ID: 1119009764

View in Genome Browser
Species Human (GRCh38)
Location 14:70972483-70972505
Sequence GCATACTTGTTAGCTGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119009764 Original CRISPR GCATACTTGTTAGCTGCTTG GGG Intronic
900508783 1:3046215-3046237 GAATTCTTTTTACCTGCTTGGGG - Intergenic
903161760 1:21494091-21494113 GCATACATGTTAGGTGTTTGTGG - Intergenic
904373068 1:30062924-30062946 GATTACTTGGTAGCTGCATGTGG - Intergenic
907414319 1:54303683-54303705 AAGTACTTGGTAGCTGCTTGTGG - Intronic
908323369 1:62999867-62999889 ACATATTTGGTAGCTTCTTGGGG + Intergenic
911772833 1:101768926-101768948 TCATACCTGTTTACTGCTTGAGG + Intergenic
912532244 1:110334269-110334291 GAATGCTTGTTTGCTACTTGTGG + Intergenic
913508030 1:119536737-119536759 GCATTCTTGTTAAGTGCTTATGG + Intergenic
914806847 1:150998000-150998022 GCATACATTTTAACTGCTAGAGG - Intronic
916508937 1:165454269-165454291 GCATCCTTAACAGCTGCTTGTGG - Intergenic
919961762 1:202477373-202477395 GCTTACTTGGTAGGTGATTGTGG - Intronic
921696493 1:218216654-218216676 GGATATGTGTTAGATGCTTGTGG - Intergenic
921873219 1:220164343-220164365 GGATAGTAGTCAGCTGCTTGGGG + Intronic
1063367877 10:5502313-5502335 GCATACTTGCAAGCCACTTGTGG - Intergenic
1063767442 10:9159048-9159070 GTATACTTGTAAACTGCTAGGGG + Intergenic
1065865139 10:29908492-29908514 GCAAACTTTTTAACTCCTTGAGG + Intergenic
1066807043 10:39267882-39267904 GGATATTTGTGAGCTCCTTGAGG - Intergenic
1066807230 10:39270808-39270830 GGATATTTGTGAGCTCCTTGAGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1070423916 10:76266352-76266374 GATTACCTGTTAGCTGCTAGAGG + Intronic
1075263715 10:120983745-120983767 GGAAACTTGTTTGCTGTTTGGGG - Intergenic
1076167166 10:128292018-128292040 ACATACTGCTAAGCTGCTTGGGG - Intergenic
1079433075 11:20415705-20415727 GCACACTTGTTACCTGGTTTGGG - Intronic
1082149758 11:48722486-48722508 GGATATTTGTGAGCAGCTTGTGG + Intergenic
1082150062 11:48728002-48728024 GCATATTTGTGAGCGGTTTGAGG + Intergenic
1082221907 11:49648720-49648742 GCTTCCTTTTTAGCTACTTGAGG + Intergenic
1082297743 11:50463373-50463395 GGATACTTGATAGCTCATTGAGG + Intergenic
1082575141 11:54793962-54793984 GCATATTTGATAGCTCATTGAGG - Intergenic
1082587855 11:54964976-54964998 GTATACTTGATAGCTCATTGAGG + Intergenic
1082600957 11:55153325-55153347 GGATACTTCTCAGCTGTTTGAGG - Intergenic
1082604276 11:55204603-55204625 GGATATTTCTGAGCTGCTTGAGG - Intergenic
1086627126 11:88970481-88970503 GCTTCCTTTTTAGCTACTTGAGG - Intronic
1091291053 11:134440125-134440147 CCATACATGATAGATGCTTGGGG - Intergenic
1094869622 12:34586005-34586027 GCACATTTGTGAGCTCCTTGAGG - Intergenic
1095067703 12:37801065-37801087 GGATATTTGTGAGCTGTTTGAGG + Intergenic
1095071628 12:37857926-37857948 GAATACTTCTGAGCTGTTTGAGG - Intergenic
1095637183 12:44448547-44448569 GCATATTTGTGAGCTCCTTAGGG + Intergenic
1095720098 12:45391488-45391510 GAATACTTGTTAGCTATTTGGGG + Intronic
1096714318 12:53482248-53482270 GCATTCTTGTTTTCTGCTAGGGG - Intronic
1097512768 12:60564827-60564849 GCATGCTTGTTGGCTGCTGCAGG + Intergenic
1100177352 12:92045950-92045972 ACATGCTTTTTAGATGCTTGTGG + Intronic
1100392742 12:94158317-94158339 GCAGCCTGGTGAGCTGCTTGTGG - Intronic
1102822792 12:115922660-115922682 GCATATTTTCTACCTGCTTGTGG + Intergenic
1103740645 12:123088993-123089015 GCATAAATGTTAGCTGCTGTTGG + Intronic
1105076072 13:16024951-16024973 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105076278 13:16028874-16028896 GGATACTTGTGAGCTGATTGAGG + Intergenic
