ID: 1118990378

View in Genome Browser
Species Human (GRCh38)
Location 14:70792153-70792175
Sequence GAGCATCCTGTTCAGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118990378_1118990383 12 Left 1118990378 14:70792153-70792175 CCCATCAACTGAACAGGATGCTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1118990383 14:70792188-70792210 GGTGGCTGCTAGCTAACCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 71
1118990378_1118990380 -9 Left 1118990378 14:70792153-70792175 CCCATCAACTGAACAGGATGCTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1118990380 14:70792167-70792189 AGGATGCTCTGAGACACGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 142
1118990378_1118990381 -6 Left 1118990378 14:70792153-70792175 CCCATCAACTGAACAGGATGCTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1118990381 14:70792170-70792192 ATGCTCTGAGACACGCCAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118990378 Original CRISPR GAGCATCCTGTTCAGTTGAT GGG (reversed) Intronic
908859339 1:68465423-68465445 GAGCAAACTGTTCTGTTCATGGG + Intergenic
915609103 1:156976773-156976795 GAGAATCCTATTCACTTTATTGG + Intronic
916547107 1:165816296-165816318 CAGCATCCTTTTCATTTGCTGGG - Intronic
916742559 1:167659172-167659194 GAGCATCTTTTTATGTTGATTGG + Intronic
919133359 1:193478173-193478195 GAGCATCCTGTTCATTTACATGG - Intergenic
919306219 1:195842250-195842272 GTGTATACTGCTCAGTTGATGGG - Intergenic
920619889 1:207534508-207534530 GAGTATGCTGTTCACTGGATGGG + Intronic
920621671 1:207553063-207553085 GAGTATGCTGTTCACTGGATGGG + Intronic
920623297 1:207570158-207570180 GAGTATGCTGTTCACTGGATGGG + Intronic
922794099 1:228330836-228330858 GTGTATACTGTTCAGGTGATGGG - Intronic
1062998133 10:1887964-1887986 GTGCATACTGTTCAGGTGACGGG - Intergenic
1068079155 10:52297839-52297861 AAGCATCCTGTTTTGTTGAGAGG - Exonic
1070639227 10:78154432-78154454 CATCCTCCTTTTCAGTTGATGGG + Intergenic
1070792335 10:79196850-79196872 CAGCATCCTGTTCTGCAGATGGG + Intronic
1071171749 10:82874224-82874246 TAGGATCCTGTTTAGATGATAGG + Intronic
1071811786 10:89190068-89190090 GTGTATACTGTTCAGGTGATAGG - Intergenic
1074129639 10:110562611-110562633 CAGCTTCCCCTTCAGTTGATGGG - Intergenic
1074879881 10:117647514-117647536 AAGCATCCTGTTCATCTGGTTGG - Intergenic
1078267242 11:9764455-9764477 CAGAATCCTGTTCAGATGAGAGG - Intergenic
1083249033 11:61453115-61453137 GAGCATCCTGTCCCTTGGATGGG + Intronic
1084889305 11:72228861-72228883 GGGTCTCCTGTTCAGTGGATGGG - Intronic
1088047216 11:105468762-105468784 GTGCATACTGTTCAGGTGATGGG - Intergenic
1088180126 11:107099780-107099802 GTGTATACTGTTCAGGTGATGGG + Intergenic
1088703437 11:112435919-112435941 GTGTATACTGTTCAGGTGATGGG + Intergenic
1089926910 11:122268309-122268331 CAGTAACCTGTTCAGTTTATCGG + Intergenic
1092976893 12:13753864-13753886 AAGCTTGCTGTTCAATTGATGGG + Exonic
1093362486 12:18247824-18247846 GAGCAGCCTGTAAAGTTGAGGGG - Intronic
1094822789 12:34239824-34239846 GAGCATCCTGCTCACCTGTTTGG - Intergenic
