GTGGGAGCCCAGGAGTTTGAGGG + Intronic
1123488740 15:20763649-20763671 GTACCGGCTCAGGTGTGTGGAGG + Intergenic
1123923798 15:25089324-25089346 GTTGTATCCCATGTGTTTGGGGG + Intergenic
1124888229 15:33707188-33707210 GGAGAATCACAGGTGTTTGGTGG + Intronic
1127096276 15:55514871-55514893 GTACCAGGTCAGGTGTTTGAGGG + Intergenic
1129967962 15:79753568-79753590 GCAGAGGCCCAGGTGTGTGGGGG - Intergenic
1129974395 15:79809983-79810005 CCAGCGGCCCAGGTGTTGGGAGG + Intergenic
1130190037 15:81725534-81725556 GTAGCAGCCCCAGTGAGTGGTGG + Intergenic
1130410100 15:83639949-83639971 GGAGCAGCTCAGGTGGTTTGAGG + Intergenic
1202953585 15_KI270727v1_random:60007-60029 GTACCGGCTCAGGTGTGTGGAGG + Intergenic
1132543179 16:520984-521006 TTGGCAGCCCCGGTCTTTGGCGG - Exonic
1133132694 16:3687483-3687505 GTGGTAGACCTGGTGTTTGGTGG - Intronic
1133318300 16:4897631-4897653 GTAGCACCCCCGGTGCTGGGGGG + Intronic
1133341971 16:5042525-5042547 TGAGCAGCCCAGGTGGGTGGTGG - Intronic
1136044072 16:27601817-27601839 GCAGCAGCCCTGGGGTGTGGGGG + Intronic
1139400359 16:66676486-66676508 GTAGCTACCCCGTTGTTTGGTGG - Intronic
1140950559 16:79812868-79812890 GTGGCAGCCCTGGTGATTTGGGG - Intergenic
1143649445 17:8254443-8254465 GGAGCAGGCTAGGTCTTTGGAGG - Intronic
1144273422 17:13641968-13641990 TTTGCAGGTCAGGTGTTTGGGGG - Intergenic
1144650614 17:17004685-17004707 GCAGCAGCCCAGGGGCGTGGTGG - Intergenic
1147772473 17:42877568-42877590 GCAGCAGCCCAGGGGTTTTGTGG + Intergenic
1150736361 17:67743175-67743197 ACTTCAGCCCAGGTGTTTGGAGG + Intronic
1151748512 17:76024112-76024134 GTGGCAGCCCTAGTGTGTGGAGG + Exonic
1152350442 17:79781271-79781293 GAAGCTGCCCAGGGGATTGGTGG + Intronic
1152645070 17:81465066-81465088 GCAGCAGGCCAGGGGTTTGGGGG - Exonic
1152655140 17:81515729-81515751 GTAGCCGGCCAGGTGGTTGGCGG - Intronic
1156264064 18:35469983-35470005 GTAGAAGCCCATGTGCTTTGAGG - Intronic
1156269939 18:35521353-35521375 GTAGTTGGCCAGCTGTTTGGTGG - Intergenic
1157208044 18:45717275-45717297 GGGGCATCCCAGGTGGTTGGTGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161001192 19:1912119-1912141 GGAGCAGCCCAAGTGCTTGGAGG + Exonic
1161785463 19:6322529-6322551 GAGTCAGCCCAGGTGTTGGGAGG - Intronic
1161801605 19:6419395-6419417 GCAGCCTCCCAGGTGTTTAGGGG - Intronic
1162284174 19:9725892-9725914 GTACCAGGTCAGGTGTTTGAGGG + Intergenic
1163485047 19:17580529-17580551 GCAGGAGCCCAGGGGTCTGGCGG - Intronic
1165007272 19:32817508-32817530 GCAGCAGCCCAGGTGTGCGCAGG - Intronic
1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG + Intronic
1166777475 19:45321923-45321945 GCAGCACCCAAGGTCTTTGGCGG - Intronic
1167245278 19:48369366-48369388 GTCACAGCCCAGGGTTTTGGGGG + Intronic