1105076472 13:16032791-16032813 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105076858 13:16040628-16040650 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105077082 13:16044546-16044568 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105077496 13:16052372-16052394 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105077693 13:16056287-16056309 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105077883 13:16060028-16060050 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105078084 13:16063943-16063965 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105078288 13:16067858-16067880 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105078440 13:16070754-16070776 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105078488 13:16071605-16071627 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105078691 13:16075519-16075541 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105078878 13:16079262-16079284 GGATACTTGTGAGCTGATTGAGG + Intergenic
1105079084 13:16083181-16083203 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105079279 13:16086923-16086945 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105079685 13:16094587-16094609 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105079881 13:16098329-16098351 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105080091 13:16102244-16102266 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105080305 13:16106163-16106185 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105080504 13:16110078-16110100 GGATACTTGTGAGCCGATTGAGG + Intergenic
1105080811 13:16114632-16114654 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105081037 13:16118061-16118083 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105081701 13:16128336-16128358 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105081921 13:16131765-16131787 GGAAATTTTTTAGCTGCTTGAGG + Intergenic
1105082153 13:16135191-16135213 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105082383 13:16138617-16138639 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105082608 13:16142040-16142062 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105082834 13:16145468-16145490 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105083062 13:16148895-16148917 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105083516 13:16155746-16155768 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105083743 13:16159171-16159193 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105083969 13:16162598-16162620 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105084213 13:16166812-16166834 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105084786 13:16177089-16177111 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105084979 13:16180512-16180534 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105085555 13:16190787-16190809 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105085751 13:16194211-16194233 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105085945 13:16197638-16197660 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086134 13:16201063-16201085 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086339 13:16204488-16204510 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086539 13:16207914-16207936 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086730 13:16211339-16211361 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105086925 13:16214764-16214786 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105087115 13:16218188-16218210 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105087313 13:16221612-16221634 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1105087717 13:16228462-16228484 GGAAATTTCTTAGCTGCTTGAGG + Intergenic
