ID: 1119012561

View in Genome Browser
Species Human (GRCh38)
Location 14:71010205-71010227
Sequence CTGTGCCACTGTAAGATCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119012561 Original CRISPR CTGTGCCACTGTAAGATCTT CGG (reversed) Intronic
901005011 1:6167280-6167302 CTGTGTCACTGTGTGACCTTGGG + Intronic
901267737 1:7924762-7924784 TTGTCCCACTGGAAGATCTTTGG - Intronic
901650493 1:10740198-10740220 CTGAGCCACTGTGAGACATTGGG - Intronic
903760039 1:25691382-25691404 CTTTGCCACTGCATGACCTTGGG + Intronic
908543665 1:65145269-65145291 CTCTGCCAATGTATGACCTTTGG - Intergenic
910900968 1:92120328-92120350 ATGTCCCACTGGAAGGTCTTCGG + Intronic
913038239 1:114996094-114996116 TTAGGCCACTGTAAGAACTTTGG + Intergenic
919617090 1:199821344-199821366 CTGGGCCATTGTAAGTTCTTTGG - Intergenic
920324463 1:205151810-205151832 CTGTCCCACTGGAAGGTTTTCGG + Intronic
923211677 1:231809046-231809068 CTGGGCCACTGTAAGTTTTCAGG + Intronic
924042127 1:239993819-239993841 CTGTGCAAGTCTAAGATTTTGGG + Intergenic
924784270 1:247180828-247180850 CTGTGCCACTGTCTGTCCTTTGG + Intergenic
1063905001 10:10772281-10772303 CTGTTCAACTATATGATCTTGGG + Intergenic
1066567892 10:36739625-36739647 CTGTCCCGCTGGAAGCTCTTTGG + Intergenic
1069918837 10:71803662-71803684 CTGTGCTAGTAAAAGATCTTTGG + Intronic
1070000563 10:72373493-72373515 TTTTACCACTGCAAGATCTTAGG - Intronic
1070159431 10:73857043-73857065 CCCTGCCACAGTAAGCTCTTGGG - Intronic
1070393842 10:75994382-75994404 CTGTGGCACTGTACAATCCTAGG - Intronic
1070987714 10:80702615-80702637 CTGTGCCTCTGTGAGACCTCTGG + Intergenic
1071978694 10:90981347-90981369 TTGTCCCACTGGAAGGTCTTTGG - Intergenic
1072001280 10:91198200-91198222 CTGGGCCACTGTAAGGACTGTGG - Intronic
1072901475 10:99411323-99411345 CTTTTCCACTTTCAGATCTTAGG - Intronic
1075770051 10:124926511-124926533 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
1079504764 11:21141425-21141447 CTGTTTCACTGTGTGATCTTGGG + Intronic
1080589992 11:33714827-33714849 TTGTCCCACTGGAAGGTCTTAGG + Intronic
1081384177 11:42451750-42451772 CTGTGTCACTGGATAATCTTAGG + Intergenic
1082003501 11:47407709-47407731 CTGTGCCACTGTGTGACCCTGGG + Intronic
1084773619 11:71360460-71360482 CTCTGCCACTGTGTGATCTTGGG + Intergenic
1085142495 11:74159421-74159443 TTGTTCCACTGGAAGGTCTTAGG - Intronic
1085872028 11:80361809-80361831 CTGTACCACTGTAATAATTTTGG - Intergenic
1088300852 11:108356825-108356847 CTTTGCCATTGTAAGGACTTTGG + Intronic
1091628805 12:2142629-2142651 TTGTGCCACTGGAAGGTCTTCGG - Intronic
1091929867 12:4387020-4387042 GTGTGGCCCTGTAAGATGTTAGG + Intergenic
1092447034 12:8567518-8567540 CAGTGACACTGTAACATTTTGGG - Intergenic
1092665636 12:10793438-10793460 TTGTCCCACTGCAAGGTCTTTGG + Intergenic
1092777991 12:11960836-11960858 CTTTCCAACTGTAAGATCTTAGG - Intergenic
1093182172 12:15979260-15979282 TTGTGCCACAGGAAGAGCTTGGG + Intronic
1096543187 12:52319949-52319971 CTCTGCCACTGTGAGCTCTCAGG - Intronic
1097144259 12:56929257-56929279 CTGTGCCACTATGTGACCTTGGG + Intronic
1098213413 12:68190051-68190073 CTGTTCATCTGTAACATCTTGGG - Intergenic
1098800272 12:74948791-74948813 GTGTCCCACTGGAAGGTCTTCGG + Intergenic
