ID: 1118992046

View in Genome Browser
Species Human (GRCh38)
Location 14:70806223-70806245
Sequence CATCAGAGGGTGAACATGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118992046 Original CRISPR CATCAGAGGGTGAACATGGG CGG (reversed) Intronic
900784167 1:4637240-4637262 CAGAAGACGGTGACCATGGGAGG + Intergenic
901070145 1:6512881-6512903 CCTCACAGGGTGGCCATGGGGGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902134756 1:14295380-14295402 CATGAGAGGGAGAAGCTGGGAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904456730 1:30652212-30652234 CAGCAGAGGGTGGGCATAGGTGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909074983 1:71041918-71041940 CATCTGAGGGTGCAGAGGGGTGG - Intronic
909609038 1:77533864-77533886 CAGCAGAGGGCGAGCTTGGGAGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910912305 1:92249777-92249799 TACCAGAGTGTGAGCATGGGAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913080039 1:115375349-115375371 GGACAGAGGCTGAACATGGGAGG - Intergenic
913225239 1:116693345-116693367 CCTCAGAGGGTGAAGGGGGGAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914962888 1:152222031-152222053 CATCAGAGAGGAAACATTGGGGG + Intronic
916326238 1:163562947-163562969 TATCAGAGGGTGAGGGTGGGAGG - Intergenic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
918142312 1:181730033-181730055 CATCAGTGGGTGCTCCTGGGTGG + Intronic
918332792 1:183475220-183475242 AATAAAAGGGTGAACATGGGAGG + Intronic
918479745 1:184965640-184965662 TATCAGAGGGTGAACGGTGGAGG + Intronic
920754950 1:208720703-208720725 CATCAGAGAGTTGACATGGCAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923459695 1:234197565-234197587 CATCAGGGAGTGATCATGGAGGG - Intronic
1062966234 10:1609700-1609722 CAACACAGGGAGCACATGGGCGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064949179 10:20827917-20827939 TATCAGAGGGTGAAGAAGGAGGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070365661 10:75734368-75734390 CCTCAGAGGCTAAACATGGCGGG - Intronic
1071192238 10:83114745-83114767 CATCAGAGGGTGAAGCATGGTGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074296207 10:112191890-112191912 CAAAAAAGGGTGAAGATGGGGGG + Intronic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1077724004 11:4655289-4655311 CATGAAAGGCTGCACATGGGAGG - Exonic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079569092 11:21920897-21920919 CATCTGAGGCTGCACATGGGAGG - Intergenic
1080893143 11:36426997-36427019 GAGCAGAGGGTGGCCATGGGTGG - Intronic
1081292055 11:41338456-41338478 CATCTGAGGGAGAACATGAGGGG - Intronic
1083798793 11:65034588-65034610 ACTCAGAAGGTGAACAGGGGAGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087563889 11:99828421-99828443 CATCATATGGTGAAGATGGAAGG + Intronic
1088080890 11:105911862-105911884 CATCAGAGGCTGAAAAGAGGAGG - Intronic
1088385375 11:109248608-109248630 CATCAAAGGAGGAACATGAGTGG - Intergenic
1088968415 11:114749500-114749522 CATCAGCAGGTGGATATGGGAGG - Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091589771 12:1836243-1836265 CCTCAGAGTGTGAAGATGGTGGG + Exonic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093488997 12:19683550-19683572 CATCAGAGGGCAAACAATGGGGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1097102334 12:56598539-56598561 CATCAGCAGGTGAAAATGGCAGG + Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099397845 12:82163192-82163214 TATTAGAGCATGAACATGGGGGG + Intergenic
1100371177 12:93970369-93970391 CATCATAGGTTTAACATGTGAGG - Intergenic
1101969365 12:109302049-109302071 CATTAGTGGGTGATCATGAGTGG - Intronic
1101995129 12:109519916-109519938 GATCACTGGGTGAACATGGCAGG + Intronic
1103013803 12:117478540-117478562 CTTCATAGGCTGAAGATGGGAGG - Intronic
1104652695 12:130548035-130548057 CACCAGAGGGTGACCAGGGCAGG - Intronic
