ID: 1118994194

View in Genome Browser
Species Human (GRCh38)
Location 14:70822105-70822127
Sequence CTCACCGCCTTGCAGAGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118994194_1118994199 1 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994199 14:70822129-70822151 CGTTTCTTCCCGGCACAGGAGGG No data
1118994194_1118994196 -9 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994196 14:70822119-70822141 GGCGGTGAGTCGTTTCTTCCCGG 0: 1
1: 0
2: 1
3: 9
4: 50
1118994194_1118994203 24 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994203 14:70822152-70822174 ACAGTTTCCCCACGTGGACGCGG No data
1118994194_1118994204 25 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG No data
1118994194_1118994206 30 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994206 14:70822158-70822180 TCCCCACGTGGACGCGGGGCTGG No data
1118994194_1118994205 26 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994205 14:70822154-70822176 AGTTTCCCCACGTGGACGCGGGG No data
1118994194_1118994197 -3 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994197 14:70822125-70822147 GAGTCGTTTCTTCCCGGCACAGG No data
1118994194_1118994198 0 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994198 14:70822128-70822150 TCGTTTCTTCCCGGCACAGGAGG No data
1118994194_1118994202 18 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994202 14:70822146-70822168 GGAGGGACAGTTTCCCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118994194 Original CRISPR CTCACCGCCTTGCAGAGGCG CGG (reversed) Intergenic
901916837 1:12506547-12506569 TTCACTGCCTGGCAGAGGAGAGG - Intronic
905907716 1:41630517-41630539 CTCACCGCCTTGAAGATGGAGGG + Intronic
912822578 1:112879595-112879617 CTCACAGCCTGGCACAGGCCTGG + Intergenic
916655991 1:166875967-166875989 CTCACCGCCCTGGAGAGACCGGG - Intronic
919775975 1:201194256-201194278 CTCACCCTCTGGCAGAGCCGAGG - Exonic
920214842 1:204354861-204354883 CACACGGCCGTGCAGGGGCGCGG + Intronic
921190506 1:212704063-212704085 CTCACCTCCTTCCAGAAGCCTGG - Intergenic
924052835 1:240093800-240093822 GTCACCGCCTTCCAGAGCCCAGG - Intronic
1065319503 10:24495981-24496003 CTCATCTTCTTGCAGAGGCCTGG - Intronic
1070805570 10:79268807-79268829 CTGACCGCGTTGCAGAGGGCAGG + Intronic
1074114511 10:110445744-110445766 CTCACCCCATTGCAGGGGAGAGG - Intergenic
1076530842 10:131143276-131143298 CTCACTGCCTTGGAGAGGGGAGG - Intronic
1076852199 10:133098746-133098768 CTCACCGCCTGGCACAGGATGGG - Exonic
1081002077 11:37687260-37687282 ATCTCAGCCTTGCAGAGGCTAGG + Intergenic
1081812965 11:45923419-45923441 CTCACCGCCTAGCGGAGAAGGGG + Intronic
1082081912 11:48018919-48018941 CCCACCAGCCTGCAGAGGCGAGG - Intronic
1087687763 11:101284738-101284760 CCCACATCCTTGCAGCGGCGTGG - Intergenic
1089635269 11:119807856-119807878 CTCACCCCCTTCCACAGGTGGGG - Intergenic
1090275675 11:125417697-125417719 CCCAACGCCCAGCAGAGGCGTGG + Intronic
1090296538 11:125593032-125593054 CTTAGGGCCTTGCAGAGGAGGGG + Intronic
1106411271 13:29513206-29513228 CTCTCCCACTTGCAGAGGCGTGG + Exonic
