ID: 1119004127

View in Genome Browser
Species Human (GRCh38)
Location 14:70908312-70908334
Sequence GCCGGGGCCCCCCGCCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 187}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119004109_1119004127 23 Left 1119004109 14:70908266-70908288 CCCTTCTCGGGGTTCCCTCCTGC 0: 1
1: 0
2: 1
3: 16
4: 192
Right 1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG 0: 1
1: 0
2: 2
3: 16
4: 187
1119004114_1119004127 8 Left 1119004114 14:70908281-70908303 CCTCCTGCGGCCACTCGGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG 0: 1
1: 0
2: 2
3: 16
4: 187
1119004108_1119004127 24 Left 1119004108 14:70908265-70908287 CCCCTTCTCGGGGTTCCCTCCTG 0: 1
1: 1
2: 0
3: 16
4: 173
Right 1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG 0: 1
1: 0
2: 2
3: 16
4: 187
1119004116_1119004127 5 Left 1119004116 14:70908284-70908306 CCTGCGGCCACTCGGCTAGGCCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG 0: 1
1: 0
2: 2
3: 16
4: 187
1119004107_1119004127 30 Left 1119004107 14:70908259-70908281 CCTAGGCCCCTTCTCGGGGTTCC 0: 1
1: 0
2: 0
3: 4
4: 163
Right 1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG 0: 1
1: 0
2: 2
3: 16
4: 187
1119004113_1119004127 9 Left 1119004113 14:70908280-70908302 CCCTCCTGCGGCCACTCGGCTAG 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG 0: 1
1: 0
2: 2
3: 16
4: 187
1119004117_1119004127 -2 Left 1119004117 14:70908291-70908313 CCACTCGGCTAGGCCGTCCCCGC 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG 0: 1
1: 0
2: 2
3: 16
4: 187
1119004110_1119004127 22 Left 1119004110 14:70908267-70908289 CCTTCTCGGGGTTCCCTCCTGCG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG 0: 1
1: 0
2: 2
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119004127 Original CRISPR GCCGGGGCCCCCCGCCCGTG GGG Intronic
900095961 1:940237-940259 GCCGGCGCCCCTCCCCCGCGCGG - Intronic
900096711 1:942786-942808 GCCGGGACCCCCCTTCCGGGGGG - Exonic
900113604 1:1019766-1019788 GCCGCGGCCCCCCGGAAGTGCGG - Intergenic
900269206 1:1778546-1778568 GCCGGGACACCCCGCGCGGGCGG + Intronic
900400821 1:2472257-2472279 GCCCGGCCCTCCCTCCCGTGCGG + Intronic
900540770 1:3201607-3201629 GCCGGGGCTCCCAGCCCCCGAGG - Intronic
900780729 1:4615700-4615722 ACAGGGGCCCCCAGCCAGTGGGG - Intergenic
901209923 1:7518937-7518959 GCCGGGGGCCCCCTCCCCTGGGG - Intronic
901251798 1:7784563-7784585 GCTGGGGCGCCCCGACCGCGCGG - Intronic
903287447 1:22285830-22285852 GCCGGGGTTCCCGGCCCGGGGGG + Intergenic
903628230 1:24745981-24746003 GCCGGGCCCCGGCGCCCGGGCGG - Intronic
906298226 1:44662224-44662246 GCCTGGGACCCCCACCGGTGCGG - Intronic
908128248 1:61050835-61050857 TCCGCGGCCTCCCGCCCGGGGGG - Intronic
