ID: 1118994200

View in Genome Browser
Species Human (GRCh38)
Location 14:70822137-70822159
Sequence GAAACTGTCCCTCCTGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118994200_1118994215 22 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994215 14:70822182-70822204 AGCGGGAGGGGCAATAGCGCTGG No data
1118994200_1118994210 4 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994210 14:70822164-70822186 CGTGGACGCGGGGCTGGCAGCGG No data
1118994200_1118994216 25 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994216 14:70822185-70822207 GGGAGGGGCAATAGCGCTGGCGG No data
1118994200_1118994203 -8 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994203 14:70822152-70822174 ACAGTTTCCCCACGTGGACGCGG No data
1118994200_1118994214 10 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994214 14:70822170-70822192 CGCGGGGCTGGCAGCGGGAGGGG No data
1118994200_1118994204 -7 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG No data
1118994200_1118994205 -6 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994205 14:70822154-70822176 AGTTTCCCCACGTGGACGCGGGG No data
1118994200_1118994212 8 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994212 14:70822168-70822190 GACGCGGGGCTGGCAGCGGGAGG No data
1118994200_1118994211 5 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994211 14:70822165-70822187 GTGGACGCGGGGCTGGCAGCGGG No data
1118994200_1118994206 -2 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994206 14:70822158-70822180 TCCCCACGTGGACGCGGGGCTGG No data
1118994200_1118994213 9 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994213 14:70822169-70822191 ACGCGGGGCTGGCAGCGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118994200 Original CRISPR GAAACTGTCCCTCCTGTGCC GGG (reversed) Intergenic
No off target data available for this crispr