ID: 1119019302

View in Genome Browser
Species Human (GRCh38)
Location 14:71093720-71093742
Sequence TCAGAGGTGGAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1576
Summary {0: 1, 1: 10, 2: 64, 3: 280, 4: 1221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119019302 Original CRISPR TCAGAGGTGGAGGAGGTGGA AGG (reversed) Intronic
900096337 1:941600-941622 TCAGAGCTGGAGGCGGAGGGGGG + Intronic
900100512 1:960276-960298 CCGGAGGAGGAGGAGGAGGAGGG + Intergenic
900379400 1:2376409-2376431 CCAGAGGCCGAGCAGGTGGAAGG - Intronic
900711813 1:4119255-4119277 TTAGAGGTGGTGGTGGTGGGGGG + Intergenic
900768343 1:4520453-4520475 TCATATATGGTGGAGGTGGAGGG - Intergenic
900771786 1:4550935-4550957 TGAGAGGCTGAGGAGATGGAGGG + Intergenic
900972820 1:6000887-6000909 TCAGAGCGGGAGGAGGTGTATGG + Intronic
900990399 1:6095904-6095926 GCAGAGGTGGGGGATGTGGTAGG - Intronic
901409493 1:9072236-9072258 TCAAAGATGGAGGAGGGGGATGG + Intronic
901411647 1:9088348-9088370 TAATAGGTGGAGAAGGAGGAGGG - Intronic
901630762 1:10647089-10647111 TCTGGGGAGGAGGAGGGGGAGGG + Intronic
901938492 1:12644446-12644468 AGTGAGGTGGAGGAGGCGGAGGG + Intergenic
902093550 1:13923725-13923747 GAAGAAGTGGTGGAGGTGGAAGG + Intergenic
902150299 1:14437628-14437650 TGAGAGGTGGAGGCAGGGGAAGG - Intergenic
902558396 1:17260640-17260662 ACAGAGGTGGGGGTGATGGAGGG - Intronic
902568226 1:17329622-17329644 TCAGGGGTGGCAGAGGAGGAAGG + Intronic
902614909 1:17618489-17618511 ACAGAGGAGGAGGAGGAGGAGGG - Intronic
902735847 1:18400180-18400202 GCGGAGGTGGAGGAGAGGGAGGG + Intergenic
902798690 1:18816002-18816024 TCAGAGGAGGAGCAGGGCGAAGG - Intergenic
903011717 1:20335831-20335853 GAATAAGTGGAGGAGGTGGAAGG + Intronic
903237834 1:21961876-21961898 TGAGAGGTGAGGGAGGTGGCAGG + Intergenic
903334187 1:22614017-22614039 TGTGAGGGGGAGGAGGAGGAGGG + Intergenic
903431926 1:23310838-23310860 TAAGAGGAAGAGGAGGAGGAAGG - Exonic
903438874 1:23372144-23372166 TTGGAGGTGGAGAAGGTGGGAGG + Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904058222 1:27686207-27686229 ACAGAGGAGGAAGAGGGGGAGGG + Intergenic
904890140 1:33773631-33773653 TGAGAGATGGACGAGGAGGAGGG + Intronic
905280001 1:36842987-36843009 TGGCAGGTGGAGGGGGTGGATGG - Intronic
905353058 1:37360693-37360715 CCAGGTGTGGAGGAGGAGGAGGG - Intergenic
905354602 1:37372640-37372662 GCAAAAGGGGAGGAGGTGGAGGG - Intergenic
905407706 1:37746949-37746971 CAAGAGCTAGAGGAGGTGGATGG + Intronic
905423267 1:37862926-37862948 TCAGAGGTGGCTGAGGTTGGGGG + Intronic
905470529 1:38188297-38188319 TGGGAGGAGGAGGAGGGGGAGGG + Intergenic
905566260 1:38967511-38967533 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
