ID: 1119012604

View in Genome Browser
Species Human (GRCh38)
Location 14:71010966-71010988
Sequence CAATGGAAACAGTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119012600_1119012604 -10 Left 1119012600 14:71010953-71010975 CCTGATTCTGTAACAATGGAAAC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG 0: 1
1: 0
2: 2
3: 49
4: 341
1119012597_1119012604 22 Left 1119012597 14:71010921-71010943 CCTCTCAAAAAATTATTAAATTG 0: 1
1: 0
2: 6
3: 70
4: 837
Right 1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG 0: 1
1: 0
2: 2
3: 49
4: 341
1119012596_1119012604 23 Left 1119012596 14:71010920-71010942 CCCTCTCAAAAAATTATTAAATT 0: 1
1: 3
2: 151
3: 2978
4: 9413
Right 1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG 0: 1
1: 0
2: 2
3: 49
4: 341
1119012599_1119012604 -9 Left 1119012599 14:71010952-71010974 CCCTGATTCTGTAACAATGGAAA 0: 1
1: 0
2: 2
3: 24
4: 246
Right 1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG 0: 1
1: 0
2: 2
3: 49
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119012604 Original CRISPR CAATGGAAACAGTAGGAGGA GGG Intronic
900494025 1:2968125-2968147 CCCTGGAAACAGTAGCAGCATGG - Intergenic
901977255 1:13005000-13005022 CAATGGCACCAGTTAGAGGACGG - Intronic
902004831 1:13223934-13223956 CAATGGCACCAGTTAGAGGACGG + Intergenic
902024049 1:13369669-13369691 CAATGGCACCAGTTAGAGGACGG + Intronic
902027051 1:13391893-13391915 CAATGGTGCCAGTTGGAGGAGGG - Intronic
902606669 1:17572997-17573019 CAAGGGAAACAGTAGGATTTGGG - Intronic
904208106 1:28868034-28868056 CCATGGAAACTGGAGGAGGAGGG + Intergenic
905346991 1:37318100-37318122 CAAGGGCAACGGGAGGAGGAAGG - Intergenic
906013258 1:42549713-42549735 CATTGTACACAGTAGGAGTAGGG - Intronic
906092942 1:43198154-43198176 CAAAGAAAACAGTAGGGGGTGGG - Intronic
906135254 1:43495268-43495290 CACTGGGAACAGCAGGAGGGAGG + Intergenic
906724668 1:48035578-48035600 CAAAGGAAAGAGCAGGGGGAGGG + Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
908769970 1:67587067-67587089 CAATGGTAAGAGTAGGAGGATGG - Intergenic
910223759 1:84916040-84916062 CCATAGTAACAGTTGGAGGAAGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911364943 1:96926845-96926867 AAATGGAAACACTGGGTGGAGGG - Intergenic
911733737 1:101315330-101315352 ACATGGAAACAGTAGGAGGCAGG - Intergenic
912905019 1:113695829-113695851 CTATGGAAACAGTAAAAGCATGG + Intergenic
912921966 1:113877148-113877170 CATAGGGAACAGTAGGAGGAGGG + Intergenic
913691525 1:121284299-121284321 AAATGCAAAAAGTAGGAGCATGG + Intronic
914146021 1:144995682-144995704 AAATGCAAAAAGTAGGAGCATGG - Intronic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
915965754 1:160306840-160306862 CAATGGAGGCAGCAGAAGGAGGG + Intronic
916083234 1:161249913-161249935 TAATGGAAACAATAGGTGCAAGG + Intergenic
916215374 1:162389106-162389128 CAGTGCAAACAGTAGCAGGGAGG - Intergenic
919972894 1:202592150-202592172 GAATTCAAACAGTGGGAGGAAGG + Exonic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920478852 1:206302777-206302799 AAATGCAAAAAGTAGGAGCATGG + Intronic
920785511 1:209037437-209037459 TAATGGAATCAATTGGAGGAGGG - Intergenic
920883567 1:209902931-209902953 CAAAGGTAAAGGTAGGAGGAGGG - Intergenic
920940459 1:210477348-210477370 CTAGGGAAACAGTGGGAAGAAGG - Intronic
921934533 1:220785063-220785085 CAAAGGAAAATGGAGGAGGAGGG - Intergenic
