ID: 1119008493

View in Genome Browser
Species Human (GRCh38)
Location 14:70957601-70957623
Sequence TTGTCTAGGGCTAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119008487_1119008493 19 Left 1119008487 14:70957559-70957581 CCAGGACAGGGAAATCTGTAAAG 0: 1
1: 0
2: 4
3: 89
4: 938
Right 1119008493 14:70957601-70957623 TTGTCTAGGGCTAAGGAGGATGG 0: 1
1: 0
2: 4
3: 29
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119008493 Original CRISPR TTGTCTAGGGCTAAGGAGGA TGG Intronic
901096238 1:6682520-6682542 TGGTCTAGGGCTGAGGAGATGGG - Intronic
903150738 1:21406229-21406251 TTGCCTAGGGCTGAGGGGGTGGG - Intergenic
904380956 1:30110544-30110566 TTGTCTGGGGCAGAGGAGGCAGG - Intergenic
905317726 1:37094239-37094261 TAGTCTAGGCTAAAGGAGGAGGG + Intergenic
906260816 1:44388147-44388169 TTCTCTAGGTCTAAGGAGTGAGG + Intergenic
906582609 1:46948709-46948731 ATGAGTGGGGCTAAGGAGGAAGG - Intergenic
906712991 1:47945582-47945604 TTGTCAGGGACTGAGGAGGAGGG - Intronic
906720413 1:48000286-48000308 TTGCCTAGGGCTAGGAAGAATGG + Intergenic
906812341 1:48841096-48841118 TTTGCTAGGGGTTAGGAGGAAGG + Intronic
907512192 1:54970080-54970102 TTGTCTAGGGCAATGTAGCAAGG + Intergenic
908188484 1:61675864-61675886 TTGTATAGTGATTAGGAGGACGG + Intergenic
908634593 1:66148668-66148690 TTGCCTAGGGCTAAGGATGGTGG - Intronic
908819136 1:68065327-68065349 TTGCCAAGGGTTAAGGATGAGGG + Intergenic
910993098 1:93076337-93076359 TTGCCTAGGGCTTGGAAGGAGGG + Intergenic
911024850 1:93426025-93426047 TTGCCTATGGCTGAGGAGAATGG + Intergenic
911667458 1:100569690-100569712 TTTCCTAGGGATAAGCAGGAAGG - Intergenic
913178956 1:116300931-116300953 TTGCCTAGGGCTGAGGAGGTTGG - Intergenic
917921357 1:179753292-179753314 TTGCCCAGGGCTAGGGAGAAGGG + Intronic
918506551 1:185261183-185261205 TTGTCAAGGGCTGAAGGGGATGG - Intronic
920500275 1:206481052-206481074 TTGTCTTGGGCTAATAAGGGGGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921521064 1:216154652-216154674 TTGCCTAGGCCTGAGGAGGAGGG - Intronic
923374603 1:233348152-233348174 TTGCCTAGGGCTGAGAGGGAAGG - Intronic
923454994 1:234156943-234156965 TTGCCTAGGGTTGAGGAGGGTGG + Intronic
924420404 1:243904260-243904282 TTGTGTAGCGCTTAAGAGGATGG + Intergenic
1063633339 10:7755475-7755497 CTGTCTAGGGCTAGGGCAGAGGG + Exonic
1066008869 10:31173948-31173970 TTGGGGAGAGCTAAGGAGGATGG - Intergenic
1066428897 10:35334446-35334468 TTGTCTGGGGCTATGGAGTTTGG - Intronic
1066505823 10:36041696-36041718 TTGCCTAGGGCTTGGGAGAATGG - Intergenic
1067142436 10:43668496-43668518 TGGTCTAGGGCTGAGGTTGAAGG - Intergenic
1067411379 10:46067670-46067692 TTGCCTAGGGCTGGGGAGGATGG + Intergenic