1105566852 13:21558187-21558209 CATCAGAGGCTTAACACTGGGGG - Intronic
1106682135 13:32018760-32018782 ACTCAAAGGGTAAACATGGGAGG - Intergenic
1108386015 13:49900186-49900208 CATCATAGGGTGTACATCGTAGG - Intergenic
1109527493 13:63596123-63596145 CATCAGAGAGGGGACATGGTGGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1118992046 14:70806223-70806245 CATCAGAGGGTGAACATGGGCGG - Intronic
1120906401 14:89624850-89624872 CTTCATAGGGTGAAGACGGGTGG - Intergenic
1121275523 14:92664920-92664942 CATCAGATCCTGAACATGAGGGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123097546 14:105773628-105773650 CATCAGAAGGTGAGCATGGCTGG - Intergenic
1125791062 15:42366041-42366063 TATCAGAGGGTGTCCATGGAAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126969954 15:54099536-54099558 CATCAGAATGTGAACATGAATGG - Intronic
1127425325 15:58850206-58850228 AATCTGAGTGTGTACATGGGAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1131424395 15:92333868-92333890 CATCAGAGGGGACATATGGGTGG - Intergenic
1133284837 16:4685872-4685894 CATGAGATGGTGAACACTGGGGG + Intronic
1133843746 16:9435450-9435472 CATCAGAAGGTGAGCATGGCTGG + Intergenic
1135135182 16:19882118-19882140 TATCAGAGGGTGAGAATTGGGGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144218641 17:13080128-13080150 CCTCAAATGGTGAACATGGCTGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146766049 17:35522694-35522716 CAGAAGCTGGTGAACATGGGGGG - Intronic
1147771620 17:42872146-42872168 CCTCAGAGGGAGGACATTGGTGG + Intergenic
1148082847 17:44976975-44976997 CCTCTGAGGGTGGACATGGAGGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152160803 17:78667399-78667421 CCTCAGAGGGTGGGCTTGGGAGG + Intergenic
1152353444 17:79795634-79795656 CATCATAGGGTAAAGATAGGAGG - Intronic
1157600802 18:48892176-48892198 CATCAGCAGGTGAACACGGCAGG + Intergenic
1157690073 18:49674420-49674442 TATAAGAGGGAGAACAAGGGAGG + Intergenic
1158097947 18:53796172-53796194 AATCAGAAGGTGAACATGCCAGG + Intergenic
1158678616 18:59546325-59546347 CATTAGAGTGTGAATATGAGGGG - Intronic
1159346450 18:67212867-67212889 TACCTGAGGGTGAAGATGGGAGG - Intergenic
1159568871 18:70089384-70089406 GATCAGAGTGTCAACATGGTTGG - Intronic
1159836665 18:73345222-73345244 CAGCGGAGGCTGCACATGGGTGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168625000 19:57911100-57911122 CAGCAGAGGGTGGTCATGGATGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927089493 2:19699720-19699742 CTCCAGATGGTGAACATGGAAGG + Intergenic
927122772 2:19984116-19984138 TAACAGAGGGCAAACATGGGTGG - Intronic
927744112 2:25600162-25600184 AAACAAAGGGTCAACATGGGAGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928684639 2:33735926-33735948 CATCAGCGAATGAACATGTGGGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930228226 2:48816435-48816457 TGTCAGAGGGTGAAAGTGGGAGG - Intergenic
931626528 2:64261172-64261194 TTTCACAGGGTGAAGATGGGAGG - Intergenic
932687364 2:73883437-73883459 TATCAGAGGATTAACTTGGGAGG + Intergenic
933615802 2:84481419-84481441 CAGCACTGGGTGAACATGTGAGG - Intergenic
935411519 2:102769257-102769279 CATCAGGGGTTGAACAAAGGTGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936377844 2:111957502-111957524 GATCAGAGGGTCAGGATGGGTGG - Intronic
938068487 2:128294284-128294306 CATCAGAGGGGGCACAGGGCGGG + Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938950358 2:136249464-136249486 GATCAGAGGGTGAAATGGGGAGG - Intergenic
939565758 2:143784849-143784871 GATCAGTGGGTTATCATGGGAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941764862 2:169285619-169285641 GATCAGAGGGTGGCCAAGGGGGG - Intronic