905631408 1:39521156-39521178 ACAGATTTGGAGGAGGTGGGAGG - Intronic
905666346 1:39765015-39765037 ACAGATTTGGAGGAGGTGGGAGG + Intronic
905892478 1:41526046-41526068 ACAGAGGGGCAGGAGGTGGCTGG + Intronic
906000381 1:42419608-42419630 TCAGAAGGGGAGGAGGCGGAGGG - Exonic
906018886 1:42609114-42609136 GAAGAGGTGGAGAAGGTGGAAGG - Intronic
906165717 1:43684634-43684656 TGATAGGTGGAGTAGGAGGAGGG + Intronic
906198534 1:43945001-43945023 TCACTGGTGGAGGTGGTGGTGGG - Intergenic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
906672724 1:47668461-47668483 TGAGAGAAGGAGGAGGTGGAGGG + Intergenic
907474784 1:54698497-54698519 GCAGAGCTGGAGGAGGGGGCAGG - Intronic
907531145 1:55098737-55098759 TCAGAAGAGGAAGAGGAGGAGGG + Intronic
907550170 1:55298477-55298499 TCAGAGGATGAGGCGGGGGATGG + Intergenic
908284145 1:62575284-62575306 GCAGAGGCAGAAGAGGTGGAAGG - Intronic
908409399 1:63847531-63847553 TCTGAGGCAGAGGACGTGGATGG + Intronic
908997733 1:70177831-70177853 TCAGAGATGGCAGAGGTGGAAGG - Intronic
909205594 1:72753075-72753097 GAAGAGGAGGAGGAAGTGGAGGG - Intergenic
909979815 1:82085363-82085385 GAAGAGGTGGAGAAGGTGGAGGG + Intergenic
910173550 1:84403577-84403599 GGAGAGGTGGGGAAGGTGGAAGG + Intronic
910218233 1:84863854-84863876 TGAGAGGTGGAGGAGAAGGTGGG - Intronic
911080372 1:93923203-93923225 TCAGAGGTGGAGGCCGTAAAGGG + Intergenic
911204123 1:95075489-95075511 TCAAAGCTGGTGGAGGTGGGAGG + Intergenic
911452474 1:98081281-98081303 GAAAAGGTGGAGAAGGTGGAAGG + Intergenic
911724873 1:101232736-101232758 TAAAAGATGGAGGTGGTGGATGG + Intergenic
911729322 1:101276554-101276576 GAGAAGGTGGAGGAGGTGGAAGG - Intergenic
911781522 1:101885518-101885540 GAAGAGGTGAAGGAGATGGAAGG - Intronic
911991270 1:104699679-104699701 CAAAAGGTGGAGGAGGTGGAAGG - Intergenic
912326581 1:108769248-108769270 GCAGAGGTGGAGGAAGCGGAGGG + Intronic
912326590 1:108769296-108769318 GCAGAGGCAGAGGAGGTGGCAGG + Intronic
912416183 1:109509585-109509607 TCAGCGGTCGAGGCGGTGGCAGG - Exonic
912533101 1:110340353-110340375 GCAATGGTGGCGGAGGTGGAGGG - Exonic
912551819 1:110489824-110489846 TCGGGGGTGGAGGAGGAAGAAGG - Intergenic
912664727 1:111568758-111568780 GAAGAGATGGAGGAAGTGGAAGG - Intronic
912841603 1:113043993-113044015 GCTGAGGTGGAGTAGGGGGAGGG + Intergenic
912865546 1:113252932-113252954 TGAGAGGTAGAGGAGGGTGAGGG + Intergenic
912904754 1:113692525-113692547 TCAGGGGTGGCACAGGTGGAAGG - Intergenic
913296369 1:117324644-117324666 TTAGGGGTGGCAGAGGTGGAAGG - Intergenic
913593083 1:120348240-120348262 TGAGAGGTTGAGGATGTGGTGGG - Intergenic
913647232 1:120869938-120869960 GCAGAGGTGGAAGAGGGTGAAGG - Intergenic
914079410 1:144392924-144392946 GCAGAGGTGGAAGAGGGTGAAGG + Intergenic