1095847446 12:46760660-46760682 GATCATCCAGTTCAGTTCCTTGG + Intergenic
1097265785 12:57744087-57744109 AATCATTCTGTTGAGTTGATTGG + Intronic
1098261055 12:68671122-68671144 GAGCATCTTTTTATGTTGATGGG - Exonic
1100678292 12:96892233-96892255 AAACATTCTGTTCAGTTTATTGG - Intergenic
1101274855 12:103188381-103188403 GTGTATACTGTTCAGGTGATAGG - Intergenic
1103410983 12:120711009-120711031 GAGGATCCAGTTCAGCTGAACGG - Intronic
1104160695 12:126177389-126177411 GTGTATACTGTTCAGGTGATGGG + Intergenic
1107683743 13:42876344-42876366 AGGCAGCCTGTTCAGTTGACTGG + Intergenic
1108576356 13:51794928-51794950 GAGCATCGTGTCCAGTGGACTGG + Intronic
1109822550 13:67677154-67677176 GTGTATACTGGTCAGTTGATGGG + Intergenic
1111148932 13:84222526-84222548 GGGCATGCTGTTCTGGTGATGGG + Intergenic
1112323921 13:98431000-98431022 GAGGGTCCTGTTCAGCTGAATGG - Intronic
1112642988 13:101297974-101297996 GAGCATCCCCTTCAGTTGGAAGG + Intronic
1114488505 14:23080085-23080107 CAGCATACTGTCCAGTTGGTAGG - Exonic
1114860626 14:26516198-26516220 GAAATTCCTGTTCAGTTGTTTGG + Intronic
1116724326 14:48543380-48543402 GTGCATACTGCTCAGGTGATGGG + Intergenic
1118990378 14:70792153-70792175 GAGCATCCTGTTCAGTTGATGGG - Intronic
1120459276 14:84773178-84773200 CAGCATCTTGTTCAGTATATGGG + Intergenic
1122859202 14:104574917-104574939 GAGGAGCCTGTTCAGTCGGTTGG + Intronic
1125286533 15:38099051-38099073 GAGCCTCCTTTTCAATTGTTTGG - Intergenic
1127979104 15:64021303-64021325 GAGCATTCCGTACAGTTGCTGGG + Intronic
1128217424 15:65944210-65944232 GAGCTTTCTGTTTAGTAGATGGG + Intronic
1128895087 15:71365685-71365707 GAGTTTCCTGTTCAGTTGGTGGG - Intronic
1130181124 15:81629546-81629568 GTGTATACTGCTCAGTTGATGGG + Intergenic
1131548451 15:93335412-93335434 GTGCATACTGCTCAGGTGATGGG - Intergenic
1131712166 15:95067878-95067900 CAGCAGCCTGTGGAGTTGATAGG + Intergenic
1135351420 16:21732429-21732451 GTGTATACTGTTCAGGTGATGGG - Intronic
1136243725 16:28960893-28960915 ATGCATCCTGTTAAGATGATAGG + Intronic
1138046827 16:53733449-53733471 GGGCGACCTGTACAGTTGATAGG + Intronic
1138631988 16:58303833-58303855 GTGCATACTGTTCAGGTGATGGG - Intronic
1139114353 16:63931450-63931472 GAGCAACCTTTTCATTGGATGGG + Intergenic
1139145505 16:64319961-64319983 GTGTATACTGTTCAGGTGATGGG - Intergenic
1139973314 16:70790000-70790022 GAGTCTCCTGTCCAGTTGCTCGG - Intronic
1149153806 17:53601862-53601884 GTGTATACTGTTCAGGTGATGGG - Intergenic
1153012594 18:552946-552968 GTGTATGCTGCTCAGTTGATGGG + Intergenic
1153811472 18:8755713-8755735 GAACATTCTGTTGACTTGATTGG - Intronic
1155725935 18:29083123-29083145 GTGCATACTGCTCAGGTGATGGG + Intergenic
1157156327 18:45270101-45270123 GAGCTTCCTCATCATTTGATAGG + Intronic
1158381510 18:56935221-56935243 GAGCATGCTGTTTAGTAGATTGG + Intronic
1159199147 18:65161141-65161163 GAGCATTTTATTCAGCTGATGGG - Intergenic
1159220498 18:65457549-65457571 GTGTATACTGTTCAGGTGATGGG + Intergenic
1159225986 18:65536685-65536707 GTGTATACTGTTCAGGTGATTGG + Intergenic
