ID: 1118998180

View in Genome Browser
Species Human (GRCh38)
Location 14:70856507-70856529
Sequence AGTCAAAAGACATGGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118998180_1118998186 -7 Left 1118998180 14:70856507-70856529 CCCCAACACCATGTCTTTTGACT No data
Right 1118998186 14:70856523-70856545 TTTGACTAATGGGCTTCGTGTGG No data
1118998180_1118998187 0 Left 1118998180 14:70856507-70856529 CCCCAACACCATGTCTTTTGACT No data
Right 1118998187 14:70856530-70856552 AATGGGCTTCGTGTGGCAAATGG No data
1118998180_1118998188 12 Left 1118998180 14:70856507-70856529 CCCCAACACCATGTCTTTTGACT No data
Right 1118998188 14:70856542-70856564 GTGGCAAATGGTATGAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118998180 Original CRISPR AGTCAAAAGACATGGTGTTG GGG (reversed) Intergenic
No off target data available for this crispr