922040369 1:221890430-221890452 CTTTGGAAACAGTAAGAGAAAGG - Intergenic
922986194 1:229867704-229867726 CACTAGAAACTGCAGGAGGAAGG - Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
1063182645 10:3619113-3619135 CCCTGGAAACAGGAGGAGGAGGG + Intergenic
1063773717 10:9235676-9235698 CTATGGAAATATTGGGAGGAGGG - Intergenic
1063884084 10:10560391-10560413 CAATGGAAACATTAGATGGTTGG - Intergenic
1063948304 10:11199041-11199063 CCATGGATACCTTAGGAGGAGGG + Intronic
1063966680 10:11351626-11351648 CAATGGAAAAATTATGTGGATGG + Intergenic
1065196952 10:23275924-23275946 GAATGGAAACTGTAGGAAAAAGG - Intronic
1065378823 10:25068548-25068570 CAATCGACACCCTAGGAGGAGGG + Intergenic
1068917739 10:62451100-62451122 CAATGGCTACAGAATGAGGAAGG + Intronic
1069653312 10:70067878-70067900 CAATTGAAAAGGGAGGAGGAAGG + Intronic
1070170658 10:73930315-73930337 GAATGGAAACAGTGGCTGGAGGG + Intergenic
1070272116 10:74966209-74966231 AAATGGCAAAAGGAGGAGGAAGG - Intronic
1070442104 10:76456359-76456381 CAAAGGAAATAGTAGTGGGAGGG + Intronic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071135183 10:82445536-82445558 TAAGGGAAACAGTGGGAGAAAGG - Intronic
1071948552 10:90676498-90676520 TAATGGAAACAGAAGGGAGAAGG - Intergenic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1074692956 10:116023557-116023579 CCATGGAACCATTAGGAGAATGG + Intergenic
1075342943 10:121661749-121661771 CCATGGAAGCAATAGCAGGAAGG + Intergenic
1076136176 10:128046823-128046845 CAAAGGACACAGTAAGAGGCCGG + Intronic
1076944914 10:133640071-133640093 CCATGGAAACAGTAGAACGCTGG + Intergenic
1077277689 11:1722888-1722910 CAATGGAAGCCGTAAGAGAACGG + Intergenic
1077823268 11:5773937-5773959 TCATGGACACAGTAGAAGGACGG - Intronic
1080327476 11:31094145-31094167 CAATGGAAACAGAGGCATGAAGG + Intronic
1081698095 11:45132619-45132641 GAATGGAAACAGAAGTAGAAAGG - Intronic
1082588897 11:54980300-54980322 CAAGGGAAAAACTAGAAGGAAGG + Intergenic
1082965795 11:58965004-58965026 CAATGGAAGAAGTGGCAGGAAGG - Intronic
1085738334 11:79058569-79058591 TAATGGACACTGTAGTAGGATGG + Intronic
1085821147 11:79795099-79795121 CAATGCAAAAATTATGAGGAAGG - Intergenic
1086141236 11:83502836-83502858 CAATGGAAACAGAAAAAGAATGG - Intronic
1086484972 11:87289773-87289795 GGCTGGAAACAGTAGGGGGAAGG - Intronic
1087278592 11:96185018-96185040 AAATCTAAACAGTATGAGGAAGG - Intronic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1087817916 11:102679380-102679402 CAAGAGAGAGAGTAGGAGGAGGG + Intergenic
1088901456 11:114120816-114120838 CAATGGGAACTGTAGAAGAAAGG + Intronic
1089636637 11:119818098-119818120 AAAAGGAAACAGCAGCAGGAAGG + Intergenic
1090080617 11:123609809-123609831 CCATGGAAAAAGGAGGAGAATGG + Exonic
1090710186 11:129376627-129376649 CAGTGGAGACAGTAGGAGGCTGG - Intronic
1090718459 11:129451527-129451549 CAATGGTAACTGTGGGAGGGAGG - Exonic
1090769799 11:129909767-129909789 CTGTGGAAACAGTAGCAGGCTGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091691994 12:2603620-2603642 CAATGGAGACAGCAGGAGACAGG - Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1092847100 12:12593999-12594021 TAATTGAAACAGTTGGAGGCCGG + Intergenic
1093698626 12:22192054-22192076 CAAGGGAGACAGTAGGAATAAGG - Intronic
1094451449 12:30586819-30586841 CACTGGAAACAGAATGAGAATGG - Intergenic
1096492743 12:52021890-52021912 GAATGGCAAGAGTAGGAGTATGG - Intergenic
1096546641 12:52344705-52344727 CAAATGAAACAGGAGGAGCAAGG + Intergenic