1109085086 13:57961106-57961128 GCAAACTTGTGAGTTCCTTGTGG + Intergenic
1111772387 13:92614557-92614579 GCAGAGTTGTGAGCTGCTTTTGG + Intronic
1113995767 14:16068031-16068053 GGATATTTGTGAGCGGCTTGAGG + Intergenic
1113998554 14:16119586-16119608 GTATATTTGTGAGCTGTTTGAGG + Intergenic
1115431316 14:33321956-33321978 GCAGATTTGTCAGCTGCCTGTGG - Intronic
1115694998 14:35887458-35887480 GAATACTTGTTGGCTACTTTAGG - Intronic
1115804742 14:37038228-37038250 GCATACTGGTTACCTCCATGGGG + Intronic
1116485663 14:45445016-45445038 CCATGCTTGTTAGTTTCTTGAGG + Intergenic
1119009764 14:70972483-70972505 GCATACTTGTTAGCTGCTTGGGG + Intronic
1123226928 15:17047835-17047857 GGATACTTGTGAGCCGATTGAGG + Intergenic
1123227964 15:17066107-17066129 GGATACTTGTGAGCACCTTGAGG + Intergenic
1128902470 15:71437090-71437112 CCATAATTGTAAGCTTCTTGAGG - Intronic
1130730225 15:86484171-86484193 ACACACTTGTTACTTGCTTGAGG - Intronic
1137076793 16:35975919-35975941 GGATACTTGTGAGCGGTTTGAGG - Intergenic
1137076965 16:35979335-35979357 GGATATTTGTGAGCTGTTTGAGG - Intergenic
1140637371 16:76930921-76930943 GCTTACTTGGTAGCTACTTGTGG + Intergenic
1203012632 16_KI270728v1_random:312691-312713 GCATATTTGTTAGCTCATTGAGG + Intergenic
1203030967 16_KI270728v1_random:585850-585872 GCATATTTGTTAGCTCATTGAGG + Intergenic
1203040754 16_KI270728v1_random:748581-748603 GCATATTTGTTAGCTCATTGAGG - Intergenic
1145417000 17:22724253-22724275 GGATATTTGTGAGCTCCTTGAGG + Intergenic
1146097989 17:29951043-29951065 GCAAACTTATTAACTGCTTTGGG - Intronic
1146530461 17:33603851-33603873 GCAGACTTGTTATCAGCCTGGGG - Intronic
1149492817 17:57097267-57097289 GCCCACTTCTCAGCTGCTTGTGG + Intronic
1150039445 17:61843676-61843698 GCATGCTTGTAAGCTTCTTGAGG + Intronic
1156148832 18:34220399-34220421 GAATCATTCTTAGCTGCTTGAGG - Intronic
1164334133 19:24293336-24293358 GCATACTTGGTAGCCGTTTGGGG + Intergenic
1164351749 19:27354747-27354769 GGATATTTGTGAGCTGATTGAGG - Intergenic
1164351775 19:27355261-27355283 GAATATTTGTGAGCTGCTTGAGG - Intergenic
1164352627 19:27371039-27371061 GGATATTTGTGAGCTGTTTGAGG - Intergenic
1164356329 19:27436250-27436272 GCATATTTGTGAGCAGTTTGAGG + Intergenic
1164357342 19:27454200-27454222 GTATATTTGTGAGCTGTTTGAGG + Intergenic
1165479866 19:36056257-36056279 GGATACCTGGTAGCTGCTGGTGG + Intronic
1165969552 19:39614955-39614977 GCATAATTGTAAGCTTCTTGAGG + Intergenic
929315746 2:40476333-40476355 GCATTCTTGATACCTGCTGGAGG + Intronic
929337128 2:40762577-40762599 GCATACTAGTAGGATGCTTGTGG + Intergenic
931766869 2:65464656-65464678 GCATTCTCGATGGCTGCTTGAGG + Intergenic
938519295 2:132050548-132050570 GCAAATTTGTAATCTGCTTGTGG + Intergenic
938536015 2:132248634-132248656 GGATATTTGTGAGCGGCTTGAGG - Intronic
938759098 2:134407676-134407698 GCATACCTGTATGCTCCTTGTGG - Intronic
939439863 2:142233164-142233186 GCATAATTGTAAGCTTCCTGAGG + Intergenic
941684878 2:168438119-168438141 GCATACTTCCAAGCTGGTTGGGG + Intergenic
942189227 2:173454619-173454641 GGGGACTTGTTAACTGCTTGAGG - Intergenic
944276661 2:197846611-197846633 CCATATTTGTCAGCTTCTTGAGG - Intronic
946425802 2:219595855-219595877 GCATACTAGTTAGCTGTTGTAGG + Intergenic
1169274234 20:4222148-4222170 CGATACTATTTAGCTGCTTGGGG + Intronic
1171733796 20:28743974-28743996 GGATATTTGTTAGCGGTTTGTGG + Intergenic
1171733840 20:28744832-28744854 GTATATTTGTGAGCTGTTTGAGG + Intergenic
1171742665 20:28919190-28919212 GGATACTTGTGAGCACCTTGAGG - Intergenic
1171743260 20:28929988-28930010 GGATACTTGTGAGCCGATTGAGG - Intergenic
1171766829 20:29292590-29292612 GGATATTTGTGAGCAGCTTGAGG - Intergenic