1108000445 13:45901127-45901149 CTCACCACCCTTCAGAGCCGTGG - Intergenic
1118404768 14:65412563-65412585 TCCACCGCCTAGCAGAGCCGCGG - Intronic
1118608697 14:67522782-67522804 CCCACTGCCTTGCAGAGGGTGGG + Intronic
1118994194 14:70822105-70822127 CTCACCGCCTTGCAGAGGCGCGG - Intergenic
1131343884 15:91628198-91628220 CACACCGCAGTGCAGAGCCGTGG + Intergenic
1132618252 16:852782-852804 GTCTCCCCCTTGCAGAGGCTGGG + Intergenic
1138105980 16:54287280-54287302 CTCGCTGCCTTGCGGGGGCGAGG + Intergenic
1141784176 16:86187510-86187532 CTCACCGCCTGGCAGATGGCAGG + Intergenic
1142377245 16:89712315-89712337 CTCCCCGCTTTGCAGAGGCAGGG - Intronic
1143316203 17:6035234-6035256 CTCAGCGCCTTTCACAGGTGGGG + Intronic
1144149833 17:12432801-12432823 CTCACCCACTTGCAGAGGACAGG + Intergenic
1147960725 17:44166034-44166056 CTCACCACCTTGCTCAGGCTGGG - Intergenic
1148912801 17:50952114-50952136 CTCATCACCTTGCAGATGGGTGG - Intergenic
1149003022 17:51776342-51776364 CTCACCTCGTTGCTGAGGCTGGG - Intronic
1149665509 17:58362539-58362561 CTCACCGGCCTGCTGTGGCGGGG + Exonic
1150226190 17:63525835-63525857 CTCACATCATTGCAGAGGAGAGG + Intronic
1151968590 17:77445286-77445308 CGCACCCCCATGCAGAAGCGCGG + Intronic
1157442246 18:47719860-47719882 CTCCCCACCTTGCAAAGGCTGGG + Intergenic
1160248403 18:77179748-77179770 CTTACCGCGTTGCACAGGCCTGG - Intergenic
1160465023 18:79069279-79069301 CTCGCCGCTTGGCGGAGGCGGGG + Intronic
1160965528 19:1745504-1745526 CTCACCTCCAGGCAGAGGTGAGG + Intergenic
1161125877 19:2556816-2556838 CTCACCACCCTGCAGAGCCCAGG - Intronic
1163641701 19:18465877-18465899 CTGACTGCCCCGCAGAGGCGCGG - Exonic
1164754751 19:30681296-30681318 CTCAGCACCTTGCACAGGCCTGG - Intronic
1165005532 19:32803294-32803316 CTGACAGCCCTGCAGAGGGGAGG - Intronic
1167565243 19:50252121-50252143 CTCACGGCCTAGCAGAGGGCTGG - Intronic
925161177 2:1685405-1685427 CACACTGCCTGGCAGAGACGAGG - Intronic
925359359 2:3266878-3266900 ATGACCACCGTGCAGAGGCGTGG + Intronic
925959784 2:9003820-9003842 CCGACCGCCCTGCACAGGCGCGG + Intergenic
926118408 2:10227668-10227690 CTCACAGGCTAGCAGGGGCGTGG - Intergenic
927561427 2:24076760-24076782 CTCACCGCCTTGCTCAGGCCCGG - Intronic
936153246 2:110033004-110033026 CTCCCCGTCTTGCCGAGGTGTGG + Intergenic
936191435 2:110338411-110338433 CTCCCCGTCTTGCCGAGGTGTGG - Intergenic
938245734 2:129776453-129776475 CTCACCGGCTCCCAGAGGCAAGG + Intergenic
946140687 2:217688154-217688176 CTCACCACCGTGCAGGGGCTTGG - Intronic
947729196 2:232418801-232418823 CTCACTGCCTTCCAGAGGGCTGG + Intergenic
948948979 2:241236674-241236696 CACACCTCCTTGGAGAGCCGGGG + Exonic
1168878561 20:1186802-1186824 CTCCCAGCCTTGCAGAGGCCTGG + Intronic
1169208939 20:3755008-3755030 CTCCCAGCCTGGCAGAGGCTAGG - Intronic
1170457514 20:16547281-16547303 CTCACAGCCTTGTAAAGGGGAGG - Intronic
1174475780 20:50794965-50794987 CGGACCGCCTGGCGGAGGCGGGG - Exonic
1175279368 20:57793068-57793090 CTTCCCGCCTTGCTGAGGGGTGG - Intergenic
1176428123 21:6561087-6561109 TTCATCCCCTTGCAGAGGCTGGG + Intergenic
