ID: 1118994017

View in Genome Browser
Species Human (GRCh38)
Location 14:70821340-70821362
Sequence CATAAAACCCACACTCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118994017_1118994020 13 Left 1118994017 14:70821340-70821362 CCTTAGGGAGTGTGGGTTTTATG No data
Right 1118994020 14:70821376-70821398 AACTTTCGCACCGGCTCTTCTGG No data
1118994017_1118994018 4 Left 1118994017 14:70821340-70821362 CCTTAGGGAGTGTGGGTTTTATG No data
Right 1118994018 14:70821367-70821389 AACAAGCCAAACTTTCGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118994017 Original CRISPR CATAAAACCCACACTCCCTA AGG (reversed) Intergenic
No off target data available for this crispr