914094177 1:144530746-144530768 TGAGAGGTTGAGGATGTGGTGGG + Intergenic
914099769 1:144573578-144573600 GCAGAGGTGGAAGAGGGTGAAGG - Intergenic
914174309 1:145261470-145261492 GCAGAGGTGGAAGAGGGTGAAGG + Intergenic
914299220 1:146364103-146364125 GCAGAGGTGGAAGAGGGTGAAGG + Intergenic
914304352 1:146403142-146403164 TGAGAGGTTGAGGATGTGGTGGG - Intergenic
914515336 1:148369530-148369552 TGAGAGGTTGAGGATGTGGTGGG + Intergenic
914528976 1:148502654-148502676 GCAGAGGTGGAAGAGGGTGAAGG + Intergenic
914597705 1:149169668-149169690 TGAGAGGTTGAGGATGTGGTGGG + Intergenic
914637415 1:149564454-149564476 GCAGAGGTGGAAGAGGGTGAAGG - Intergenic
914686121 1:149981104-149981126 GAAGAGGAGGAGGAGGGGGAGGG + Intronic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915271344 1:154755925-154755947 GAAGAGGTGGAGGATGGGGAGGG + Intronic
915271395 1:154756173-154756195 GAAGAGGTGGAGGATGGGGAGGG + Intronic
915313323 1:155015357-155015379 TATGAGGAGGAGGAGGTGGCGGG + Exonic
915632952 1:157166164-157166186 ACAGAGGTAGAGGATGAGGATGG - Intergenic
915917269 1:159948080-159948102 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
915973291 1:160368560-160368582 ACAGAGGTGGAGGAAGAGGCTGG + Intronic
916307953 1:163360790-163360812 GCAGAGGCAGAAGAGGTGGATGG + Intergenic
916739814 1:167638142-167638164 TCAGAGATGGAGGTCGTGGTGGG - Intronic
917127096 1:171696652-171696674 ACAGTGGTTGAGGAGGAGGAAGG + Intergenic
917456154 1:175187738-175187760 TCAGAGGTGGTGTAGGGGCAGGG - Intronic
917513931 1:175691317-175691339 TAAGAGGAGGAGGAAGAGGAAGG + Intronic
917524216 1:175773035-175773057 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
917733526 1:177899759-177899781 TCAGAGATGGAGGAGGAAGAGGG + Intergenic
919041038 1:192388525-192388547 AGAGGTGTGGAGGAGGTGGATGG + Intergenic
919811032 1:201408965-201408987 TAACAAGTGGAGGAGGAGGAGGG - Exonic
919876742 1:201874867-201874889 GAAGAGGAGGAGGAGGAGGATGG + Exonic
920041741 1:203102384-203102406 GCACATGTGGAGGAGGGGGAAGG - Intronic
920052074 1:203170398-203170420 TCAGAGATGGTGCAGGTGGTTGG + Exonic
920227096 1:204446896-204446918 ACAGAACTGGAGGAGCTGGAGGG - Intronic
920256602 1:204659443-204659465 TCAGAGGAGGAGGAGGGAGAGGG + Intronic
920312388 1:205056385-205056407 TCAGAGGCGGAGGCGGCGGGCGG - Intronic
920764514 1:208819082-208819104 TCAGACGTGAAGTAGGTTGAAGG + Intergenic
920865459 1:209748430-209748452 TGAGAGGTGGACCGGGTGGAAGG - Intergenic
921080382 1:211734336-211734358 GAAGAGGTGGAGGTGTTGGAAGG + Intergenic
921300782 1:213749650-213749672 TGGGAGGTGGGGGAGGTGGGAGG - Intergenic
921896307 1:220405165-220405187 TTGGTGGTGGTGGAGGTGGAGGG - Intergenic
