ID: 1118994204

View in Genome Browser
Species Human (GRCh38)
Location 14:70822153-70822175
Sequence CAGTTTCCCCACGTGGACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118994195_1118994204 20 Left 1118994195 14:70822110-70822132 CCTCTGCAAGGCGGTGAGTCGTT 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG No data
1118994200_1118994204 -7 Left 1118994200 14:70822137-70822159 CCCGGCACAGGAGGGACAGTTTC No data
Right 1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG No data
1118994194_1118994204 25 Left 1118994194 14:70822105-70822127 CCGCGCCTCTGCAAGGCGGTGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG No data
1118994201_1118994204 -8 Left 1118994201 14:70822138-70822160 CCGGCACAGGAGGGACAGTTTCC No data
Right 1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118994204 Original CRISPR CAGTTTCCCCACGTGGACGC GGG Intergenic
No off target data available for this crispr