942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944258340 2:197648309-197648331 CAAAAGAGGGTGAAAATTGGAGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945837233 2:214847643-214847665 AATCACAGGGTGAACCTGGGGGG - Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948485626 2:238279114-238279136 CATCACTGGGTGAAGAAGGGAGG - Intronic
1168938857 20:1691598-1691620 GATCAGATGGTGTACATGTGTGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169492925 20:6086433-6086455 CTTCAGGGAGTGAACAGGGGTGG + Intronic
1173132558 20:40408373-40408395 CCTCAGAGGAAGAACCTGGGTGG - Intergenic
1173451024 20:43163959-43163981 CAGAAGAGGGTATACATGGGAGG + Intronic
1173965804 20:47111778-47111800 CTTCAGAGGGTGAAGATGTAAGG + Intronic
1174486658 20:50865682-50865704 CAGCAGCTGGTGGACATGGGAGG - Intronic
1178521032 21:33288650-33288672 CACCAGAGGGAGAGAATGGGAGG + Intronic
1179775847 21:43661521-43661543 CATCAGGAGGTGAACGAGGGAGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181672573 22:24432557-24432579 CCTGAGAGGCTGAGCATGGGGGG + Intronic
1182250720 22:28997893-28997915 ACTCAGAAGGTTAACATGGGAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
949503758 3:4706708-4706730 AATCAGCAGGTGAACAAGGGTGG + Intronic
951580799 3:24160410-24160432 CAAGAGAGGGTGAACCTGGAGGG + Intronic
953827855 3:46269583-46269605 CACCAGAGGGTGAGGATGGATGG - Intergenic
954105442 3:48407302-48407324 CATCAGAGACTGGACATTGGTGG - Intronic
954279761 3:49568909-49568931 CATGAGAGGATGATCATGGTGGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961647776 3:128401529-128401551 CATCAGAGTGTGAGCATGGCAGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965577698 3:170234890-170234912 TCTCAGGGGGGGAACATGGGAGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970181168 4:13396433-13396455 CATTAGAGAGTGTACATGGCAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971333381 4:25700908-25700930 GACCAGAGGGTGAACTTGGGTGG - Intergenic
971382668 4:26113203-26113225 CATCAGATAGTACACATGGGGGG + Intergenic
971825367 4:31614471-31614493 CACCAGAGAGTGAACAAGGCAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974100185 4:57407595-57407617 CACTTGAGGGTAAACATGGGAGG + Intergenic
974148058 4:57970082-57970104 CCTCAGAGGGTGAACATTCTAGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980970628 4:139563878-139563900 CCTCAGAGGGTGGGCATCGGAGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983657659 4:170099354-170099376 CATGGGAGGGACAACATGGGAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
986316793 5:6594622-6594644 CATCCCAAAGTGAACATGGGTGG + Intergenic
987001141 5:13661392-13661414 CATCAGAGGCTGAACTGGGTAGG + Intergenic
987207709 5:15644507-15644529 CATCAAAGGTGGAACGTGGGTGG + Intronic
987532036 5:19132783-19132805 GATCAGATGGTGTACATGTGTGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990049438 5:51478810-51478832 TAACAGAGCATGAACATGGGAGG + Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992252486 5:74889227-74889249 CATTAGAGAGTAAACATGGCTGG - Intergenic
992785531 5:80167229-80167251 TATCAGAGGGTGGAGGTGGGAGG - Intronic
998225978 5:140326582-140326604 CATCAGAGGTTGAAGATGCAAGG - Intergenic
1001383251 5:171317728-171317750 CACCTGGGGGTGAACTTGGGTGG - Intergenic
1003160926 6:3633630-3633652 GACCTGAGGGTGGACATGGGGGG + Intergenic
1003189409 6:3861134-3861156 CATCAGAGGCTGCACAATGGAGG - Intergenic
1004249403 6:14011147-14011169 CTTCAGAGGCTGAGCATGGGAGG - Intergenic
1006672140 6:35736269-35736291 CATCAGAGGATGAAAAGGAGGGG - Intergenic
1006699466 6:35960226-35960248 AAGCAGAGGGTGAAAATGGGAGG - Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1010089880 6:71968185-71968207 CATCTGAGGATGAACATGGATGG - Intronic
1010745077 6:79551728-79551750 CACCACAAAGTGAACATGGGTGG - Intergenic
1013275308 6:108579372-108579394 CATCAGAAGGTCCACATGGAAGG + Intronic
1013582465 6:111549992-111550014 CACCACAGTGTGAGCATGGGAGG - Intergenic