1097281673 12:57848330-57848352 CAATGGGAACTGCAGCAGGAAGG - Intergenic
1098051737 12:66461505-66461527 CAATGCAAACAGCTGTAGGAAGG - Intronic
1098409334 12:70163561-70163583 CAATGTAATCAGTATTAGGACGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099349965 12:81554162-81554184 AAATGGCAACAGTAGGAAGAAGG + Intronic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1099893552 12:88617922-88617944 GAATGTAAGCAGTAGGAGGTCGG + Intergenic
1101191156 12:102334140-102334162 CAAAGGAAAAAGTAAAAGGATGG - Intergenic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103114597 12:118315986-118316008 CAATGGAAAAAGGAGTAGGGAGG + Intronic
1103929203 12:124440274-124440296 CATTGGAAACAGGAAAAGGAGGG + Intronic
1104504002 12:129313315-129313337 TTATGGGAAGAGTAGGAGGACGG - Intronic
1104647608 12:130508462-130508484 CAATGGAATCAGCAGGTGCAGGG - Intronic
1105722380 13:23129222-23129244 CAAAGGAAGGAGTAGGAGTAGGG + Intergenic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1112228157 13:97561352-97561374 AAATGGAAACAGTAGAAAGGAGG + Intergenic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1113153925 13:107295633-107295655 AAATGGAAGGAGTGGGAGGAGGG + Intronic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114460653 14:22884256-22884278 TGCTGGAAACAGGAGGAGGAAGG + Intronic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115315254 14:32018622-32018644 CTAGAGAAACAATAGGAGGAGGG - Exonic
1115400447 14:32953304-32953326 AAATGAAAACAGTTGCAGGAGGG - Intronic
1116288287 14:43001431-43001453 CAATTGAGACAGAAGGAAGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117003489 14:51395092-51395114 CTTTGGGAACAGTAGGAGGTGGG - Intergenic
1118461066 14:65987501-65987523 CATTGCAAAGAGTGGGAGGAGGG + Intronic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1119986840 14:79147919-79147941 AAATGGGAAAAGTAGGTGGATGG + Intronic
1120527454 14:85593635-85593657 CAAAAGAAACAGTAGAAGGTTGG - Intronic
1120725530 14:87935560-87935582 GAATGGCAACATTCGGAGGAAGG - Intronic
1121006773 14:90495730-90495752 CAAGGAAAACAGTGGGATGATGG + Intergenic
1121209858 14:92200063-92200085 CAATGGGACCCATAGGAGGAGGG + Intergenic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1124891085 15:33733634-33733656 CAGTGGAAACAGTATAATGATGG + Intronic
1125021552 15:34991488-34991510 CATGGGAGACAGTAGGAGGCAGG + Intergenic
1125409901 15:39395254-39395276 CAATGGAAGGAGAAAGAGGAAGG + Intergenic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1129461046 15:75700268-75700290 CAATGGCCCCAGTGGGAGGAGGG + Intronic
1129723774 15:77891457-77891479 CAATGGCCCCAGTGGGAGGAGGG - Intergenic
1129913486 15:79247339-79247361 GAATGGAAAGAGTAGGGAGAGGG - Intergenic
1130025238 15:80265359-80265381 ACATGGAGTCAGTAGGAGGATGG - Intergenic
1130271687 15:82454170-82454192 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130464035 15:84181557-84181579 CAATGGAAAGAGCAGGAGAAGGG + Intronic
1130474836 15:84255487-84255509 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130482252 15:84369543-84369565 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130488649 15:84413276-84413298 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130500232 15:84491984-84492006 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130507787 15:84562463-84562485 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130586331 15:85186189-85186211 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132428119 15:101737776-101737798 CAATGGAAAGAGCAGGAGAAGGG - Intronic