1179703614 21:43169404-43169426 TTCATCCCCTTGCAGAGGCTGGG + Intronic
1183966751 22:41446874-41446896 CCCTCCGCCCTGCAGGGGCGGGG + Exonic
1184735086 22:46393353-46393375 CTGACCGCCCTGGACAGGCGTGG + Intronic
1185006478 22:48279644-48279666 CTCTCCGCCTAGCAGAGGGCTGG + Intergenic
950161094 3:10761803-10761825 CTCACCGACTTCCTGAAGCGTGG - Intergenic
950487967 3:13283844-13283866 CTCAACGCCGAGCAGAGGCGGGG - Intergenic
952925184 3:38315146-38315168 CTGACCACCTTGCAGAGCCCCGG + Intronic
954863955 3:53713131-53713153 CTCCCCTCCTTGCAGAGCTGGGG + Intronic
960592422 3:119378737-119378759 CTCACCGCCTTGCAGAGCCAGGG + Intronic
961554603 3:127689414-127689436 CTCAGTTCCTTGCAGAGGTGAGG - Exonic
966807573 3:183818980-183819002 CTCCCCATCTTGCAGAGGAGTGG - Intronic
968487241 4:868575-868597 CTCACCGCCAAGCAGCAGCGCGG - Exonic
968765951 4:2469263-2469285 GTCAGGGCCTTGCAGATGCGAGG + Intronic
970800448 4:19966592-19966614 CTCACAGTCTTGCAGAGCTGGGG + Intergenic
972418980 4:38868529-38868551 CTCACCGGATGGCAGAGGCGAGG - Exonic
990695897 5:58416460-58416482 CTCTACTCCTTGCAGAGGTGTGG - Intergenic
990709369 5:58564199-58564221 CTCACTGCCTCCCAGAGGGGCGG + Intergenic
991384278 5:66067777-66067799 CTCACCACCTTGCCCAGGCTTGG - Intronic
993095324 5:83473144-83473166 CCCACCGTCCTGCAGAGGCGTGG + Intronic
998372438 5:141670515-141670537 CTCACCCCCTCGCAGGGGCCGGG - Exonic
1001560440 5:172665620-172665642 GTCACTGCCTTGTAGAGGTGAGG - Intronic
1001565735 5:172697972-172697994 CTCCCAGCATTGCAGGGGCGGGG - Intergenic
1003122494 6:3329594-3329616 CACACCGCCCAGCAGAGGCCGGG - Intronic
1003172833 6:3733624-3733646 CTTGCAGCCTTGCAGAGCCGAGG - Intronic
1005937209 6:30532449-30532471 CCCACCGCCTTGCTGTGGCAGGG + Intergenic
1013780853 6:113727076-113727098 CCCACCCACTTGCAGAGGCTGGG + Intergenic
1019428183 7:987093-987115 GTCATCCCCCTGCAGAGGCGTGG - Exonic
1020288775 7:6706632-6706654 CTCACCGTCCTGCGGAGCCGGGG + Exonic
1024473788 7:49789928-49789950 CTTGGCTCCTTGCAGAGGCGGGG + Intronic
1026497050 7:70912424-70912446 CCCACGTCCTTGCAGAGGCAGGG - Intergenic
1029600374 7:101559739-101559761 CTCACCTTCTTGCAGAGCTGGGG - Intergenic
1030926261 7:115459216-115459238 CTCACTGCCTTGCACTGGTGAGG - Intergenic
1033741677 7:144280887-144280909 CTCTCTGCCTTTCAGAGGCAGGG - Intergenic
1033752224 7:144368727-144368749 CTCTCTGCCTTTCAGAGGCAGGG + Intronic
1034557707 7:151860480-151860502 CACACCCCCTTCCACAGGCGAGG - Intronic
1045238673 8:100378639-100378661 CTCACCGCCTTGGATAGCCTTGG - Intronic
1053316313 9:37054805-37054827 CTCACTGCCTAGCAGAGGAATGG + Intergenic
1056933465 9:90897726-90897748 CTCACCTCCCTGCAGAGGTCCGG + Exonic
1058726589 9:107810507-107810529 CTCACCTCCTTGCAGAAGGGAGG - Intergenic
1060532059 9:124353554-124353576 CTCACCACCTTCCAGAACCGCGG + Exonic
1062031362 9:134363496-134363518 CACACTGCCCTGCAGAGGAGGGG - Intronic
1185467645 X:364113-364135 CTCACAGCCTTGCAGAGCTCTGG + Intronic
1191175460 X:57495982-57496004 CTGACCCCATTGCAGAGGGGAGG + Intergenic
1197350501 X:125376405-125376427 CTCACTGCATTGCACAGGCTAGG - Intergenic