1167796311 19:51711857-51711879 GCAGCTGCCCAGGTCTTAGGGGG + Intergenic
934114620 2:88775216-88775238 GCAGCTGGCTAGGTGTTTGGGGG + Intergenic
934632014 2:95936640-95936662 GCAGCTGGCTAGGTGTTTGGGGG - Intronic
934801489 2:97166581-97166603 GCAGCTGGCTAGGTGTTTGGGGG + Intronic
937904364 2:127045757-127045779 GCAGCAGCCCAGGTGCCTGAGGG - Intergenic
938576091 2:132606014-132606036 GCAGGAGCCCAGGTGGGTGGGGG + Intronic
946571601 2:221029784-221029806 GTGGCAGGCATGGTGTTTGGAGG + Intergenic
946881727 2:224183195-224183217 CTAACAGCCGAGCTGTTTGGGGG - Intergenic
948083599 2:235227577-235227599 GTAGGAGCCCAAGGGGTTGGAGG - Intergenic
1169415904 20:5416029-5416051 GTTGCAGCCCAGATCCTTGGAGG - Intergenic
1171005640 20:21462908-21462930 GAAGGAGCCCAGGAGTTTAGAGG - Intergenic
1175067895 20:56305651-56305673 GTACCTGCCCAGCTCTTTGGAGG + Intergenic
1175129867 20:56781070-56781092 CCAGCAGCCCTGGTGTATGGTGG + Intergenic
1175352836 20:58337663-58337685 GTAGAAGTCCAGGTGTTTGAAGG + Intronic
1175757313 20:61538028-61538050 TAAGCAGCCTAGGGGTTTGGAGG - Intronic
1178447744 21:32661011-32661033 GTACCAGGTCAGGTGTTTGAGGG - Intronic
1179090532 21:38261163-38261185 GGAGCTGCCCTGGTGTTGGGCGG + Intronic
1179921838 21:44511818-44511840 GTAGCAGCCCAGGGTGATGGGGG + Intronic
1182061869 22:27404257-27404279 GTAGCAGCCTGGGGGTTTGGAGG - Intergenic
1183241530 22:36661255-36661277 GTTGCTCCCCAGGTGCTTGGAGG - Intronic
1183538249 22:38415524-38415546 CAGGCAGCCCAGGGGTTTGGTGG + Intergenic
1183686308 22:39363204-39363226 GCAGGAGCCCTGGCGTTTGGTGG + Intronic
1183737155 22:39650475-39650497 GAATCACCCCAGCTGTTTGGGGG - Intronic
950686453 3:14621889-14621911 GTAGGGGCCCAGGAGTTGGGGGG + Intergenic
951165979 3:19485666-19485688 GTACCAGGTCAGGTGTTTGAGGG + Intronic
954441682 3:50525602-50525624 GAAGCAGCCCAGTAGTGTGGGGG - Intergenic
957682960 3:83461537-83461559 GTAGTAGCACAGCTGTTTGGGGG - Intergenic
964522369 3:157582974-157582996 GTACCAGGTCAGGTGTTTGAGGG + Intronic
966601953 3:181784552-181784574 TTAGCAAGACAGGTGTTTGGTGG - Intergenic
966862801 3:184239840-184239862 GGAGCAGCCCATGTGCTGGGAGG + Exonic
969099492 4:4758038-4758060 GCAGCAGTGCAGGTGTTTGCAGG + Intergenic
969527652 4:7712124-7712146 GTCGCAGCCTAGGTGGGTGGGGG - Intronic
975300257 4:72782213-72782235 GTAGCAGGCCATGGGTTAGGTGG - Intergenic
980445947 4:132907693-132907715 GTATCAGTCCAGATGTTTAGAGG + Intergenic
980780176 4:137483280-137483302 GTACCAGGTCAGGTGTTTGAGGG - Intergenic
982751042 4:159162311-159162333 GTTTGAGCCCAGGAGTTTGGGGG + Intronic
982947734 4:161647828-161647850 GTAGCAGGCCAGGTGGTTTTAGG - Intronic
983167981 4:164500623-164500645 CTAACAGCCCAGTTATTTGGAGG - Intergenic