1133685900 16:8165389-8165411 CAATGGAAAGGGTGGGAGGGGGG - Intergenic
1134375362 16:13667137-13667159 CCATGGAAATAGTAGAAGGATGG - Intergenic
1135197608 16:20407603-20407625 TCATGGAGACAGTAGAAGGACGG + Intergenic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138156062 16:54703888-54703910 CCGTTGAAACACTAGGAGGAAGG + Intergenic
1138396533 16:56708976-56708998 CACTGGCAACAGCAGGGGGATGG + Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142498523 17:319879-319901 AAATGGAAATAGTGGGGGGAGGG + Intronic
1144700644 17:17336387-17336409 TCATGGAGATAGTAGGAGGATGG - Intronic
1145866715 17:28246553-28246575 CCAGGGAGACAGTGGGAGGAGGG + Intergenic
1146336067 17:31971728-31971750 AAATGAAAACAGTTGCAGGAGGG - Intronic
1149183680 17:53972187-53972209 CAATGGAGGGAGTAAGAGGAGGG + Intergenic
1150543138 17:66124235-66124257 GAATGGAAAGAGTGGGAGAAGGG - Intronic
1151188197 17:72379136-72379158 CAATGGGAACAGCAGGATGGGGG + Intergenic
1152520239 17:80851835-80851857 AAATGGAAAAAGTGGCAGGACGG - Intronic
1153344353 18:4009834-4009856 CCAAGGGAACAGTAGCAGGATGG + Intronic
1153764750 18:8364991-8365013 TAATGGAAAAAGGAGGATGATGG + Intronic
1156025442 18:32648603-32648625 CCATGGAGACAGTAGAAGGATGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157555400 18:48610101-48610123 CAATGGAAGCAGGTGTAGGATGG + Intronic
1157690481 18:49677962-49677984 GAATGAAAACAGAAGCAGGAAGG - Intergenic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158707629 18:59807491-59807513 CAATGGAAGCAGCCAGAGGAAGG - Intergenic
1159553863 18:69924663-69924685 AAAGGGCAACAGTAGGATGAAGG + Intronic
1161440953 19:4291398-4291420 CCATGGAAACAGCAGAAGTAGGG + Intergenic
1162823025 19:13234846-13234868 CTATGGGAACAGAAGGATGAAGG + Intronic
1166753761 19:45178311-45178333 CAATGGAAGCCGGAGTAGGAGGG - Intronic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1168159648 19:54501162-54501184 CAAATGACACTGTAGGAGGAGGG + Intronic
1168182354 19:54670975-54670997 CCATGGAAAGAGGAGGAGGAAGG + Intronic
925650157 2:6081022-6081044 CATTGACAACAGTAGGAGGCAGG - Intergenic
926179473 2:10628498-10628520 CAATGGATAGAGTAGGAGAAGGG - Intronic
926452626 2:13024126-13024148 CAATGGAAAGAGAGGGAGGGAGG + Intergenic
926707051 2:15844305-15844327 CCATGGAAACAGGAGAAGGAAGG - Intergenic
927352486 2:22133704-22133726 GAAAGGAAAGAATAGGAGGAAGG - Intergenic
928024507 2:27728707-27728729 CATTGGAAGGAGTAGGGGGATGG - Intergenic
928439683 2:31281922-31281944 CAATGGAAACATTATCAAGAGGG + Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930284140 2:49406892-49406914 CAAAGGAAACAATAGAATGAAGG - Intergenic
930696552 2:54417217-54417239 GAAAGGAAACAGAAGTAGGAGGG + Intergenic
931044385 2:58334002-58334024 CAATGGAAAAGAAAGGAGGAGGG - Intergenic
937234653 2:120423402-120423424 CAATGGAAAGAGGAGGAGGGAGG - Intergenic
937872030 2:126792810-126792832 CCAGGGAAACAGTGGGAGGCAGG + Intergenic
938877943 2:135553449-135553471 CCATGGAAAGAGGAGTAGGAAGG + Intronic
941440116 2:165524207-165524229 CAATTCAAATAGCAGGAGGAGGG + Intronic
942581522 2:177424105-177424127 CAAGGGGAGCAGTAGAAGGAGGG - Intronic
943219046 2:185080301-185080323 CAATAGAAACAGTAGAAAGGTGG + Intergenic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