1171864267 20:30468994-30469016 GGATACTTCTTAGATGTTTGAGG - Intergenic
1171864474 20:30472758-30472780 GGATATTTGTGAGCAGCTTGAGG - Intergenic
1171864911 20:30480458-30480480 GGATATTTGTGAGCGGCTTGAGG - Intergenic
1175195658 20:57241626-57241648 GCCTCCTTGTTAGGTGCTGGGGG + Intronic
1175595680 20:60230613-60230635 TCATACTTATGAGCTGTTTGTGG - Intergenic
1176324768 21:5382772-5382794 GGATACTTGTGAGCACCTTGAGG + Intergenic
1176482321 21:7313187-7313209 GGATACTTGTGAGCACCTTGAGG + Intergenic
1176531737 21:7970341-7970363 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176531933 21:7974256-7974278 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176532137 21:7978167-7978189 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176532349 21:7982250-7982272 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176532558 21:7986333-7986355 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176532771 21:7990417-7990439 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176532977 21:7994331-7994353 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176533194 21:7998579-7998601 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176533395 21:8002494-8002516 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176533604 21:8006409-8006431 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176533810 21:8010324-8010346 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176534015 21:8014234-8014256 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176534215 21:8018148-8018170 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176534529 21:8024443-8024465 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176534701 21:8027683-8027705 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176534875 21:8030922-8030944 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176535075 21:8034836-8034858 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176535274 21:8038749-8038771 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176535465 21:8042490-8042512 GGATACTTGTGAGCCGATTGAGG - Intergenic
1176745689 21:10650277-10650299 GCAAAATTGTTAGCGGTTTGAGG - Intergenic
1180311293 22:11239115-11239137 GGATATTTGTGAGCGGCTTGAGG - Intergenic
1180401169 22:12427736-12427758 GGATACTTGTGAGCACCTTGAGG + Intergenic
949637839 3:6003313-6003335 GGACACTTGTTATCTCCTTGGGG - Intergenic
950630981 3:14281807-14281829 CCATAATTGTTAGCTTCCTGAGG + Intergenic
954790953 3:53133067-53133089 GCATCCATGTAAGCTGCTTTGGG + Intergenic
956026933 3:64993065-64993087 GCATACCTGTTAGCTCCTCAGGG + Intergenic
956093227 3:65689913-65689935 GCATACGTGTCTGCTGCTTCTGG + Intronic
956989885 3:74751234-74751256 GCAGCCATGTAAGCTGCTTGTGG - Intergenic
959470092 3:106739328-106739350 GCTTAGCTGTTAGCTGCTTCAGG - Intergenic
966010119 3:175064724-175064746 TCATACTTGTTAGCTTCTCTGGG + Intronic
970839644 4:20452270-20452292 CTATACTTGTTAAATGCTTGGGG + Intronic
971913116 4:32822404-32822426 CCATACCTGTTAGGTGCCTGAGG - Intergenic
973223903 4:47760581-47760603 GCATACTTGTTAACGGCCTTAGG + Intronic
978534131 4:109743375-109743397 GCACTCTTGTAAGCTTCTTGAGG + Intronic
984378733 4:178963975-178963997 TCATACTAGTTATCTGCATGGGG + Intergenic
985186145 4:187318027-187318049 GCACACGTGTTAGCTTCTGGGGG - Intergenic
986496597 5:8348071-8348093 ACATACTTGTTGGCTGCATTTGG - Intergenic
988194432 5:27984690-27984712 CCATAATTGTAAGCTTCTTGAGG - Intergenic
989265796 5:39472087-39472109 GCATTCTTGTCAGAAGCTTGTGG + Intergenic
989831827 5:45929224-45929246 GCATATTTGTGAGCTCATTGAGG + Intergenic
991996621 5:72394065-72394087 GAATACTTTTGAGCTGCTTTAGG - Intergenic
994082094 5:95718432-95718454 GCAAATTTGTTAGCTAATTGTGG + Intronic