1068121947 10:52789776-52789798 TTGCCAAGGGCTGAGGAGGAGGG - Intergenic
1068857392 10:61811508-61811530 TTGCCTAGGACTAAGGGGGCAGG + Intergenic
1070169620 10:73922903-73922925 TTGCCTAGGGCTGAGGGGGTTGG - Intergenic
1070399270 10:76038869-76038891 TTGGCCAGGGCTCAGCAGGATGG + Intronic
1070816904 10:79330088-79330110 TTTTCTAGGGCTGAGGAGATGGG - Intergenic
1071719148 10:88125417-88125439 TTGTTTAGGGCTGAGGAGGACGG + Intergenic
1072037714 10:91578984-91579006 TTGTCTGGGGATCAGGAGAAAGG + Intergenic
1072306531 10:94113088-94113110 TTGCTTAGGGCTAGTGAGGATGG + Intronic
1073257871 10:102166288-102166310 TTGCCAAGGGCTGGGGAGGAGGG - Intergenic
1075025722 10:118981814-118981836 TTCTCAAGGGCTGGGGAGGAGGG - Intergenic
1075827464 10:125371280-125371302 TTGCCTAGGGCTGGGGAGGATGG - Intergenic
1076105302 10:127817724-127817746 TTGTCATGTGCTAAGGATGATGG + Intergenic
1076394450 10:130128852-130128874 GTGGCTTGGGCTAAGGAGAAGGG + Intergenic
1077447359 11:2603540-2603562 TTGCCTAGGGCTGAGGGGGATGG - Intronic
1078240877 11:9529973-9529995 TTGTCTGGGGCAAAGCAGGGTGG - Intergenic
1078269374 11:9780773-9780795 TCGTCTTTGACTAAGGAGGAAGG + Intronic
1079341989 11:19618866-19618888 TTGGCTAGAGCTAAGGGGCAGGG + Intronic
1080137382 11:28871611-28871633 CTTTCTAGGGCCAAGGACGAGGG - Intergenic
1080286087 11:30614354-30614376 TTTGCTAGGGGTAAGGGGGAGGG - Intergenic
1081388403 11:42500524-42500546 TTGTCCAGATATAAGGAGGAGGG + Intergenic
1081642442 11:44765372-44765394 CTGTCTTGGGCAAAGGACGATGG + Intronic
1081979300 11:47256688-47256710 TTGACTAGGGCTAATAAGTACGG + Intronic
1084655843 11:70517690-70517712 TTGCCAAGGGCTCAGGGGGAGGG + Intronic
1084777374 11:71386564-71386586 TTGTCTGTTGCTACGGAGGAGGG + Intergenic
1088289866 11:108224270-108224292 TTTTCTAGTGCTAAGGAGTGTGG - Intronic
1088772434 11:113048663-113048685 TGGTCTAGTGTTAAGGAGTATGG + Intronic
1088868466 11:113871335-113871357 TAGACTAGGACTAAGGAGAAGGG + Intronic
1088971765 11:114780285-114780307 CTGTCTTGGGCCAAGGAGGCAGG + Intergenic
1089514790 11:119025615-119025637 TTGGCTAGGGGTAAGGCAGAAGG + Intronic
1090630548 11:128643739-128643761 TAGTCTAGGCCTATAGAGGAGGG - Intergenic
1091060082 11:132452922-132452944 ATGTCCAGGGGAAAGGAGGAGGG - Intronic
1091232507 11:133997918-133997940 TTCTATGGGGCTAATGAGGAAGG - Intergenic
1092154609 12:6274191-6274213 CTGTTTGGGGCCAAGGAGGAAGG - Intergenic
1093650112 12:21633741-21633763 CTGTCTAGATGTAAGGAGGAGGG - Intergenic
1093676881 12:21952067-21952089 TTGCCAAGGGCTAGGGAGCAGGG + Intergenic
1093876940 12:24359713-24359735 TTATCAAGGGATAAGGAAGAAGG + Intergenic
1094391560 12:29956856-29956878 TTGCCTAGGGCTAGGAAGGATGG + Intergenic