1099412219 12:82345097-82345119 CTGTGACAGTGTTAGCTCTTTGG + Intronic
1100558363 12:95721097-95721119 CTATGCCATTGTAAGACCCTTGG + Intronic
1102101064 12:110279606-110279628 CTGTGCCACTGTCACTGCTTGGG - Intergenic
1102819747 12:115897613-115897635 ATGTGTCACTGTAAATTCTTAGG - Intergenic
1105664867 13:22542630-22542652 ATTTGCCACAATAAGATCTTGGG - Intergenic
1106298562 13:28440691-28440713 CTGTGTAACTGTGAGACCTTGGG + Intronic
1106936622 13:34729575-34729597 GAATGCCACTGTAAGAACTTTGG - Intergenic
1107271883 13:38628898-38628920 TTGTGCCACTGTTAAATCTATGG + Intergenic
1108515564 13:51199537-51199559 CTGTGGTACTGTAAGAGCTAAGG + Intergenic
1109104738 13:58236814-58236836 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
1111958480 13:94783538-94783560 CTGTGCATCTGAAAGGTCTTGGG + Intergenic
1111970478 13:94909216-94909238 GTGTGCCATTGTAAGAACTTTGG - Intergenic
1112143048 13:96667782-96667804 CTGTGACACTGTAATGTCTAAGG - Intronic
1112897847 13:104323182-104323204 CTGTGCCACTGTTAGAAGGTAGG - Intergenic
1114856867 14:26457820-26457842 TTGTCCTACTGAAAGATCTTTGG - Intronic
1116051099 14:39804318-39804340 ATGTGCCACTCAAGGATCTTAGG + Intergenic
1116700898 14:48240398-48240420 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
1117129039 14:52666046-52666068 CACTGCCACTGTGTGATCTTGGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118079225 14:62339092-62339114 CTCTGCCAGTGTCAGATCCTGGG + Intergenic
1119012561 14:71010205-71010227 CTGTGCCACTGTAAGATCTTCGG - Intronic
1121679145 14:95778235-95778257 GTTTGCCAATTTAAGATCTTGGG - Intergenic
1123806124 15:23875527-23875549 CTTTGCCACTGGAAAATTTTTGG + Intergenic
1126453220 15:48833332-48833354 CTGTGGCACTGCAAGTTCTCTGG + Intronic
1127979538 15:64024566-64024588 CTCTGCCACTGTGAGCTCCTTGG - Intronic
1129203891 15:74023854-74023876 CTGAGCCACTGTATGGTTTTGGG - Intronic
1129373117 15:75110204-75110226 CTAAGTCACTGTAGGATCTTGGG + Intronic
1130104771 15:80921080-80921102 CTGTGCCGCTGCAGGATCTGAGG + Exonic
1130156254 15:81352706-81352728 TTGTCCCACTGGAAGGTCTTCGG - Intronic
1131097180 15:89663521-89663543 CTGTGGCCCTGGCAGATCTTTGG - Intergenic
1133487772 16:6236899-6236921 ATGTGCCACTGTGTGACCTTGGG - Intronic
1135537710 16:23307047-23307069 CTGACCCACTGCAAGATTTTGGG - Intronic
1136648981 16:31649156-31649178 CTATGCCACTGTTAGTCCTTTGG + Intergenic
1138572908 16:57887185-57887207 CTGTGACAATTTAAGATATTTGG - Intronic
1138979861 16:62254570-62254592 CTGTACCACTGCACGATTTTAGG + Intergenic
1140268037 16:73436877-73436899 CTGTGTCACTGGAGGGTCTTGGG - Intergenic
1140996591 16:80265945-80265967 CATTGCAACTGTAAGCTCTTTGG + Intergenic
1141851364 16:86648395-86648417 CTGTCTCACTGTGTGATCTTAGG + Intergenic
1142653239 17:1371125-1371147 TGGTGCCACTGTATCATCTTGGG - Intronic
1145735385 17:27226371-27226393 TTGTCCCACTGGGAGATCTTCGG - Intergenic
1145820888 17:27834386-27834408 TTGTCCCACTGGAAGGTCTTTGG + Intronic
1146486202 17:33244919-33244941 GTCTGCCACTGTGTGATCTTGGG + Intronic
1147887637 17:43695404-43695426 CAGTCTCACTGTATGATCTTGGG - Intergenic
1149797964 17:59539028-59539050 CTGTACGACTGTAAGAACTGAGG - Intergenic
1150867834 17:68872672-68872694 TTGTCCCACTGGAAGGTCTTCGG - Intronic