944982386 2:205136231-205136253 GAATGGAAAGAAAAGGAGGAAGG - Intronic
945264941 2:207881778-207881800 CACTGGAAAGAGTAGGAGAAAGG - Intronic
946864917 2:224034335-224034357 CAATGAACACAGGAGGAGAAAGG + Intronic
947337344 2:229101080-229101102 CAATGGAAACTTGGGGAGGATGG + Intronic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947829135 2:233126370-233126392 CAAGTGAGAGAGTAGGAGGAGGG - Intronic
947868291 2:233416955-233416977 CAATGCACACCGTAGCAGGAAGG - Intronic
1168743088 20:211628-211650 CAATGGAAACAATTGTGGGAGGG - Intergenic
1170948919 20:20916630-20916652 GAAAGGAAAAAGGAGGAGGATGG + Intergenic
1171782246 20:29430053-29430075 CCATGGAAACAGTAGAACGGTGG + Intergenic
1172205560 20:33160611-33160633 CAATGGAAAAGGTGGGGGGAGGG - Intergenic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1175120943 20:56715851-56715873 GAATGGAAGCAGTAGAAGGAAGG + Intergenic
1175243904 20:57569792-57569814 CAATGGTAACAGTAGCAGCTGGG + Intergenic
1176674043 21:9760580-9760602 ACATGGAGAAAGTAGGAGGAAGG - Intergenic
1179255813 21:39714326-39714348 CAAGGGAAACAGTAGATGCAAGG - Intergenic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180883867 22:19225781-19225803 CACGGGAAAAAGTAGGAGCAAGG + Intronic
1181373039 22:22432800-22432822 AAATGGAAAAAGTAGGATGATGG - Intergenic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181820889 22:25474788-25474810 TTATGGAGACAGTAGAAGGATGG + Intergenic
1181907342 22:26209822-26209844 AAAGGAAAAAAGTAGGAGGAAGG + Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
1184689798 22:46112352-46112374 CACTGGAGACCCTAGGAGGAGGG - Intronic
1185180351 22:49356690-49356712 GCATGGAAACAGGAGGAAGATGG - Intergenic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
950475070 3:13209909-13209931 CAATGGGAAAGGTTGGAGGATGG - Intergenic
951252238 3:20407416-20407438 AAATGGAAAAATGAGGAGGAAGG - Intergenic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
952747814 3:36798131-36798153 CAATGGGAACACTTGGAGGAAGG - Intergenic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
955647760 3:61158611-61158633 CAATGGAAAAGGTAAAAGGAGGG - Intronic
956037943 3:65116224-65116246 CAATAGAAACATTTTGAGGAAGG - Intergenic
956617783 3:71190175-71190197 CTATGGAGGCAGTAGGAAGATGG - Intronic
956856376 3:73279035-73279057 CAAAGGAAACAGGATGAGAATGG - Intergenic
958077599 3:88702944-88702966 GAAAGGAAAAAGTAGGAAGAAGG - Intergenic
958130589 3:89416062-89416084 TTATGAAAACAGTAGAAGGAGGG + Intronic
958815197 3:98906363-98906385 TACTGGAAACCTTAGGAGGATGG + Intergenic
958921507 3:100111195-100111217 CAATGGAGGCAGAAAGAGGATGG + Intronic
959592177 3:108092435-108092457 CAATGGAAAGTCTTGGAGGAGGG - Intergenic
961905334 3:130257085-130257107 AACTGGAAAAAGTAGGGGGAAGG - Intergenic
963392718 3:144688492-144688514 CAATGGAAAGGGTAAGACGATGG + Intergenic
964192429 3:154018786-154018808 CCATGAAAACAGTTGGAAGAGGG + Intergenic
965069472 3:163899950-163899972 CAACTGCAAGAGTAGGAGGATGG + Intergenic
965988391 3:174785170-174785192 AGAGGGAAACAGTAGAAGGAGGG - Intronic
966252782 3:177885455-177885477 CAGTGGATACATTAGGAGGTAGG - Intergenic
966464124 3:180210878-180210900 TAATGGAGATAGTAGGATGATGG + Intergenic
968257306 3:197287622-197287644 AAAAGGAAAAAGGAGGAGGAAGG + Intronic
968358259 3:198124813-198124835 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