1096698351 12:53365542-53365564 TTGACTAAGGCTGAGGAGGGAGG - Intergenic
1098971228 12:76858973-76858995 TTGGCTATGGCCAAGGAGCAGGG - Exonic
1099079004 12:78151612-78151634 TTGCTAAGGGCTAAGGATGAAGG + Intronic
1099582766 12:84473761-84473783 TTGGCTAGTGCTAAGCAGGCAGG - Intergenic
1101338294 12:103817127-103817149 TTCTCTAGGCCTAATGATGATGG + Intronic
1103761277 12:123251909-123251931 CTGTCTAGAGCTGAGGAGCAAGG + Intronic
1103814703 12:123644995-123645017 TTGTTTATGGCTTTGGAGGAGGG + Intronic
1106192994 13:27470446-27470468 TTGCCTAGGGTTAAGGAGAAGGG + Intergenic
1107249755 13:38345599-38345621 TTGTCAGGGGCTAAGCAGGAGGG + Intergenic
1108175959 13:47792424-47792446 TTGTCTAGGGTTTAGGGGCAAGG + Intergenic
1110335056 13:74319024-74319046 TTGTGTAAGACTAAGGAGAATGG - Intergenic
1110945810 13:81414486-81414508 TTGCCAAGGTCTTAGGAGGAGGG + Intergenic
1113008197 13:105731878-105731900 TTGCCTAGAGCAAAGGAGGTTGG + Intergenic
1114239405 14:20852419-20852441 TTGCCAGGGGTTAAGGAGGAAGG + Intergenic
1116071826 14:40056834-40056856 TTGTCTAAGGCTGAGGATAAAGG + Intergenic
1116977216 14:51129788-51129810 TTGTGTAGGGCTGAGGAGTTGGG - Intergenic
1118233947 14:63982986-63983008 TTGTGTAGGGCTTAGGGGGTGGG - Intronic
1118314931 14:64720278-64720300 CTGTCTGGGGCCAAGTAGGATGG + Intronic
1119008493 14:70957601-70957623 TTGTCTAGGGCTAAGGAGGATGG + Intronic
1119970662 14:78966397-78966419 TTGTCAAGGGGTAAGTAGAAGGG + Exonic
1120254613 14:82103289-82103311 TTGAATAGGGCAAAGAAGGATGG + Intergenic
1120610839 14:86639427-86639449 TTGACTAGGGCTGAGGGTGAAGG - Intergenic
1121068905 14:90998187-90998209 TTGTTTAGGACTGGGGAGGATGG + Intronic
1121233483 14:92375786-92375808 TTGTCAAGGGCTGTGGGGGAGGG + Intronic
1121638384 14:95468979-95469001 TTCTCTAGGCCTAAGAATGAGGG + Intronic
1121642137 14:95492595-95492617 TTTCCTAGGGCTAGGGAGGTGGG + Intergenic
1122095436 14:99367186-99367208 TTGTTTAGGGCTGTGGAGAATGG - Intergenic
1122984513 14:105206027-105206049 CTGTCTAGTGCTGAGGAGCAGGG - Intergenic
1123801921 15:23830502-23830524 TTGCTTAGGGCTAGGAAGGATGG - Intergenic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1127817389 15:62623278-62623300 TTGTCTACGGCTAAGCATGAAGG + Intronic
1128424869 15:67531737-67531759 TTGCCTAGGGCTGAAGAGGTTGG + Intergenic
1131515486 15:93073669-93073691 TTGTCTAGGTCTGGGCAGGATGG + Intronic
1132212778 15:100036744-100036766 GTGCCTAGTGCTAATGAGGAGGG - Intronic
1133611814 16:7440707-7440729 CTGTTTAGGGCTGGGGAGGAGGG + Intronic
1135169128 16:20167525-20167547 TTGTCTAGGGCTTTGAAGGATGG + Intergenic
1136497526 16:30653190-30653212 TTTTCTTGGGGTGAGGAGGATGG + Intronic
1137562910 16:49514485-49514507 TTCTCAAGGGCTAGGAAGGAAGG + Intronic