912056638 1:105607784-105607806 GCCAGGGCCCACAGCCAGTGAGG - Intergenic
914758374 1:150579433-150579455 GGCGGCGCCACCCGCCCGGGAGG - Exonic
919451329 1:197775585-197775607 GCCAGGTCCCCGCGCCCGGGCGG + Intronic
920099574 1:203508507-203508529 GCCGGGGCCACCTCCCCGTCTGG - Intronic
921189884 1:212699798-212699820 GCCCGCGCGCCCTGCCCGTGGGG + Exonic
921331145 1:214037650-214037672 GGCTGGTGCCCCCGCCCGTGTGG - Exonic
922305530 1:224340972-224340994 GGCGGGGCTCCCCGTCGGTGGGG - Intergenic
924436736 1:244049052-244049074 GCTGGCGCCCCCCGCCCGCCGGG - Intronic
1063665139 10:8056217-8056239 GCCAGGGCACCCCGCGCTTGGGG - Intronic
1065533639 10:26697777-26697799 GCCCGGCTCCCCCGGCCGTGCGG + Exonic
1065727262 10:28677868-28677890 GCGGGGGCGCCGCGGCCGTGCGG + Exonic
1068762947 10:60733182-60733204 GCCCGGGCCTCCCGCCCGCCCGG + Intronic
1070570677 10:77637845-77637867 GCCGCCGCCGCCCGCCCGGGGGG + Intronic
1070785355 10:79159297-79159319 GCCGAGGCCCACAGCCTGTGTGG - Intronic
1076634383 10:131872952-131872974 GCCGGGACCTCTCCCCCGTGTGG - Intergenic
1076706846 10:132307134-132307156 GCCGGGCCCCGCCACCTGTGGGG + Intronic
1076861628 10:133140622-133140644 GCCGCGGGCCCCAGCCTGTGGGG + Intergenic
1077205233 11:1338831-1338853 GCCCGGGCCCCCCACCCCCGTGG - Intergenic
1077205402 11:1340174-1340196 GACAGGGACCCCCGCCCTTGAGG + Intergenic
1077326198 11:1965151-1965173 GCCAGGGCCCTCTCCCCGTGGGG - Intronic
1081209471 11:40313897-40313919 GCCGCCGCGCCCGGCCCGTGGGG + Intronic
1083921062 11:65781501-65781523 GCCCGGGCCCCCAGCCCGCTCGG + Intergenic
1084570222 11:69955203-69955225 GCAGGGGTCCCACGCCTGTGAGG + Intergenic
1089190745 11:116651523-116651545 GCCTCTGCCCCCCGCCCGTCAGG + Intergenic
1092256362 12:6928400-6928422 GCCTGGGCCCCGGGCCCGCGGGG + Intronic
1094025843 12:25958974-25958996 GCCGGGGCCTCCAGCCGGTGCGG + Intergenic
1094849980 12:34378004-34378026 GCCTGGGCCCCACGCATGTGAGG + Intergenic
1095369772 12:41453187-41453209 GCCCATGCCCCCCGCCCCTGGGG + Intronic
1097882030 12:64694913-64694935 AGCGGGGCTCCCTGCCCGTGAGG + Exonic
1101877067 12:108603190-108603212 GCCGGGGTCCCCCGCCCTGGTGG + Intergenic
1102038628 12:109786644-109786666 GCAGGGGCCCCGAGCCAGTGGGG + Intronic
1102498374 12:113334951-113334973 GCCCGGGTCCTCCGGCCGTGCGG + Intronic
1102822131 12:115917115-115917137 GTCGGGGCCCCCGGGCCGCGGGG - Intergenic
1103364021 12:120369357-120369379 GCCGGGACCCCCTTCCCGCGGGG + Intergenic
1103364066 12:120369457-120369479 GCCGGGCCCCCGCGCCGGGGTGG - Intergenic
1103862319 12:124025041-124025063 GCCAGGGCCCCCGGGCCATGTGG + Intronic
1104140679 12:125983750-125983772 GGAGGGGCCCCACGCCAGTGTGG + Intergenic
1105504578 13:20998804-20998826 GCTGCGGCCCCCGCCCCGTGTGG - Intronic