970397887 4:15689269-15689291 CTATGGAAAGAGTAGTAAGAAGG + Exonic
970709591 4:18846317-18846339 CAAGGGTAAGAGTAGGAAGATGG + Intergenic
971145406 4:23970756-23970778 CAATGGAAACAATACCAGGTCGG + Intergenic
971498053 4:27288857-27288879 CCATGGAAACGGAAGCAGGAGGG - Intergenic
971613651 4:28759298-28759320 CAATGGAATCAGTAGCAAAAAGG - Intergenic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
973369092 4:49231014-49231036 GCGTGGAAACAGTAGGAGGTGGG - Intergenic
973391950 4:49564402-49564424 GCGTGGAAACAGTAGGAGGTGGG + Intergenic
973759281 4:54101607-54101629 CAATGGCAAGAGGATGAGGACGG + Exonic
973926167 4:55740078-55740100 CTTTGGATATAGTAGGAGGAGGG + Intergenic
974057188 4:56996002-56996024 CAAGGGCAATAGTAGGAGGCAGG + Intronic
975165018 4:71168635-71168657 TCATGGAAATAGTAGAAGGATGG - Intergenic
977599713 4:98923150-98923172 CCATAGAAACAGTAGGAAAATGG - Intronic
977658024 4:99546109-99546131 CAATGGAAACAGTAGGGAATTGG - Intergenic
978262029 4:106771478-106771500 CAATGGAGATAGTAGAACGATGG + Intergenic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
980048894 4:128019085-128019107 CAATGGAAACACTACTAGGTAGG - Intronic
980737801 4:136913615-136913637 CAATAGAAACTATAGGAAGAAGG + Intergenic
981811794 4:148783859-148783881 CAATGGTAATATTAGGAGAAGGG - Intergenic
981818617 4:148860437-148860459 AAATGGAAACACCAGGAGAAGGG + Intergenic
982064861 4:151645208-151645230 CCATGGAGACAGTAGGAGGAGGG + Intronic
982317736 4:154048309-154048331 CAAAGGATACAGGAGGAGGGTGG + Intergenic
982471884 4:155802357-155802379 CATTGGCAACAGACGGAGGAAGG - Exonic
983135247 4:164070896-164070918 TCATGCAAACAGTAGGAGAAGGG - Intronic
983519990 4:168698163-168698185 AAATCGAAACAGTAGAAGGATGG + Intronic
983658713 4:170110101-170110123 AATAGGAAAGAGTAGGAGGAAGG + Intergenic
985448298 4:190040580-190040602 CCATGGAAACAGTAGAACGCTGG + Intergenic
985726251 5:1517282-1517304 CCCTGGAAACAGGAAGAGGAAGG + Intronic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
989712690 5:44419267-44419289 CCATGGAAACAATAGTAGAATGG - Intergenic
990218350 5:53559765-53559787 AAATAGGAACAATAGGAGGATGG - Intergenic
991592615 5:68269390-68269412 AAATGTAAACTGTTGGAGGATGG + Intronic
992037558 5:72795445-72795467 CAATGGAATCTGAAGGAGAAGGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995293891 5:110494994-110495016 CTATGAAAGCAGTAGGAGAATGG + Intronic
995333401 5:110971280-110971302 TAATGAAAACAGTAGGTAGAGGG + Intergenic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
996944587 5:129051138-129051160 CCATGGAAATTGTAGGAGAAAGG + Intergenic
998797779 5:145837223-145837245 TAATGGAAAATGTAGCAGGAAGG + Intergenic
999426751 5:151494196-151494218 CAATGGGCAAAGTATGAGGAAGG - Intergenic
999511531 5:152257501-152257523 CAATAGAGTCATTAGGAGGAAGG - Intergenic
999995452 5:157088064-157088086 AAATGGAAACATTAGGTGGAAGG - Intronic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000631848 5:163599675-163599697 CAATGGAAAGAGATGGAGTATGG + Intergenic
1001415017 5:171539610-171539632 CAAAGCAGACAGTAGAAGGAAGG - Intergenic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1002120418 5:176999580-176999602 TAATGGAGATAGTAGAAGGATGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1004392896 6:15224121-15224143 CAATGGAGAAAGTGAGAGGAAGG - Intergenic