1152597204 17:81243586-81243608 CTGGGTCACGGTAAGATATTTGG + Intergenic
1155456921 18:26027113-26027135 GTTTGGCACTGTAAGTTCTTTGG - Intronic
1156460844 18:37320558-37320580 CTGTGCCTCTGTGGGAACTTGGG + Intronic
1156828247 18:41459259-41459281 CTGTACCACACTGAGATCTTTGG - Intergenic
1157300576 18:46476233-46476255 CTTTGCAACTGTGAGAACTTGGG - Intergenic
1157545682 18:48544970-48544992 CTGTGCCGCTGTAAGGGCCTTGG - Intronic
1159085663 18:63788239-63788261 TTGTCCCACTGAAAGGTCTTCGG - Intronic
1159187224 18:64990784-64990806 TTGTCCCACTGGAAGGTCTTTGG - Intergenic
1160970781 19:1766905-1766927 CTGGGCCACAGAAAGATCTCAGG + Intronic
1161264724 19:3358989-3359011 CTGTGCGTCTGTGAGATCTCGGG + Intergenic
1162897274 19:13772468-13772490 TTTTCCCACTGTATGATCTTGGG + Exonic
1164700091 19:30278895-30278917 CTGAGCCACTGGTAGATTTTGGG - Intronic
1165503278 19:36207160-36207182 GTAAGCCACTGTAAGAACTTTGG + Intronic
1165699155 19:37924298-37924320 TTGTCCCACTGGAAGGTCTTCGG + Intronic
925600225 2:5600961-5600983 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
927032003 2:19130509-19130531 CTCCACCACTGTAAGCTCTTTGG + Intergenic
927738866 2:25548696-25548718 CTATGCCACTGTAAGGACTGTGG + Intronic
928033735 2:27802592-27802614 CTGGGCCACTGGTAGTTCTTTGG - Intronic
930535453 2:52640229-52640251 TTGTCCCACTGAAAGGTCTTCGG - Intergenic
935122143 2:100192358-100192380 CTGTGCCACTCTTAGTTATTAGG + Intergenic
935644411 2:105322055-105322077 TTGTCCCACTGGAAGGTCTTCGG - Intronic
936000558 2:108824477-108824499 TTGTTCCACTGGAAGGTCTTCGG + Intronic
938813545 2:134876537-134876559 TTGTCCCACTGGAAGGTCTTCGG + Intronic
939880305 2:147623749-147623771 TTTGGCCACTGTAAGATCATTGG + Intergenic
940086867 2:149869525-149869547 TTGTGCCAATGTCAAATCTTTGG + Intergenic
940202855 2:151170343-151170365 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
940330833 2:152472762-152472784 CTCTGCCACTGTGTGACCTTGGG + Intronic
940589343 2:155701234-155701256 TTCTGCCACTCTAATATCTTGGG + Intergenic
940998329 2:160174725-160174747 GTGTTCTACTGTAATATCTTTGG - Intronic
941201322 2:162514102-162514124 CTGTGCCCATTTAAAATCTTGGG + Intronic
943580030 2:189674158-189674180 CTGTTCAACTGTAAGCTCCTTGG + Intergenic
944536934 2:200719882-200719904 CTGTGAATCTGTAAGGTCTTGGG - Intergenic
945658581 2:212656415-212656437 TTGTGTCACTGTCAGATTTTGGG + Intergenic
945681482 2:212919127-212919149 CTGTCCCACTGTAAAATCTTTGG + Intergenic
946803321 2:223444272-223444294 CTAGGCCACTGTAAGGTCTCTGG - Intergenic
947663803 2:231890286-231890308 CAGTGCCTCTGGAAGCTCTTTGG + Intergenic
1169040194 20:2487637-2487659 CTGTACAAGTGTAATATCTTTGG + Intronic
1170200162 20:13733986-13734008 CTATGTCACTGTATGATATTGGG - Intronic
1174310888 20:49653326-49653348 CTGTGTCACTGGCACATCTTTGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175124645 20:56742258-56742280 CTGTGAAGCTGTAATATCTTTGG + Intergenic
1175301287 20:57944810-57944832 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
1180948071 22:19707741-19707763 CTGTGCCGCTGTGAGATTTGCGG + Intergenic
1181759951 22:25051348-25051370 CTCTGCCACTGTGTGACCTTGGG + Intronic
1182160471 22:28116304-28116326 CTGTGCCACTGTAAATCCTGAGG + Intronic