1138231085 16:55336793-55336815 TTGGGTAGGGCTCAGTAGGAGGG + Intergenic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1140798598 16:78464192-78464214 TTGTCTAGTACTAAGCAGAATGG + Intronic
1141176994 16:81727400-81727422 TTGCTTAGGGCTGAGGGGGATGG + Intergenic
1146603597 17:34239033-34239055 GTGGCTGGGGCTCAGGAGGAAGG - Intergenic
1150381248 17:64721774-64721796 TTGCCTAGGGCTGGGGAGGAAGG + Intergenic
1150775253 17:68076329-68076351 TTGCCTAGGGCTGGGGAGGAAGG - Intergenic
1152024545 17:77800272-77800294 TTGCCTAGGGCTGCGGAGGTGGG + Intergenic
1155638847 18:27988235-27988257 GTGTCTAGGGCCACTGAGGATGG + Intronic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157550497 18:48577985-48578007 TTGCCTAGGGCTGAGGAAGCTGG - Intronic
1157769072 18:50328682-50328704 TTGCCCAGAGCCAAGGAGGAGGG - Intergenic
1158691759 18:59667364-59667386 TTCTCCAGGGCCAAGGAGGAAGG + Intronic
1158743283 18:60167914-60167936 TTCTCCAGGGCCAAGGGGGAAGG + Intergenic
1159491086 18:69135362-69135384 CTGTCAAGGGCTGAGGAGAACGG - Intergenic
1160841499 19:1148697-1148719 TTTTCTGGGGTGAAGGAGGATGG - Intronic
1163512880 19:17746604-17746626 TTGTCTAGGGCTGGGATGGAGGG + Intergenic
1164047527 19:21555416-21555438 TTTTCTAGTGCTAAGGAGGCTGG - Intronic
1164224006 19:23225773-23225795 TTGTCAAGGGCTGAGGAGAGGGG + Intronic
1164635654 19:29789372-29789394 TTGCCTAGGGCAGAGGAGGTGGG + Intergenic
1165700742 19:37935538-37935560 TTGACTGGGGCTCAGCAGGATGG + Intronic
1166611483 19:44203039-44203061 TTGCCTAGGGCTGAGGAGTTTGG + Intergenic
1166653862 19:44595872-44595894 TTGAGTGGGGCTTAGGAGGAAGG + Intergenic
1167296350 19:48652467-48652489 TTGTATAGGGCTTAAGAGGAAGG + Intergenic
925167520 2:1727255-1727277 TGGTCCAAGGCTCAGGAGGAGGG - Intronic
925345099 2:3166491-3166513 TTGTCGGTGGCTAAGGGGGAGGG + Intergenic
926819410 2:16836077-16836099 TGGAGTAGAGCTAAGGAGGATGG + Intergenic
927482236 2:23463437-23463459 TTGTTGAGGGCTAATGAGGGAGG + Intronic
928698397 2:33873473-33873495 TTGCCTAGGGCTGGGGAGGATGG - Intergenic
929073987 2:38062231-38062253 TTGTCGAGGGTTAAAGGGGAGGG - Intronic
929627678 2:43426854-43426876 TTGTCAAGAGCTAAGCAGAAAGG + Intronic
934733479 2:96674179-96674201 TTGCCTAGGGCTGGGGAGGTGGG - Intergenic
935634219 2:105237529-105237551 TTGACCAGGCCTTAGGAGGACGG + Intergenic
935836663 2:107062433-107062455 CTTTCTAGGGCTCAGGAGAAAGG - Intergenic
936391306 2:112076625-112076647 TTTTCTAGGGCTGAGCAGGGTGG - Intronic
938294701 2:130170815-130170837 TTGTCTGAGGCCAAGGTGGACGG + Intronic
939293396 2:140223682-140223704 TAGTTTAGGGCTAAGCATGATGG + Intergenic
941038416 2:160592153-160592175 TTGCCTAGAGCTAAGGGTGATGG - Intergenic