985495338 5:201118-201140 GGAGGAGCCAGGGTGTTTGGGGG - Exonic
987861475 5:23492723-23492745 GTAGCAGCTCAGGTGTCTGTTGG + Intergenic
990644571 5:57829685-57829707 GTGGCAGCCCAGGTGTTCCTTGG - Intergenic
992325403 5:75655128-75655150 GTAGCAGCACAGGAGCCTGGAGG + Intronic
995462767 5:112420067-112420089 GGAGCAGCCCAGGTGCATGTGGG + Intergenic
995473860 5:112528877-112528899 GTACCAGGTCAGGTGTTTGAGGG - Intergenic
995683219 5:114743820-114743842 GCAGCAGCCCAGGCCTGTGGTGG - Intergenic
1002558962 5:180067491-180067513 GTAGCAGGACAGGGATTTGGTGG + Intronic
1002811170 6:631009-631031 GTTGCAGCCCAGGGCCTTGGAGG - Intronic
1007238173 6:40405977-40405999 GTCGCAGCCCAAGTGTTTGGTGG + Intronic
1009429371 6:63549223-63549245 GTAGCAGAGCAGCTGTTTGGTGG + Intronic
1014546860 6:122745254-122745276 GTACCAGGTCAGGTGTTTGAGGG + Intergenic
1018576477 6:165264897-165264919 GAAGAACCCCAGGTGTTTGATGG - Intergenic
1021487423 7:21182652-21182674 GTCCCAGGACAGGTGTTTGGAGG + Intergenic
1024550490 7:50558942-50558964 GGATCAGCCCAGGTGGGTGGAGG - Intronic
1026584856 7:71647828-71647850 GCTGCAGTCCAGGTGTCTGGGGG + Intronic
1029030832 7:97464767-97464789 ATAGCAGCACAGGTGTTTGGAGG + Intergenic
1032190024 7:129759538-129759560 GTAGCAGCCCAGTGGTTTTCAGG - Intergenic
1036459465 8:8939018-8939040 GTAACAGCACAGGGGTCTGGGGG + Intergenic
1036611710 8:10355979-10356001 GTAGCAGCCCAGGTCCTACGTGG + Intronic
1037823851 8:22148902-22148924 GTCGTGGCCCAGCTGTTTGGCGG - Exonic
1038682420 8:29681311-29681333 GGAGAAGGCCAGGTGGTTGGGGG - Intergenic
1041082674 8:54228188-54228210 GTGGCAGCCCAGGTGGTGAGAGG + Intergenic
1044742501 8:95342280-95342302 GGAACAGCCCACATGTTTGGAGG + Intergenic
1049355901 8:142187904-142187926 GTAGGAGCCCAGGTGTGGGAGGG - Intergenic
1051890385 9:21936238-21936260 GTCGCTTCCAAGGTGTTTGGAGG + Intronic
1056217168 9:84416110-84416132 GTAGCAGCCCAGGGGAGGGGAGG - Intergenic
1057010468 9:91596986-91597008 GGAGCAGCCCACGAGTTTCGTGG - Intronic
1062466232 9:136682842-136682864 GGAGCAGCCCAGGTGCCTGGGGG - Intronic
1188901776 X:35741488-35741510 TTAGGAACCCAGGTTTTTGGTGG + Intergenic
1190249443 X:48711005-48711027 GTGCCAGCTCAGTTGTTTGGGGG - Intergenic
1195148958 X:102045565-102045587 GTTGGAGAACAGGTGTTTGGAGG - Intergenic
1196827787 X:119754570-119754592 ATATCAGCACAGGTCTTTGGAGG + Intergenic
1197130072 X:122995128-122995150 GCAGTGGCCCAGGTGTCTGGTGG - Intergenic
1198439221 X:136645778-136645800 GTGGCAACCAAGGTTTTTGGAGG + Intergenic
1200394047 X:155972687-155972709 GTACCAGGTCAGGTGTTTGAGGG + Intergenic
1201555132 Y:15259262-15259284 GTACCAGGTCAGGTGTTTGAGGG - Intergenic
1201715158 Y:17036403-17036425 GTAACAGCCAATGTCTTTGGGGG - Intergenic