1182957262 22:34438266-34438288 TTGTGTCAGTGTAAAATCTTAGG - Intergenic
1184844946 22:47076837-47076859 CTGTGGGACTGTGAGATCATTGG + Intronic
949993471 3:9598591-9598613 CTGTGCCTCTGTCAGTTCCTGGG + Intergenic
950660196 3:14462342-14462364 CTGAGCCACAGTAGGATCTGTGG + Intronic
952461333 3:33529679-33529701 TTGTCCCACTAAAAGATCTTCGG + Intronic
954772715 3:52987095-52987117 CTGTCCCACTGGAAGATCTTCGG + Intronic
955617439 3:60824036-60824058 ATGGGCCACTCTAAGAACTTAGG + Intronic
958039727 3:88212384-88212406 CTGTGAAACTGTAATGTCTTCGG + Intergenic
961023884 3:123534719-123534741 GTGTCCCACTTTAAGGTCTTCGG - Intronic
962728309 3:138256049-138256071 CTGCTCCAATGTAAGATGTTTGG - Intronic
963421581 3:145067276-145067298 CTATGCTACTGTAACATCATAGG + Intergenic
963427287 3:145147982-145148004 CTGTGACACTGTAGGAGTTTTGG + Intergenic
964883344 3:161449336-161449358 CTGTGCTACTGTAATAATTTTGG + Intergenic
965514238 3:169603959-169603981 TTTTGGCACTCTAAGATCTTTGG + Intronic
966298334 3:178449983-178450005 TAGTGCCACCCTAAGATCTTGGG - Intronic
967816910 3:193807243-193807265 CAGAGCCACTGTTTGATCTTAGG - Intergenic
971690359 4:29826822-29826844 CTTAGCCACAGTGAGATCTTGGG + Intergenic
972614404 4:40684443-40684465 CTGTTCCACTCTATGACCTTGGG - Intergenic
972724375 4:41733490-41733512 CTGTTCCATTGTAACATTTTTGG + Intergenic
974831774 4:67198422-67198444 CTATCCCACTGCATGATCTTGGG + Intergenic
974858007 4:67483660-67483682 TTGTCCCACTGTAAGGTCTTTGG - Intronic
976416139 4:84777794-84777816 CTGTGAAACTGTAGGATCTATGG - Intronic
977676346 4:99752195-99752217 CTGTCCCACTGGAAGGTCTTTGG + Intergenic
977700753 4:100020119-100020141 CTGTTCCACTGCTTGATCTTGGG + Intergenic
978624837 4:110673306-110673328 TTGTGCCGCTGGAAGTTCTTTGG - Intergenic
980177008 4:129358094-129358116 CTTTGCCACTGTGTGATCCTAGG + Intergenic
981450860 4:144896071-144896093 CTGAGCCACTATTATATCTTGGG - Intergenic
981790370 4:148529585-148529607 TTGTCCCACTGTAAGGTCTATGG - Intergenic
983281289 4:165683922-165683944 CTGTGCCAATGTTTGGTCTTGGG - Intergenic
988013332 5:25519025-25519047 ATGTGCCACAGTATGATCTGTGG - Intergenic
989175299 5:38518841-38518863 TTGTCCCACTGGAAGGTCTTCGG - Intronic
992730396 5:79660870-79660892 ATGTCCCACTGGAAGATCTTTGG - Intronic
995304646 5:110631115-110631137 CTGTGCCACTGTAGGCTGCTGGG - Intronic
995424598 5:112006087-112006109 CTCTTCCATTGTAAAATCTTAGG - Intergenic
995704315 5:114970575-114970597 CTTTGCCACTATAATATGTTGGG + Intergenic
995764749 5:115602691-115602713 CTGTACCTCTGAAAGATCTACGG - Intronic
1000046919 5:157529673-157529695 GTGTGCCACTGCAAGTTCCTAGG + Intronic
1001217123 5:169866354-169866376 CAGTTTCACTGTGAGATCTTGGG + Intronic
1001556338 5:172640106-172640128 CTGTACCATTGGAAGATCTTGGG + Intergenic
1004069979 6:12288967-12288989 CTGGGCCACTGTGAGCGCTTTGG + Intergenic
1004123322 6:12847681-12847703 CTGTGCCACTGAAACATCTTGGG - Intronic
1004559651 6:16735697-16735719 CTTTGTCAATGTAAGATATTAGG - Intronic
1006777733 6:36609105-36609127 CTGAGCCACTGCCAGCTCTTGGG + Intergenic
1010948387 6:82005622-82005644 CTGTGCCACACCATGATCTTAGG - Intergenic
1014347022 6:120284004-120284026 TTGTCCCACTGGAAGGTCTTTGG + Intergenic
1014806936 6:125840072-125840094 CTGTCCCACTGGAAGTTCTCAGG - Intronic