944013315 2:195001010-195001032 ATGGCTAGGGTTCAGGAGGAGGG - Intergenic
944170697 2:196773555-196773577 TGGGCCAGGGCTAAGAAGGATGG + Intronic
945836946 2:214845162-214845184 GAGTCTAGTGCTCAGGAGGAAGG - Intergenic
945863742 2:215153563-215153585 TTGTCAGGGGCTTGGGAGGAGGG - Intergenic
946090129 2:217214795-217214817 TTGTGTAGGGCAAATCAGGACGG - Intergenic
946111626 2:217424548-217424570 TTGTCTAGGGCTTGGGAGATGGG + Intronic
946382253 2:219357007-219357029 TTGCCTAGGGCTGAGGAGGGTGG + Intergenic
946898286 2:224346734-224346756 TTGTCTACAGCAAATGAGGAAGG + Intergenic
946943878 2:224799173-224799195 TTGCCTAGGGATGTGGAGGAAGG - Intronic
947250174 2:228093919-228093941 TTGCCTAGGCCTAAGGAGGATGG + Intronic
1168980110 20:1996820-1996842 TTCTCCAGGACTAAGGGGGAAGG - Intergenic
1170735248 20:19008678-19008700 GGGTCTAGGGCTATGGAGGAAGG - Intergenic
1170784812 20:19458536-19458558 TTGCCAGGGGCTAGGGAGGAGGG - Intronic
1172373431 20:34415601-34415623 TTCTCTGGGGCTAGTGAGGATGG + Intronic
1172451173 20:35024322-35024344 TTGCCTAGAGCTAAGGAGTTTGG - Intronic
1177795703 21:25776722-25776744 TTGCCTAGGGCTAGGGATAATGG + Intergenic
1178880884 21:36449280-36449302 TTGTCGGGGGCTGAGGGGGAAGG + Intergenic
1178901680 21:36604185-36604207 TTGGCCAGGGCAAAGGAGGAAGG - Intergenic
1178963135 21:37086687-37086709 CTGTCTTGGGCAAAGGAGTAGGG - Intronic
1179989680 21:44940586-44940608 TTGCTTAGGGCTGAGGGGGATGG - Intronic
1180342102 22:11627855-11627877 TTGTCTAGGAGAAAGGAGGCTGG + Intergenic
1182729962 22:32480564-32480586 TTGGCAAGGGCTTAGGAAGATGG - Intronic
1182916904 22:34042015-34042037 TTGCCTAGGGCTGAGGGAGAAGG - Intergenic
1183590339 22:38776158-38776180 TTTGCTGGGGCTCAGGAGGAAGG - Intronic
1184042280 22:41951281-41951303 TTGTCTATGGCATAGGGGGAGGG + Intergenic
1184435439 22:44471711-44471733 TTTGCTAGGGGCAAGGAGGAGGG - Intergenic
1184952345 22:47852770-47852792 GTGTTTAGTGCTAATGAGGATGG + Intergenic
949597434 3:5562820-5562842 TCATCTAGGGGTAAGGATGAAGG - Intergenic
949986158 3:9542904-9542926 TTGCTTAGGGCTGAGAAGGAAGG + Intronic
950589726 3:13928412-13928434 TTGTGGAGGGCGGAGGAGGATGG - Intergenic
950888696 3:16383876-16383898 TTGTCTGACTCTAAGGAGGATGG + Intronic
951565403 3:24007988-24008010 CAGTCTAGGGGTAAAGAGGAGGG - Intergenic
952077932 3:29720861-29720883 TTGTCTGGGGCTAATGAGGAAGG + Intronic
952266656 3:31793504-31793526 CTGTGTAGGTTTAAGGAGGATGG + Intronic
955135166 3:56209919-56209941 TTGTCAAGGGCGAAGTAAGAGGG - Intronic
956077416 3:65520156-65520178 TTGACTAGGGCTCAGCGGGATGG - Intronic
960076235 3:113489154-113489176 ATGTGGAGGGCTTAGGAGGAGGG - Intronic
960608306 3:119531089-119531111 TTGGCTATGGCCAAGGAGCAGGG - Intronic