1159939019 18:74391864-74391886 CAGCATCCTGGCCAGCTGATGGG + Intergenic
925055196 2:851943-851965 GAGCAGCCTGCCCAGTTCATGGG + Intergenic
928914547 2:36457241-36457263 GTGTATACTGTTCAGGTGATGGG - Intronic
929147076 2:38716036-38716058 GAGCATCCTGCTCACCTGTTTGG - Intronic
929266012 2:39920123-39920145 AAGCATGCTGTTCAGTGGACTGG - Intergenic
929368917 2:41197018-41197040 GAGCATCTTGTTCATTTAAAGGG - Intergenic
934625612 2:95847966-95847988 GAGCTTTCTGTTCAGGTTATCGG + Intronic
939170872 2:138693778-138693800 GAGCAGGCTGTTCTGTTGATGGG - Intronic
940393451 2:153160323-153160345 GAGCTTATTATTCAGTTGATGGG + Intergenic
940708906 2:157138423-157138445 GTGTATACTGTTCAGGTGATGGG - Intergenic
944973929 2:205025784-205025806 GAGCATCGTGTTCGGTGGTTGGG - Intronic
1169884797 20:10387334-10387356 GGGCATCCTGTTCAGCTTCTTGG - Intergenic
1174851692 20:54001638-54001660 GAGAATGCTGATTAGTTGATTGG - Intronic
1177639269 21:23825693-23825715 GAGCATTCAGTTCAGTTTCTTGG + Intergenic
951268818 3:20601582-20601604 AAGCATAATGTTCAGTAGATAGG + Intergenic
951463460 3:22976545-22976567 GTGTATCCTGCTCAGGTGATGGG + Intergenic
954528921 3:51300936-51300958 GTCCATCCTTTTCAGTTGCTTGG + Intronic
955566193 3:60249467-60249489 CATCACCCTGTTCATTTGATTGG + Intronic
955586992 3:60489865-60489887 GAGCCTCCTGTTCAGTGCCTGGG - Intronic
957263014 3:77923909-77923931 GAGCAAACTTTTCACTTGATTGG - Intergenic
958012193 3:87894120-87894142 GTGCATACTGCTCAGCTGATAGG - Intergenic
958490117 3:94761975-94761997 GTGTATACTGCTCAGTTGATGGG - Intergenic
960017220 3:112905259-112905281 GTGTATACTGTTCAGGTGATGGG - Intergenic
964947384 3:162242830-162242852 GAGCATCCAGAGCAGTTAATTGG - Intergenic
965873887 3:173293785-173293807 GTGAATACTGTTCCGTTGATGGG - Intergenic
970562338 4:17294912-17294934 GAGTATACTGCTCAGGTGATGGG - Intergenic
972185836 4:36526945-36526967 GAGCATGCTGTTCAATTTTTAGG + Intergenic
972269517 4:37497027-37497049 GAGTATACTGCTCAGGTGATGGG - Intronic
978998951 4:115193827-115193849 GTGTATACTGTTCAGGTGATGGG - Intergenic
980176792 4:129355629-129355651 CAGCATCCTGTCAATTTGATGGG - Intergenic
981169690 4:141606637-141606659 GTGTATACTGTTCAGGTGATGGG - Intergenic
984111139 4:175616231-175616253 GTGCATACTGCTCAGGTGATGGG - Intergenic
987182158 5:15379422-15379444 GTGTATACTGTTCAGGTGATGGG + Intergenic
988441124 5:31234521-31234543 CAGCATCCTATACAGCTGATAGG + Intronic
993628256 5:90252069-90252091 CAGGATCCCCTTCAGTTGATGGG + Intergenic
993795835 5:92267219-92267241 GATCATCCTTTTCACTTGTTTGG - Intergenic
995510424 5:112903479-112903501 GTGTACCCTGCTCAGTTGATGGG + Intronic
997783341 5:136682511-136682533 CATCATCCATTTCAGTTGATTGG + Intergenic
999425498 5:151484747-151484769 GACCATCCTGTTTAGTAGTTGGG + Intronic
1003264940 6:4557399-4557421 GAGCATACTTTTCTGTTGTTAGG + Intergenic
1004835408 6:19526098-19526120 GTGTATACTGCTCAGTTGATGGG - Intergenic
1008905552 6:56673886-56673908 GAGGATGATGTTCAGTTTATTGG - Intronic
1009450740 6:63797585-63797607 TGGCTTCCTGTTCTGTTGATGGG + Intronic