1005831257 6:29672861-29672883 CAATGGAAGCAGTAGTTGGGCGG + Exonic
1007244392 6:40450016-40450038 AAATGGATACAGTAGGCAGAAGG + Intronic
1008748080 6:54697710-54697732 CAATGAAAACAGAATGATGAGGG + Intergenic
1010230910 6:73534370-73534392 CAATGGAAAGTGGAAGAGGAAGG - Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1011140523 6:84150493-84150515 CCATGGAAACAGTGTGAGTAGGG + Intronic
1011290836 6:85775501-85775523 CAATGGAAACAAAAAGAGGCAGG - Intergenic
1011447742 6:87460626-87460648 CAGTGGAAAGAGTGGGAGGGGGG + Intronic
1013533376 6:111040726-111040748 AAATGAAAAAAGAAGGAGGAAGG + Intergenic
1013817218 6:114112856-114112878 CAATAGAAACATTAGGAAAATGG - Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017186450 6:151605617-151605639 CAATGGAAAAAGTAAGATCAAGG - Intronic
1017493303 6:154962846-154962868 CAATGGCCACAGTGGGAGGCGGG - Intronic
1017594929 6:156017998-156018020 CAATGGAAACAGTGAGCAGAGGG + Intergenic
1017910696 6:158790281-158790303 AAATGGAAATAGTATGAGGATGG + Intronic
1019075422 6:169383399-169383421 GAATGGAAACACTAGCATGAAGG - Intergenic
1021192465 7:17637420-17637442 CCATGAGAACAGCAGGAGGATGG + Intergenic
1021859130 7:24888577-24888599 CCATGAAAACCCTAGGAGGAGGG - Intronic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1022458262 7:30578641-30578663 CAATAGATTCAGTAGGAGAAGGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024808293 7:53175837-53175859 CAAAGGAAACAATAGGCAGAGGG + Intergenic
1026979161 7:74516581-74516603 CAAAGGCTACAGTAGGAGAAGGG - Intronic
1027608466 7:80329427-80329449 CAATGGAACCTGTTGTAGGAGGG + Intergenic
1028189700 7:87831705-87831727 CAATGGAAACTTTGGGAGAAGGG + Exonic
1028326741 7:89536774-89536796 CAAAGGAAAAAGTAGAAGAAAGG + Intergenic
1028650168 7:93142161-93142183 CAATGGAAAGTGCTGGAGGAAGG - Intronic
1029193964 7:98791412-98791434 CAATGGAATCAGCTGTAGGAAGG - Intergenic
1029933475 7:104398278-104398300 CCATGTCAAAAGTAGGAGGAAGG + Intronic
1031329290 7:120443997-120444019 CTAAGGAAACAGCAGGAGCAAGG - Intronic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1033870469 7:145748826-145748848 TAATTGAAAAAGTAAGAGGAAGG + Intergenic
1034080034 7:148268199-148268221 CAATGAAAACAGTAAGATGGTGG + Intronic
1034224241 7:149470541-149470563 CAATGGAAAGAGTTGGAGGGAGG + Intergenic
1035263302 7:157675081-157675103 CAAAAGAAACAGTAGGCGGTGGG - Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1037168478 8:15860154-15860176 AAATGGTAACAGTAAGGGGACGG + Intergenic
1038391222 8:27203223-27203245 CAATGGAAAAAGTAGGTAAATGG + Intergenic
1038941442 8:32310110-32310132 GAATGGAAAGAATAGGAGGAGGG + Intronic
1039965296 8:42279705-42279727 CAATGGAAAAAGCATGAGGTTGG - Intronic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1040813859 8:51485610-51485632 CAGAGGAAACATTAGGAGAAAGG - Intronic
1042038862 8:64570529-64570551 CAATGGAATTTGGAGGAGGAGGG + Intergenic
1042166374 8:65949922-65949944 GAATGCAAACAGTTGAAGGAAGG + Intergenic
1043018880 8:74975708-74975730 CACTGGATCCAGTAGGAGCATGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1044265778 8:90179559-90179581 CAATGGATACAGTAGGAAAATGG - Intergenic
1045388507 8:101692779-101692801 CAATAGAGACGGTAGGAGGCGGG - Exonic
1045600428 8:103708651-103708673 CAATGGAAACAGTGAAAGGGAGG - Intronic
1045937439 8:107697196-107697218 TCATGGAAACAGGAGGAGGTTGG - Intergenic
1046050436 8:109015196-109015218 CAAAAGAAACAGTAAGAGCATGG + Intergenic