962234093 3:133693154-133693176 GCGACTAGGGATAAGGAGGAAGG - Intergenic
963652467 3:147998762-147998784 TTATCTGGGGGAAAGGAGGAGGG - Intergenic
963726240 3:148924900-148924922 TTATCAAGAGCTAAGGCGGAGGG + Intergenic
964341074 3:155708942-155708964 TCGTCAGGGGCTAAGGGGGAGGG - Intronic
964650293 3:159003863-159003885 TTGTCTATAGGTAAGGAGAAGGG - Intronic
964716816 3:159731640-159731662 TTGTCTTGGAGTCAGGAGGAAGG + Intronic
964771422 3:160226750-160226772 TTCTTTAGGGCTGAGGAGAAAGG + Exonic
966629145 3:182052653-182052675 TTGTCTAGGGGTAGGGTGAAAGG - Intergenic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968226406 3:196975071-196975093 TTGACTCCGGCTGAGGAGGAAGG + Intergenic
968259266 3:197306599-197306621 TTGCCTAGGGTTGAGGAGCATGG + Intergenic
968626625 4:1628899-1628921 TTATCTTGGGCTACGGAGTAGGG - Intronic
969429090 4:7143350-7143372 TTGTCTGGGGAGAGGGAGGAAGG + Intergenic
972035283 4:34512314-34512336 TTCTAAAGGGCTAAGTAGGAAGG + Intergenic
972035969 4:34521340-34521362 TTGCCTAGGGCAGAGAAGGATGG - Intergenic
972166326 4:36288729-36288751 TTGACTAGGGCTAAAGAGAATGG + Intronic
973114688 4:46440711-46440733 TTTTCTAGGGGTAGGGATGAAGG + Intronic
974765105 4:66334190-66334212 TTGTCTCAGGCTAATGAGGTGGG - Intergenic
975043900 4:69778891-69778913 TTGCCAAGGGCTAAGGGGAAGGG + Intronic
978086783 4:104664713-104664735 TCAACTAGGGGTAAGGAGGAGGG + Intergenic
979272958 4:118783372-118783394 TTATCTAGGTCTATGGAGGAAGG - Intronic
981066258 4:140489497-140489519 TTATCTGGGGGTAGGGAGGAAGG - Intronic
981075849 4:140590930-140590952 TTGTCTATGTCTTAGGAGAAAGG + Intergenic
984951958 4:185014665-185014687 TCCTCCAGGGCTGAGGAGGAGGG - Intergenic
985479252 5:97459-97481 TTGCCTGGGGCTGGGGAGGACGG - Intergenic
987910051 5:24130752-24130774 TTGCCAATGGCTAAGGAAGAGGG - Intronic
990001003 5:50892589-50892611 TTGCCAAGGGCTAAGTAGGGGGG + Intergenic
991551955 5:67847005-67847027 TTGCCTAGGGCTGAGCAAGAGGG + Intergenic
991606792 5:68410449-68410471 ATGTGTAGGGCTAGGGAGAAAGG - Intergenic
992947188 5:81822297-81822319 TGGTCTAGGGCTCAGGGGCAGGG + Intergenic
993433291 5:87859237-87859259 TTGTTTAGGGCTCTGGATGAGGG + Intergenic
995360895 5:111295757-111295779 TTGTCTAGTGGTTAGGAGAATGG + Intronic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
996802368 5:127417817-127417839 GTGACTAGGGCTCTGGAGGAAGG + Intronic
997173176 5:131745914-131745936 TTTTCTAGGAGTAAGGTGGAGGG + Intronic
1002946520 6:1766552-1766574 TTGTGTATGGCTCGGGAGGAGGG + Intronic
1003014415 6:2456364-2456386 TTCTCTAGGGCTGACTAGGAGGG + Intergenic
1003278597 6:4673522-4673544 TTGTCTAGGGCTAGTGTGAAGGG - Intergenic