1106340193 13:28820067-28820089 GCCGGCGCGCCTCGCCCGCGAGG - Intergenic
1112365477 13:98752334-98752356 TCCTGGCCCGCCCGCCCGTGGGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1113962075 13:114131927-114131949 GCCGGGGCCTCACGCCCCTGGGG + Intronic
1114516486 14:23302882-23302904 GCGGGGGCGCCCGGGCCGTGAGG - Intronic
1115028417 14:28767532-28767554 GCCGGGGCGCCCCGCGTCTGGGG - Exonic
1117876040 14:60250068-60250090 GCCGGGGCGGCGCGCCCGAGCGG - Intronic
1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG + Intronic
1119230390 14:72974819-72974841 GCTGGGGCCCTGCGCCAGTGCGG - Exonic
1122601775 14:102925240-102925262 GCCTGGGGCCCCCGCGTGTGCGG + Intronic
1202895018 14_GL000194v1_random:1911-1933 GCAGGGGACCCCGGACCGTGAGG + Intergenic
1124469239 15:29968635-29968657 GCTGGGGCTCCGCGCCCGCGCGG + Intronic
1126823625 15:52528821-52528843 GCCTACGCCCCCCGCCTGTGCGG + Exonic
1128237878 15:66079902-66079924 GCTGGGGAGCCCCGCCCTTGTGG - Intronic
1131165979 15:90142421-90142443 GCCGCGGCGCCCAGCCGGTGGGG - Intergenic
1132695150 16:1198777-1198799 GCCCAGGCCCCACCCCCGTGAGG + Intronic
1132869290 16:2108554-2108576 GCCGGGGCGCCCAGCGCGTGTGG - Exonic
1134550342 16:15135951-15135973 GCCGGGGTGCCCGGCGCGTGTGG - Intronic
1134718124 16:16367044-16367066 GCCGGGGTGCCCGGCGCGTGTGG + Intergenic
1134956628 16:18385115-18385137 GCCGGGGCGCCCGGCGCGTGTGG - Intergenic
1140236305 16:73162083-73162105 GCAGGGGTCCCCAGCCCCTGGGG + Intergenic
1141198699 16:81881059-81881081 GCAGGGGCCCCCTGCCCCTTTGG - Intronic
1142120151 16:88383118-88383140 GCCCGGGCCGCCCGCCCGCCGGG - Intergenic
1143173908 17:4945758-4945780 GCCCTGGCCCCCAGCCCATGTGG + Exonic
1143958893 17:10697800-10697822 GCGGGGGCCCCCAGCGCTTGGGG - Intronic
1145792906 17:27638956-27638978 GCCGAGGCACCCCGACCGGGTGG + Intronic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146793710 17:35766854-35766876 TCCGGGGCCCCAAGCCAGTGTGG - Exonic
1147636351 17:41966817-41966839 TCCGGGGCCGCCCGCCTGCGCGG - Exonic
1148554601 17:48570721-48570743 GCCGGCGCCCCCACCCCATGAGG - Intronic
1148894319 17:50831210-50831232 GCTGGGACCCCCTGCCCGCGCGG - Intergenic
1150285071 17:63949816-63949838 GGCGGGGACCCCGGCCCGAGTGG + Intronic
1152579569 17:81160057-81160079 GCCGGGGCCACCTGCCCCAGGGG - Intronic
1152648536 17:81481496-81481518 GAGGGGGCCGCCAGCCCGTGCGG - Intergenic
1153480534 18:5543211-5543233 GCAGCGGCCCCCGGCCGGTGGGG - Intronic
1157472686 18:48002125-48002147 GCCAAGGCCCCCCGCCCCAGAGG - Intergenic
1160523104 18:79520188-79520210 GCGGGGGATCCCCTCCCGTGAGG - Intronic
1160668487 19:344629-344651 GCCGGGGCGCCTGGCCCGTCCGG - Intronic
1160765403 19:805390-805412 GCCGGGGCCGCCCGCCGGCCGGG + Intronic