1012846342 6:104394253-104394275 GAGGATGCTATTCAGCTGATAGG + Intergenic
1013702845 6:112795038-112795060 GAGCACCCTCTTGAGTTGAGTGG + Intergenic
1013898252 6:115120043-115120065 GAGCATACTGGGCAGTTGAGAGG + Intergenic
1015246312 6:131078483-131078505 GGGCATACTGCTCAGGTGATGGG + Intergenic
1018240016 6:161764357-161764379 AAGCATCCTGTCCATTTTATAGG - Intronic
1020807801 7:12812061-12812083 GTGTATACTGCTCAGTTGATGGG - Intergenic
1021635978 7:22693647-22693669 GACTATCCTTTTCCGTTGATTGG - Intergenic
1023156822 7:37259637-37259659 CCGCATCCTGTTCAGTTTCTAGG - Intronic
1027616632 7:80431963-80431985 GAGGAGTCTGTTCAGTTGGTTGG + Intronic
1031057917 7:117013997-117014019 GAGAAACCTGTTCAGTGGAAAGG + Intronic
1036794270 8:11743804-11743826 GAGCAGCTTGTTTAATTGATAGG + Intronic
1038904474 8:31883683-31883705 GATCCTGCTGTTCAGTTGGTTGG + Intronic
1038963949 8:32550552-32550574 TAGCATCCTGTTCAGGTAATAGG + Intronic
1039558255 8:38492439-38492461 GAGCATCTTCTTCTGTTTATTGG - Intergenic
1040450787 8:47544090-47544112 GAGGGTTCTGTTCAGTTGGTTGG + Intronic
1044394142 8:91689604-91689626 GTGTATACTGTTCAGGTGATGGG + Intergenic
1044726392 8:95197650-95197672 GGGCATCCTGGTCCGTGGATGGG + Intergenic
1047042035 8:121007099-121007121 GAATATACTGTTCAGGTGATGGG + Intergenic
1047678765 8:127231863-127231885 GAGATTCCTATTCAGTTGATCGG - Intergenic
1048353518 8:133634910-133634932 TAGCATCCTGTCCAGATGATGGG + Intergenic
1049003890 8:139842780-139842802 GGGCATCCTGGTCAGCTGGTGGG + Intronic
1049486249 8:142865171-142865193 GAGCTATCTGTTCAGTGGATGGG + Intronic
1050611468 9:7358432-7358454 GTGTATCCTGCTCAGGTGATGGG - Intergenic
1050977094 9:11952636-11952658 GAGAATCCTCTTTAGTTGATAGG - Intergenic
1052141562 9:24991630-24991652 GAGCCTACTGTTCAGGAGATGGG + Intergenic
1053211988 9:36237755-36237777 GAGTATACTGCTCAGGTGATGGG - Intronic
1055400205 9:75915306-75915328 GAGCAGCCTGTTCTGTTTATGGG + Intronic
1057611890 9:96551958-96551980 GAGAACCCTGCTCAGTTGGTTGG - Intronic
1057810058 9:98250726-98250748 GTGCTTCATGTTCAGTTGACAGG - Intronic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1061745670 9:132738451-132738473 GTGCCTCCTTTTCTGTTGATCGG + Intronic
1185786322 X:2894286-2894308 GTGTATACTGTTCAGGTGATGGG + Intergenic
1189276707 X:39791694-39791716 GAGCATCCTCTTCACCCGATTGG + Intergenic
1191806530 X:65141614-65141636 GTGTATACTGTTCAGGTGATGGG - Intergenic
1192820793 X:74643054-74643076 GTGCATACTGCTCAGGTGATGGG + Intergenic
1193153754 X:78151522-78151544 GTGTATACTGTTCAGGTGATGGG - Intergenic
1193747624 X:85301028-85301050 GAACATTCTGTTCTGTTTATGGG + Intronic
1194542980 X:95197863-95197885 GCGTATACTGTTCAGGTGATGGG - Intergenic
1194906426 X:99582279-99582301 GAGTATACTGTTCGGGTGATGGG - Intergenic
1194907270 X:99593612-99593634 GAGTATACTGTTCGGATGATGGG + Intergenic
1198279219 X:135125520-135125542 GGGTCTCCTGTTCAGTTGAAGGG + Intergenic
1198291738 X:135247000-135247022 GGGTCTCCTGTTCAGTTGAAGGG - Intergenic
1198801762 X:140455062-140455084 AAGTATCCTGTTCAAGTGATTGG - Intergenic