1004779618 6:18894055-18894077 AAGTCCAGGGCTAAGTAGGAGGG + Intergenic
1006208415 6:32371418-32371440 TTTCCTAGTGCTACGGAGGATGG + Intronic
1007325856 6:41059036-41059058 TTGCCTAGGGAAGAGGAGGAGGG + Intronic
1008880235 6:56374169-56374191 ATTTCTATGGCTAAGGATGATGG + Intronic
1008949283 6:57137759-57137781 TTGCCTAGGGATGAGGAAGATGG - Intronic
1010746317 6:79566060-79566082 TAGTCTTGGGGTGAGGAGGATGG + Intergenic
1011798178 6:90980541-90980563 TTGGCAAGGACTAAGAAGGAAGG + Intergenic
1013601832 6:111712413-111712435 TTGACTGGGGCTGGGGAGGAGGG - Intronic
1013945733 6:115720022-115720044 TTGTATGGGGCTAAGAAGCAAGG + Intergenic
1014392109 6:120875012-120875034 TTGTCTATGCCTCATGAGGAGGG + Intergenic
1014754392 6:125287606-125287628 ATGTCTGGGGCTTCGGAGGAAGG + Intronic
1017793357 6:157821117-157821139 TGGTGGAGGGCTAAGGTGGAAGG - Intronic
1020807682 7:12810608-12810630 TTGTCTAGGGCTAGGCAGCAGGG - Intergenic
1022097567 7:27150541-27150563 TTGGCTATGGCAAAGAAGGACGG - Intronic
1022743153 7:33142595-33142617 TTGTCAGGGGCTAGGGAGAAAGG - Intronic
1022864027 7:34398650-34398672 ATCCCTAGGGCAAAGGAGGAAGG + Intergenic
1023928366 7:44687924-44687946 TTGCTTAGGGCTTGGGAGGATGG - Intronic
1024631541 7:51252382-51252404 TTGTCTAGGGCTGGGGAGATTGG - Intronic
1026568589 7:71510379-71510401 TTGTCTAGGGCTGGGAGGGATGG - Intronic
1029444574 7:100604972-100604994 ATGTCTGGGGCTCAGGATGAGGG - Intronic
1031521360 7:122770428-122770450 TTGTCACTGGCTAAGGTGGAAGG - Intronic
1032333528 7:131002802-131002824 TTGGCTAGGGCTCAGGTGGATGG - Intergenic
1033523814 7:142189824-142189846 ATGGCTAGGGCTCAGGAGGTAGG - Intronic
1034180168 7:149130911-149130933 TTGGTTAGGGGTAAGGAAGAGGG + Intronic
1034711410 7:153194646-153194668 TTGTCAGGGGTTAAGGATGAAGG + Intergenic
1035447797 7:158954910-158954932 TTGTCTAGGCCTGTGGGGGACGG - Intronic
1038148803 8:24923735-24923757 TTCTAAAGGGCTAAGTAGGAAGG + Intergenic
1038893676 8:31756349-31756371 CTGTTAAGGGCAAAGGAGGAAGG + Intronic
1038968231 8:32600836-32600858 TTTTCTAGGGATCTGGAGGAAGG - Intronic
1039997821 8:42549564-42549586 TTGCCTGGGGCTATGGAAGAGGG + Intronic
1040506720 8:48055724-48055746 TTGTTTAGGTCTAAGGGAGATGG - Intronic
1040678174 8:49776350-49776372 TTGTCCAGAGCTAAAGAGGTTGG - Intergenic
1042183001 8:66110821-66110843 TGGTATAGGGCTAGGGAGTAGGG - Intergenic
1044470873 8:92565679-92565701 TTGGCAAGAGCTTAGGAGGAGGG - Intergenic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1046357431 8:113107041-113107063 TTGTCTAAGGCCCAGGGGGAAGG - Intronic
1048949235 8:139480468-139480490 TTGTCCAGGGCTGAGGAGACGGG + Intergenic
1049158119 8:141079462-141079484 TTGTTTAGGGTTGAGGATGATGG - Intergenic