994548131 5:101195698-101195720 GCATACTTGTATGCTGGTTTTGG - Intergenic
994597765 5:101860808-101860830 GCATACTCGTTGGCTGCTGCAGG - Intergenic
996181573 5:120426504-120426526 GCCTCCCTGTTAGCTGCTCGAGG + Intergenic
999291897 5:150431213-150431235 GCAGGCTTGTGAACTGCTTGAGG + Intergenic
1007765996 6:44160179-44160201 ACATACTTGTTATTTGTTTGTGG - Intronic
1009546948 6:65032574-65032596 CCATAATTGTTAGCTTCTTGAGG + Intronic
1010895846 6:81362401-81362423 GAATACTTAATAGGTGCTTGTGG + Intergenic
1012823565 6:104120652-104120674 ACCTACTTGTTTGCTGCTGGTGG - Intergenic
1017642779 6:156510357-156510379 GCATCCCTGTGAGATGCTTGTGG + Intergenic
1018604843 6:165585959-165585981 GGTTAGTTGATAGCTGCTTGTGG - Intronic
1018681081 6:166265928-166265950 GCCTACATGTTAGGGGCTTGAGG + Intergenic
1018771480 6:166974896-166974918 GGTTAGTTGATAGCTGCTTGTGG - Intergenic
1025519514 7:61705402-61705424 GGATATTTGTGAGCTGTTTGAGG + Intergenic
1025519553 7:61706255-61706277 GGATATTTGTGAGCTGTTTGAGG + Intergenic
1025520093 7:61716995-61717017 GGATACTTGTGAGCAGTTTGAGG - Intergenic
1025521664 7:61740402-61740424 GCATATTTGTGAGCAGCTTGAGG - Intergenic
1025522220 7:61750978-61751000 GGATACTCGTGAGCTGTTTGAGG - Intergenic
1025526598 7:61820811-61820833 GGACACTTGTGAGCTCCTTGAGG + Intergenic
1025528461 7:61844928-61844950 GCATATTTGGTAGCTCATTGAGG - Intergenic
1025543838 7:62134054-62134076 GGATATTTGTGAGCTGTTTGAGG + Intergenic
1025543877 7:62134907-62134929 GGATATTTGTGAGCTGTTTGAGG + Intergenic
1025544415 7:62145647-62145669 GGATACTTGTGAGCAGTTTGAGG - Intergenic
1025545949 7:62169097-62169119 GGATACTCGTGAGCTGTTTGAGG - Intergenic
1025581677 7:62727367-62727389 GGATACTTGGTAGCTCATTGAGG + Intergenic
1033122130 7:138675670-138675692 TTATACTTTTTAGCTGTTTGGGG + Intronic
1035970143 8:4238688-4238710 CAATACCTGTTAGCTGTTTGGGG + Intronic
1039852468 8:41381139-41381161 GCTTACCTGTTTGCTGGTTGGGG - Intergenic
1041728775 8:61043978-61044000 GCATAATTGTTAGCTCTTTTTGG + Intergenic
1046099667 8:109600125-109600147 GTATGCTTGTCAGCTCCTTGAGG + Intronic
1047082396 8:121477754-121477776 GCATAATTGTGAGATGCTGGTGG - Intergenic
1048852118 8:138655291-138655313 ACATACTTAATAGCTGCATGTGG - Intronic
1051857767 9:21588992-21589014 CCATACTTGTCAGCTTCTTTTGG - Intergenic
1052827697 9:33188923-33188945 ACATATTTTTTAACTGCTTGTGG - Intergenic
1059698355 9:116749895-116749917 ACATACTTGTAAGCTTCCTGAGG + Intronic
1060181720 9:121538939-121538961 GCATCCTTGGAAGCTGCCTGAGG - Intergenic
1062088485 9:134661362-134661384 GCAAACTGGTCATCTGCTTGGGG - Intronic
1203382518 Un_KI270435v1:70387-70409 GGATACTTGTGAGCAACTTGAGG + Intergenic
1203401332 Un_KI270519v1:102917-102939 GGATACTTGTGAGCTGATTGAGG + Intergenic
1203401485 Un_KI270519v1:105641-105663 GGATATTTGTTAGCCGTTTGAGG + Intergenic
1187814610 X:23217510-23217532 GCATGCTAGTTAGCTGTTTATGG + Intergenic
1188493134 X:30756594-30756616 GCACACTTGTTAGCTGCAGCAGG - Intergenic
1191269953 X:58452830-58452852 GGATATTTGTGAGCGGCTTGAGG + Intergenic
1191270303 X:58457008-58457030 GGATATTTGTGAGCTGTTTGAGG + Intergenic
1191270837 X:58466683-58466705 GGATATTTGTGAGCTGTTTGAGG + Intergenic
1192240924 X:69327514-69327536 GCATACTAGTTGGGTACTTGGGG - Intergenic
1193277012 X:79601584-79601606 GCATAATTGCTCTCTGCTTGAGG - Intergenic
1193624573 X:83801933-83801955 GAATACTTGTTTGCTGCTGGTGG - Intergenic
1194407238 X:93511735-93511757 GGATACTTGTGCACTGCTTGTGG - Intergenic
1197779567 X:130146099-130146121 TCATAGTTGATAACTGCTTGAGG - Intronic
1199770741 X:150973741-150973763 TCAGACTTGTTTGCTGTTTGTGG + Intergenic
1201298974 Y:12489910-12489932 GCATGCTTTATAGCTCCTTGTGG + Intergenic