1046542096 8:115598789-115598811 CAATGGAAACTGGAGGAAGGAGG - Intronic
1046611386 8:116429461-116429483 CCATGGCCACAGCAGGAGGAAGG + Intergenic
1046767476 8:118085254-118085276 CCATGGGAACAATGGGAGGAAGG + Intronic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1048083495 8:131153626-131153648 TAATGGAACCAGTAAGAGGAAGG - Intergenic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050167775 9:2784020-2784042 CAATGGAAACTGTAGGTAAATGG + Intronic
1051462732 9:17340917-17340939 CAATTAAAACAGTGGGAAGAAGG + Exonic
1051680051 9:19597939-19597961 CTATGTAAACAGCAGGAGGCAGG + Intronic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1055786012 9:79869583-79869605 GAATGGAGTCAGTAGGAGGGAGG + Intergenic
1056121735 9:83495049-83495071 AATTGGAAACAGTAGGAGAATGG - Intronic
1056300447 9:85234752-85234774 CCATTGGAACAGTAGGAGGTTGG - Intergenic
1057093942 9:92287434-92287456 CAATTGAAAAAGTAGTATGATGG - Intronic
1057841896 9:98492925-98492947 CAAAGGGTACAGTAGGAGAAGGG - Intronic
1058241849 9:102572362-102572384 TCATGGACACAGTAGAAGGATGG - Intergenic
1058444008 9:105037947-105037969 AAATTGGACCAGTAGGAGGAAGG - Intergenic
1058596410 9:106620719-106620741 CAATGGAAAGACAAGAAGGAGGG + Intergenic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1062456180 9:136640280-136640302 CAATGGGAAAAGCAGGAGAACGG - Intergenic
1062742131 9:138181346-138181368 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
1185666237 X:1767507-1767529 CCATGGAAAGAGTTGGAGCAGGG - Intergenic
1185719647 X:2371621-2371643 CTATGGTAACGGGAGGAGGAAGG - Intronic
1185966470 X:4610683-4610705 GAAAGGAAAAAGAAGGAGGAAGG + Intergenic
1187948118 X:24446240-24446262 CAATGGAAACAGAGGTTGGAGGG + Intergenic
1188316442 X:28679828-28679850 CAATGAAAACAGTATGGCGATGG - Intronic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1189906416 X:45764836-45764858 AAATGAAAACAGTAGGAAGTAGG + Intergenic
1190051332 X:47151726-47151748 CAGTTGAGACAGTAGGAAGAAGG + Intronic
1192131474 X:68555602-68555624 AAAAGTAAACAGTAGCAGGAGGG - Intergenic
1192604896 X:72506371-72506393 GAATGGAAGCAGTATGAGGGAGG - Intronic
1192780058 X:74284809-74284831 TACTGGAAATAGTAGGGGGAAGG - Intergenic
1194470990 X:94296814-94296836 CAATGGAAAGGGTGGGAGGGGGG - Intergenic
1195069655 X:101266930-101266952 CAAGGGAAAAAGTAGGACTAAGG - Intergenic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196528473 X:116755115-116755137 CAAAGTAAAGAGTATGAGGAAGG + Intergenic
1196569512 X:117249065-117249087 CAAGGGAAATAGGAGGTGGAGGG - Intergenic
1197191974 X:123657278-123657300 TAATGGAAATAGCAGAAGGAAGG + Intronic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1197862035 X:130981097-130981119 TCATGGAAAGAGTAGAAGGATGG + Intergenic
1199162941 X:144635649-144635671 CAATGAAAACAGTAGGGGATAGG - Intergenic
1199277775 X:145966071-145966093 CAATGAAAACAGTAGTAAAAGGG + Intergenic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic
1200766817 Y:7087255-7087277 CAAATGAAGCACTAGGAGGATGG - Exonic
1202371177 Y:24197080-24197102 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202376150 Y:24239389-24239411 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202494630 Y:25430729-25430751 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1202499607 Y:25473037-25473059 CAATGGAAAGAGCAGGAGAAGGG + Intergenic