1049949105 9:627263-627285 TGGTTTAGGGAGAAGGAGGAGGG - Intronic
1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG + Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1055377143 9:75660903-75660925 TTGCCTAGAGCTAAGGGGGTTGG + Intergenic
1055688648 9:78806262-78806284 TTGTCTTGGGCTGAGGTGGTTGG - Intergenic
1055913976 9:81381218-81381240 GTGCCTGGGGCTAAGGAGAAAGG + Intergenic
1056077415 9:83055597-83055619 TTGTCATGGGCTAAAAAGGAAGG - Intronic
1056728098 9:89140291-89140313 TTTTCTAGGGCTAATAAGCAGGG + Intronic
1056819762 9:89830790-89830812 TTGCCAGGGGCTGAGGAGGAGGG - Intergenic
1057695809 9:97322261-97322283 TTGTCCAGGGCTGGGGAGGAGGG - Intronic
1057925509 9:99143815-99143837 TTGCCTAGGGCTAAGGAGTTTGG - Intronic
1058772011 9:108244142-108244164 TAGTATAGGGCTTAGAAGGAAGG - Intergenic
1058861593 9:109122029-109122051 TTTTAAAGGGCTAAGTAGGAAGG + Intergenic
1059359490 9:113729993-113730015 GTTTCTAGGGATAAGGCGGAGGG - Intergenic
1059936636 9:119318456-119318478 TTGTCAGGGGCAAAGGAGAAAGG + Intronic
1061086648 9:128403334-128403356 TTGCCTAGGGCTGGGGAGAAGGG + Intergenic
1062068634 9:134542846-134542868 TTGTTTTGGGGTAAGGAGGGAGG + Intergenic
1186595055 X:10972311-10972333 ATGTCTAGGACTAAGAGGGAAGG - Intergenic
1186802518 X:13107544-13107566 TTGCCTGGGGCTAAGGAGTAGGG + Intergenic
1187228939 X:17402627-17402649 TTGTCTAGGGCTGGGAAGAAGGG + Intronic
1187242696 X:17528079-17528101 TTGTCTAGGGCAGTGGGGGAGGG + Intronic
1187954845 X:24507171-24507193 TTGTCTAGGGCTAAAGAGAAGGG - Intronic
1188336070 X:28934546-28934568 TTGCCTATGGCTGAGGGGGAAGG - Intronic
1190009007 X:46767143-46767165 GTGTCTGGGGCTAAGTGGGAGGG + Intergenic
1192405285 X:70879099-70879121 TTGCCTAGGGCTGAGGGTGAGGG + Intronic
1194071279 X:89329006-89329028 GTGTTTTGGGCTAAGGAAGAAGG - Intergenic
1195309827 X:103621390-103621412 TTGGCTAGGGTTGGGGAGGATGG + Intronic
1195911479 X:109892341-109892363 TTGCCTAGGTTTAAGGAGGTGGG - Intergenic
1196438991 X:115701505-115701527 TTGTCTAGGGCTGTTGAGGGTGG + Intergenic
1196909446 X:120470550-120470572 TTTTCTAAGGCTAAGGAGAGAGG + Intergenic
1197354525 X:125420791-125420813 TTGCCAAGGGTTAGGGAGGAGGG + Intergenic
1197485512 X:127045535-127045557 TTGGCCAGGGGTGAGGAGGAGGG - Intergenic
1197759588 X:130018296-130018318 TTGCCTAGGGTTGGGGAGGATGG + Intronic
1200032756 X:153309685-153309707 TTGTGTTGGGCTAAGGGGGTGGG + Intergenic
1200725512 Y:6664744-6664766 GTGTTTTGGGCTAAGGAAGAAGG - Intergenic
1200971964 Y:9162253-9162275 TGGTCCAGGGCAAAGGATGAAGG - Intergenic
1200977891 Y:9232056-9232078 GTGGCTGAGGCTAAGGAGGAAGG + Intergenic
1202139065 Y:21702037-21702059 TGGTCCAGGGCAAAGGATGAAGG + Intergenic