1016256113 6:142107531-142107553 CATCAGAGGTTGAACATTGTGGG + Intergenic
1016558443 6:145367478-145367500 CAACAGATGCTGAATATGGGGGG - Intergenic
1016863375 6:148743847-148743869 AAGCAGAGGGTGGAGATGGGAGG + Intergenic
1017015622 6:150097327-150097349 CATTAGAGGGTAAAGAGGGGTGG - Intergenic
1017341217 6:153324185-153324207 CATCAGCTGGTGAACAAAGGAGG + Intergenic
1018608094 6:165620312-165620334 CATGAGAAGGTGATGATGGGGGG + Intronic
1018759079 6:166874439-166874461 CAGCAGGGGGTGAACGTGGCTGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020864026 7:13533596-13533618 CTTCAGAGGCTGAGGATGGGAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023469474 7:40499020-40499042 CATCAGAGGCAAAACAAGGGAGG - Intronic
1023985632 7:45093082-45093104 CATCAGAGGCGGAACATTGTAGG + Intergenic
1024593268 7:50908660-50908682 TATCAGAGGCTGAAAAGGGGGGG - Intergenic
1024803860 7:53112863-53112885 AATATGAGGGTGAAAATGGGAGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026260303 7:68749081-68749103 CATGAGACGAGGAACATGGGTGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034514510 7:151564503-151564525 CATTAGAGGGTAAAAATTGGGGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034993297 7:155561553-155561575 CATCTGTGGGTGAGCCTGGGGGG + Intergenic
1035353855 7:158265517-158265539 GTGCAGAGGGTGGACATGGGGGG - Intronic
1035819860 8:2579739-2579761 CATCCTAGGGTGAAAATAGGAGG - Intergenic
1036481777 8:9146457-9146479 AATCAGAAGGTGAAAATGAGAGG - Intronic
1038286136 8:26207812-26207834 CATCAGAGGTTGAACAGATGTGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038871337 8:31497196-31497218 CGTCACAGAGTGTACATGGGTGG - Intergenic
1039070985 8:33649155-33649177 CACCACAAAGTGAACATGGGTGG - Intergenic
1039365364 8:36923075-36923097 CATGAGAGGAGGAACATGGAGGG - Intronic
1039994321 8:42518565-42518587 CATCAGGCTATGAACATGGGTGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1044855417 8:96470114-96470136 CATCAAAGGTGGAACTTGGGAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045960395 8:107961306-107961328 CATCAGAGGGTGACCTGGGTGGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047068219 8:121311345-121311367 TATCAGAGGGTGGAACTGGGAGG - Intergenic
1048515094 8:135100002-135100024 TATCAGAGGCTGAACAAGAGGGG + Intergenic
1049414598 8:142489446-142489468 CATCAGAGTGTGCACGTGGACGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1053416423 9:37949679-37949701 CATCAGAGGGTGCTGATGGGAGG + Intronic
1054899904 9:70357947-70357969 AATGAGAGGGTGAATATTGGAGG + Intergenic
1056822243 9:89851445-89851467 CAAGAGAGGGTGGCCATGGGGGG + Intergenic
1185642842 X:1597969-1597991 CCTCAGAGGCTGAGCATGAGGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188901051 X:35733673-35733695 CATCTTAGGGAGAATATGGGTGG + Intergenic
1188927124 X:36057698-36057720 TAACAGAGGGTGAGTATGGGAGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1195364867 X:104116104-104116126 CATCAGATGGGGAACGGGGGGGG + Intronic
1195640874 X:107173502-107173524 CATCAGAGGGAGAAAAGTGGGGG + Intronic
1200685864 Y:6258305-6258327 CTGCAGAGGCTGAACCTGGGAGG + Intergenic
1200991396 Y:9349552-9349574 CTGCAGAGGCTGAACCTGGGAGG + Intergenic
1200994052 Y:9369829-9369851 CTGCAGAGGCTGAACCTGGGAGG + Intronic
1200996717 Y:9390163-9390185 CTGCAGAGGCTGAACCTGGGAGG + Intergenic
1200999231 Y:9458715-9458737 CTGCAGAGGCTGAACCTGGGAGG + Intergenic
1201001884 Y:9479025-9479047 CTGCAGAGGCTGAACCTGGGAGG + Intronic
1201004551 Y:9499313-9499335 CTGCAGAGGCTGAACCTGGGAGG + Intergenic
1201007204 Y:9519638-9519660 CTGCAGAGGCTGAACCTGGGAGG + Intergenic
1201009846 Y:9539991-9540013 CTGCAGAGGCTGAACCTGGGAGG + Intergenic
1202374156 Y:24218176-24218198 CACCACAGGGTGAATTTGGGAGG - Intergenic
1202496625 Y:25451944-25451966 CACCACAGGGTGAATTTGGGAGG + Intergenic