1161397941 19:4054549-4054571 GGCCGGGCCCCCCGGCCGAGCGG - Exonic
1161400822 19:4065745-4065767 CCCTCGGCCCCCCGCCCGTGGGG - Intronic
1161767778 19:6216568-6216590 TCCAGGGCCCCTCGCCCATGAGG + Intronic
1161924979 19:7293671-7293693 GCCACCGCCCCCCGCCCCTGGGG + Intronic
1161998972 19:7731225-7731247 GCCTGGGCCCCCGGGGCGTGAGG - Intronic
1162302137 19:9850088-9850110 GATGGGGTCCCCCGCCAGTGTGG + Intergenic
1162895981 19:13764865-13764887 GCCGGGGCGCCCCGCACCTGCGG - Exonic
1164897634 19:31891047-31891069 GCCTGGGCCCCCTGCCCTTGCGG - Intergenic
1165854328 19:38870698-38870720 GCCGGGTCCCCAGACCCGTGGGG + Exonic
1166137637 19:40786934-40786956 GCCGTGGCCCCTCAGCCGTGTGG + Exonic
1166332701 19:42088122-42088144 CCCTGGGCCCCCCTCCCCTGAGG - Intronic
1166924725 19:46259566-46259588 GGCGGGGTCTCCAGCCCGTGCGG - Intergenic
1167134883 19:47610060-47610082 GCCGGGGCACCGCGCTCGGGTGG + Intronic
1167149105 19:47698816-47698838 CCAGGGGACCCCAGCCCGTGGGG + Intronic
1167648593 19:50718448-50718470 GCTAGGGCCCCCCGCGCGTACGG + Intronic
1168159809 19:54502845-54502867 CCGGGGGCCTCCTGCCCGTGGGG - Exonic
925278220 2:2665528-2665550 GCCGGGGGCCTCCGTCTGTGTGG - Intergenic
925405136 2:3601145-3601167 GCCGAGGCCCCCTGCCCGTGTGG - Intronic
926423343 2:12718876-12718898 GCCGGGTCCCGCTGCCCGGGGGG + Intronic
927937981 2:27086161-27086183 GCCGGCGCGCCCCGGGCGTGGGG - Exonic
929788051 2:45006083-45006105 CCAGGGGCGCCCCGCCCCTGCGG - Exonic
931882431 2:66581625-66581647 CCCAGGGCCCCCAGCCCGCGGGG - Intergenic
936428005 2:112435829-112435851 CCCGGTGCCTCCCGCCCCTGAGG + Intergenic
941843966 2:170115096-170115118 GCAGGGGCTCCCCTCCCCTGTGG + Intergenic
942612641 2:177757761-177757783 GCTGGGGCCCCCAGCCTGGGGGG + Intronic
942965879 2:181891960-181891982 CCCGGGGCCCCCTGCCCGGCCGG + Exonic
946340115 2:219061038-219061060 GCCGGGGCCGCCCGCCCGAGGGG - Intergenic
947749615 2:232525512-232525534 GTCTGGGCCCCCAGCCCCTGGGG + Exonic
948255963 2:236568113-236568135 TCCGGGGTCCCCGGCCCATGTGG + Intronic
948395742 2:237643632-237643654 GCCAGGGCCCCCAGCCCGGTGGG + Intronic
948765279 2:240216238-240216260 GCCGGATCCCCACGCCTGTGGGG + Intergenic
1169262383 20:4148594-4148616 GCAGGGGCCCCCCTCCCGCAGGG - Intronic
1171011361 20:21510934-21510956 GCCGGGCCCGGCCGCCCGCGGGG - Intergenic
1175936871 20:62518032-62518054 CCCTGGGCCCCCAGCCAGTGAGG + Intergenic
1175940147 20:62533995-62534017 GCCTGGGGCTCCCGCCCCTGTGG - Intergenic
1176162042 20:63653073-63653095 GCGGGGGCGCCTCGCCCCTGGGG - Intronic
1176197508 20:63844284-63844306 ATCTGGGCCCCCCGCCCCTGAGG + Intergenic
1176374251 21:6079383-6079405 CCCGGTGCCTCCCGCCCCTGAGG - Intergenic