1019819748 7:3233776-3233798 CTGAGCCACTGTGTGATTTTGGG + Intergenic
1021230861 7:18085612-18085634 CTCTGCCACTGTGAGACCTTGGG + Intergenic
1021267566 7:18543989-18544011 TGAGGCCACTGTAAGATCTTTGG + Intronic
1023656404 7:42426066-42426088 TTTTCCCACTGGAAGATCTTCGG + Intergenic
1025261497 7:57422877-57422899 CTATGCCACTGTGAGCCCTTTGG - Intergenic
1025738819 7:64180065-64180087 CTATGCCACTGTGAGCCCTTTGG - Intronic
1026128295 7:67598623-67598645 CTGTCCCACTGTATGTCCTTGGG + Intergenic
1028256780 7:88608938-88608960 CTGTGTCACTGAATGGTCTTTGG + Intergenic
1030123093 7:106129734-106129756 GTGTGCGACTTTAAGATGTTTGG + Intergenic
1030130542 7:106195809-106195831 CTAAGCCACTGTAAGGACTTTGG - Intergenic
1030707655 7:112711259-112711281 TTGTCCCACTGGAAGGTCTTCGG - Intergenic
1031413654 7:121469796-121469818 TTGAGCCACTGGAAGGTCTTCGG + Intergenic
1031573952 7:123393212-123393234 CTTTGCCACTTTAAAGTCTTTGG - Intergenic
1035704139 8:1662008-1662030 CTGTGCCACAGCAAGACCTCAGG + Intronic
1036447598 8:8835946-8835968 CTGTGCCACTGTAGTAGCATCGG - Intronic
1036951525 8:13144287-13144309 CAGTGCCCCTGCAGGATCTTAGG + Intronic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1043211841 8:77529511-77529533 TTATGCCACTGGAAGGTCTTTGG + Intergenic
1044967553 8:97587747-97587769 ATGTGCCACTGTCAACTCTTAGG - Intergenic
1045676874 8:104616934-104616956 CTCCGCCACTGTATGTTCTTGGG + Intronic
1046765780 8:118068149-118068171 CTCTGGCACTGTAAGCTCTGTGG - Intronic
1047136622 8:122086021-122086043 CTGTCCCACTGGAAGGTCTTTGG - Intergenic
1048085804 8:131178209-131178231 TTGTCCCACTGGAAGATCTGTGG + Intergenic
1050234613 9:3564618-3564640 TTGTCCCACTGGAAGATCTTTGG + Intergenic
1050266995 9:3901651-3901673 CTGTGCCACTTTCATATCCTTGG - Intronic
1050848608 9:10256289-10256311 TTGTCCCACTGGAAGGTCTTCGG + Intronic
1054328072 9:63727577-63727599 CTGTGCCACTGTAAATTTTGAGG + Intergenic
1056477182 9:86964109-86964131 GTGGGCCACTGTAAGAACTTTGG - Intergenic
1056841924 9:90004704-90004726 CTATGCCCCTGGAAGATTTTCGG + Intergenic
1060444537 9:123675845-123675867 ATGGGCCACTGTAAGATCAGTGG - Intronic
1186250227 X:7657729-7657751 CTGAGCCACTGTTACATCCTGGG + Intergenic
1186799312 X:13077356-13077378 CTGTGCCAGTGTCAGAGCATGGG - Intergenic
1187101006 X:16191802-16191824 CTGTGCCATTGTGTGACCTTTGG - Intergenic
1187276744 X:17822913-17822935 CTCTGCCACTGTGAGAGCATAGG + Intronic
1188574202 X:31626376-31626398 ATGTACCACTGTAATATATTTGG - Intronic
1189400894 X:40667586-40667608 GTGGGCCACTCTAAGAACTTAGG + Intronic
1192586004 X:72318635-72318657 ATGGGCCACTGTAAGAACTTTGG - Intergenic
1193145661 X:78073052-78073074 TTGTCCCACTGGAAGGTCTTTGG + Intronic
1195143298 X:101986349-101986371 GTTTCCCACTGTAGGATCTTAGG - Intergenic
1195781697 X:108473408-108473430 TTGTCCCACTGGAAGGTCTTTGG - Intronic
1196161875 X:112494031-112494053 CTTTGCCAATGTATGTTCTTGGG + Intergenic
1197605751 X:128583136-128583158 CTGTGCCATTGTAACATGTATGG - Intergenic
1199245570 X:145599950-145599972 CTCTGCCACTGTAAGTGCATTGG + Intergenic
1199270386 X:145875500-145875522 CTGTCTCACTGGAAGGTCTTCGG - Intergenic
1202059368 Y:20869711-20869733 CTGTGCCACAGGAAGGTCTAGGG + Intergenic