ID: 1118994195

View in Genome Browser
Species Human (GRCh38)
Location 14:70822110-70822132
Sequence AACGACTCACCGCCTTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 26}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118994195_1118994199 -4 Left 1118994195 14:70822110-70822132 CCTCTGCAAGGCGGTGAGTCGTT 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118994199 14:70822129-70822151 CGTTTCTTCCCGGCACAGGAGGG No data
1118994195_1118994206 25 Left 1118994195 14:70822110-70822132 CCTCTGCAAGGCGGTGAGTCGTT 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118994206 14:70822158-70822180 TCCCCACGTGGACGCGGGGCTGG No data
1118994195_1118994198 -5 Left 1118994195 14:70822110-70822132 CCTCTGCAAGGCGGTGAGTCGTT 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118994198 14:70822128-70822150 TCGTTTCTTCCCGGCACAGGAGG No data
1118994195_1118994205 21 Left 1118994195 14:70822110-70822132 CCTCTGCAAGGCGGTGAGTCGTT 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118994205 14:70822154-70822176 AGTTTCCCCACGTGGACGCGGGG No data
1118994195_1118994197 -8 Left 1118994195 14:70822110-70822132 CCTCTGCAAGGCGGTGAGTCGTT 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118994197 14:70822125-70822147 GAGTCGTTTCTTCCCGGCACAGG No data
1118994195_1118994202 13 Left 1118994195 14:70822110-70822132 CCTCTGCAAGGCGGTGAGTCGTT 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118994202 14:70822146-70822168 GGAGGGACAGTTTCCCCACGTGG No data
1118994195_1118994204 20 Left 1118994195 14:70822110-70822132 CCTCTGCAAGGCGGTGAGTCGTT 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG No data
1118994195_1118994203 19 Left 1118994195 14:70822110-70822132 CCTCTGCAAGGCGGTGAGTCGTT 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118994203 14:70822152-70822174 ACAGTTTCCCCACGTGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118994195 Original CRISPR AACGACTCACCGCCTTGCAG AGG (reversed) Intergenic
905044733 1:34986733-34986755 ACCTACTCACAACCTTGCAGGGG + Intronic
1070649312 10:78223229-78223251 CACGGCTCACCTCCCTGCAGAGG + Intergenic
1082002033 11:47398529-47398551 AAGGTCACACAGCCTTGCAGGGG + Intergenic
1085179955 11:74525749-74525771 AAAGACTCACCTCCTTGCCTAGG + Intronic
1099498900 12:83387220-83387242 AACAACCCTCAGCCTTGCAGAGG + Intergenic
1104684042 12:130772731-130772753 AAGGACACACAGCCTTCCAGAGG + Intergenic
1112211374 13:97380884-97380906 AACTACTTACCGCACTGCAGAGG + Intronic
1118994195 14:70822110-70822132 AACGACTCACCGCCTTGCAGAGG - Intergenic
1123153927 14:106206677-106206699 AAAGAGTGACCGCCTTCCAGAGG - Intergenic
1129656470 15:77528284-77528306 TACCACTCCCCGCCTTACAGAGG + Intergenic
1141999968 16:87658699-87658721 GAGGACTCACCCCCCTGCAGTGG + Intronic
1144149832 17:12432796-12432818 AAAAACTCACCCACTTGCAGAGG + Intergenic
1144516263 17:15919310-15919332 AATGACTCAACGGGTTGCAGTGG - Intergenic
1149264044 17:54908343-54908365 GACTACTCACTGCCTTGCAGAGG + Intronic
1161258137 19:3321048-3321070 ACAGACTCAGCGGCTTGCAGGGG - Intergenic
940822008 2:158366485-158366507 AAGGACTCGCTGCCTTGCTGTGG + Intronic
941352734 2:164456206-164456228 AACGACTCACAGTATTGCAGAGG + Intergenic
948936483 2:241168476-241168498 AACGACACACCGCCTGGCGGTGG - Intronic
1172748460 20:37232022-37232044 AAAGACTCACTGCCATTCAGAGG - Intronic
1178683701 21:34694914-34694936 AACTACTCATCAACTTGCAGAGG - Intronic
1179805437 21:43834355-43834377 AGCGCCTCCCCGCCCTGCAGAGG + Intergenic
950103706 3:10375169-10375191 AGCCACACGCCGCCTTGCAGGGG - Intronic
963882941 3:150548415-150548437 AAGGACTCACAGTCTAGCAGGGG - Intronic
1003018206 6:2485523-2485545 TACGATTCACGGCATTGCAGAGG + Intergenic
1011703748 6:89980716-89980738 AAAGACTCAACACCTTCCAGTGG - Intronic
1016582935 6:145649776-145649798 AACTACTCAACTCTTTGCAGTGG - Intronic
1038037308 8:23697220-23697242 AACGAATAACAGCCTTGCATTGG - Intergenic
1051984831 9:23071306-23071328 AATGACTCAGTGCATTGCAGTGG - Intergenic
1057506762 9:95640404-95640426 AACAAGACCCCGCCTTGCAGGGG - Intergenic
1197293512 X:124688490-124688512 AAGGACTCAGCTCCTTACAGGGG + Intronic