1176510628 21:7745205-7745227 GCAGGGGCGCCCCGCAGGTGGGG - Intronic
1178488594 21:33033805-33033827 GCCGGGGTCTCCAGCCGGTGGGG - Intergenic
1178644741 21:34375734-34375756 GCAGGGGCGCCCCGCAGGTGGGG - Exonic
1178707680 21:34888946-34888968 CCCGGGGCCCCGCCCGCGTGCGG + Intronic
1179209286 21:39312751-39312773 CGCGGGGACCCCGGCCCGTGGGG - Intronic
1179749225 21:43458862-43458884 CCCGGTGCCTCCCGCCCCTGAGG + Intergenic
1179800306 21:43808590-43808612 GCCGTGGCCCCCCGCCCCTACGG + Intergenic
1179891845 21:44339209-44339231 GCCGGGGGCGCCCGCCGGTCGGG - Exonic
1180954839 22:19736995-19737017 CCCGGCGCCCCCCACCCCTGAGG + Intergenic
1180960520 22:19760554-19760576 CCCGGGGCCCCCCGACCGCCCGG - Intronic
1181956361 22:26590136-26590158 GCCGCGGCCCCGCCCCCGCGCGG - Exonic
1183583478 22:38739020-38739042 AGCGGGGCCCTCCTCCCGTGCGG - Intronic
1183958328 22:41395960-41395982 ACCCGTGCCCCCCGCCCGGGCGG + Exonic
1184059649 22:42074231-42074253 GCCGGGAGACCCCGCCCGGGAGG - Exonic
1184222850 22:43111511-43111533 GAGGGGGCCCCCCGCCTGCGGGG + Intronic
1185380335 22:50504917-50504939 ACCGGGGCCCACCGCCTGTTTGG - Exonic
955219700 3:57013136-57013158 GCCTGAGCCCCCCGCCCTGGCGG + Intronic
961785377 3:129344086-129344108 GCAGAGGGCGCCCGCCCGTGTGG + Intergenic
963081800 3:141402123-141402145 GCCGGGGCCCCCCACCAAGGAGG - Intronic
966711824 3:182980176-182980198 GCCGGGGCCCGGCGCGGGTGGGG - Intronic
967164952 3:186772489-186772511 GCGGGTGCCCCCAGCCCTTGTGG + Intergenic
967859617 3:194141327-194141349 CCCGGGGCCCTCCGCCCGGGCGG + Intergenic
968382447 4:107920-107942 ACCCGGCCGCCCCGCCCGTGTGG - Intergenic
968556546 4:1248836-1248858 CCCCGCGCCCCCCGCCCGCGCGG + Intronic
969858922 4:10020861-10020883 CCCGGAGCCCCCTGCCTGTGTGG + Intronic
972765864 4:42151974-42151996 GGCGGGGGCGCCCGCACGTGCGG + Exonic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
985530085 5:429054-429076 GCTGGGGACCCCTGCCCTTGGGG + Intronic
985716199 5:1463371-1463393 ACCGGTGCCCCCCGCCCGGCAGG + Exonic
985725312 5:1513050-1513072 GCCTGGGCCCTCCCTCCGTGGGG - Intronic
987340692 5:16936412-16936434 GGCGGGGCGCTCCGCCCGGGCGG - Intergenic
989523118 5:42423874-42423896 GCCGGGGCCTCCGGCCCGCGTGG - Intronic
999272197 5:150302978-150303000 GCCGGGGCTTCCCGCCCGGGAGG - Intronic
1000014702 5:157266486-157266508 GCCGGAGCCGCCAGCCCGGGAGG + Intronic
1000319070 5:160119326-160119348 GCCGGCGCCCCCCTCCCCGGGGG + Exonic
1001556623 5:172641442-172641464 GCCGGGGAGCCCTGCCCGGGAGG + Intronic
1002399233 5:178981999-178982021 GCAGGGGCCCCGCGCCTGAGGGG + Intronic
1002719080 5:181246986-181247008 GCCGGGGCCCCCCGCCTCCCCGG + Intronic
1002927647 6:1614287-1614309 GCTGGGCCAGCCCGCCCGTGGGG - Intergenic
1003552109 6:7108800-7108822 GCCGGCGCCGTCCGCCCGGGAGG - Intronic
1003552358 6:7109548-7109570 GCCCGGGCCCGCACCCCGTGGGG - Intronic
1003942725 6:11044519-11044541 GGCGGCGCCCCCCGCCCCTGCGG + Intergenic
1005048480 6:21664297-21664319 GTCGGGGCTCCCCGCAGGTGAGG + Intergenic
1007390224 6:41546471-41546493 GACGGAGCCCCCAGCCCGCGAGG + Exonic
1007714220 6:43845073-43845095 GCTGGGACCCCCTGCCAGTGAGG + Intergenic
1015149094 6:130019289-130019311 GCCGGCGCCCCCCGCCTCGGCGG - Intronic
1016863793 6:148747174-148747196 GACGGGGCGCCGCGCCCGTCCGG - Intergenic
1016923267 6:149317224-149317246 GCCTGGGCCCCCCATCCTTGGGG - Intronic
1017719941 6:157236792-157236814 GCCTGGGCCCCTCGCCAGGGTGG - Intergenic
1019193699 6:170268774-170268796 GCCAGGGCCCTCGGCCTGTGGGG + Intergenic
1019287567 7:231349-231371 GCCGGGACCCTCCTCCCATGGGG - Intronic
1019456391 7:1129995-1130017 ACCGGTGCCCGCAGCCCGTGTGG - Intronic
1019562743 7:1666380-1666402 GCCGAGTCTCCCCGCCCGCGGGG + Intergenic
1022528375 7:31052534-31052556 GCCGGGTCTCCGCGCCTGTGTGG - Exonic
1026665363 7:72336497-72336519 GGCGCGGCCCCCAGCCCGCGGGG + Intronic
1026893947 7:73999543-73999565 GCCAGAGCCCCCCACCCCTGAGG + Intergenic
1029339249 7:99929558-99929580 GCCGGCGCTCCACCCCCGTGGGG - Exonic
1030093356 7:105876762-105876784 GCCGGGGCCGCCCGCCTGCCGGG + Intergenic
1035265981 7:157690562-157690584 GCCGGCGCCCAGCGCCCGCGCGG + Intronic
1036729233 8:11247367-11247389 GCAGGGGCCGCCTGCCCCTGAGG + Intergenic
1036756916 8:11477054-11477076 GCTGGGGCCACCCACCCCTGGGG + Intergenic
1036789900 8:11710283-11710305 GCCGGGCCCCTCCTCCCCTGGGG - Intronic
1037882885 8:22581494-22581516 GCCAGAGCCCCTCGCCCCTGCGG + Exonic
1038800356 8:30743796-30743818 GCCTGGGCCCCCCGGCCTTGTGG - Intronic
1043306737 8:78804834-78804856 GCAGGGGCCCCCAGCGCGTCTGG + Intronic
1045353196 8:101361140-101361162 GCCGGGGCCACCTGCCTGAGAGG - Intergenic
1049370141 8:142260469-142260491 GCCGGGGCCCACGGCCAGGGAGG + Intronic
1049419469 8:142510556-142510578 GCCCGCGCCCCCGGCCCGCGCGG - Intronic
1049624637 8:143614552-143614574 GCCGGCCCCACCCGCCCCTGGGG + Intronic
1056369650 9:85941327-85941349 GCCGCAGCCCCCCGCGCGTGTGG + Intronic
1058885696 9:109320248-109320270 GCAGGGGCCCGCCGCCCGCCGGG + Exonic
1061365934 9:130172506-130172528 GCCGGGGCGCCCGGGGCGTGGGG - Intergenic
1061559780 9:131394614-131394636 GCCCGGGACCCCCGCCCCTCCGG - Intronic
1203778285 EBV:86181-86203 GCCGGGGCCTCCATCCAGTGGGG + Intergenic
1189324943 X:40106344-40106366 GCCCGCGCCCCCCGCCCGCCGGG - Intronic
1192425149 X:71068456-71068478 GCCCGGGGCCCAGGCCCGTGCGG - Intronic
1197806752 X:130404816-130404838 GCCAGGGCCCTCCACCTGTGTGG - Intronic
1198807305 X:140504767-140504789 GCCGGTGCCCGCCGCTTGTGTGG + Exonic