922209880 1:223478921-223478943 TGAGAGGGTGAGGAGGTGGGGGG + Intergenic
922209896 1:223478969-223478991 TGAGAGGGTGAGGAGGTGGGGGG + Intergenic
922209932 1:223479063-223479085 TGAGAGGGTGAGGAGGTGGGGGG + Intergenic
922432566 1:225570455-225570477 GGAGAGGAGAAGGAGGTGGAAGG - Intronic
922520091 1:226242736-226242758 GAAGAGGTAGAGGAGATGGAAGG - Intronic
922563643 1:226587138-226587160 TCAGAGGTCTAGGAGGGGGCAGG + Intronic
922854666 1:228764317-228764339 GAAGAGGTGATGGAGGTGGAAGG + Intergenic
922905069 1:229168103-229168125 AAAGAAGTGGAGGAGGTGGAAGG + Intergenic
922928871 1:229373412-229373434 GCAGAGCGGGAGGAAGTGGATGG - Intergenic
923053485 1:230405294-230405316 TCAGGGGTGGCAGAGGAGGAAGG - Intronic
923161273 1:231316918-231316940 GCAGAGGTGGAAGAGATGGAGGG - Intergenic
923237847 1:232051653-232051675 ACAGAGGAGGAGGAGGTAGGAGG + Intergenic
923290760 1:232543403-232543425 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
923330403 1:232918480-232918502 GAAGAGGTGAAGCAGGTGGAAGG + Intergenic
923355151 1:233147518-233147540 GAAAAGGTGGAGGAAGTGGAAGG + Intronic
923378444 1:233390353-233390375 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
923786286 1:237071866-237071888 TCAGAGGGGGATGAGGCGGCGGG + Intronic
923920670 1:238561080-238561102 GAAGAAGTGGAGGAGGAGGAGGG - Intergenic
924481160 1:244435577-244435599 ACAGAGGTGGAGGAGGATGAAGG - Intronic
924736112 1:246757721-246757743 TAAGAGGTGTTGGAGGTAGACGG + Intronic
924768606 1:247057838-247057860 ACAATAGTGGAGGAGGTGGAGGG + Intronic
924840008 1:247698695-247698717 CCACAGGTGGAGGAGGTTAAGGG + Intergenic
1063051648 10:2455875-2455897 GCAGAGGTGGAAGAGGTAGAGGG + Intergenic
1063113635 10:3057568-3057590 GCAGAGGAGGAGGATGTGGAAGG + Intergenic
1063172891 10:3525705-3525727 TCAGAAGTGGGGAAGGTGGCTGG + Intergenic
1063173370 10:3529757-3529779 TCAGAGGAAGAGGAGGAGGGAGG - Intergenic
1063343111 10:5286934-5286956 GAAGAGGTGAAGGAGGGGGAAGG - Intergenic
1063488200 10:6439522-6439544 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
1063525555 10:6781354-6781376 TCAGATGTGCAGGAGGTGTTAGG - Intergenic
1063688832 10:8264148-8264170 CCTGAGGTCGAGGAGATGGAAGG + Intergenic
1064002297 10:11673741-11673763 TAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1064496121 10:15912100-15912122 ACAAAGGAGGAGGAGGAGGAAGG + Intergenic
1064589090 10:16869809-16869831 TCATGGGAGCAGGAGGTGGAGGG + Exonic
1064811799 10:19208315-19208337 ACAGAGGTGGAGGAAGTGGTGGG + Intronic
1064963760 10:20994865-20994887 GCTGAGGAGGAGGAGGTAGAGGG + Intronic
1065023013 10:21516570-21516592 TCAGAGGAAGAGGAGGAGGAGGG - Exonic
1065134337 10:22653325-22653347 AAAGAGGTGGAGGAGAAGGAAGG - Intronic
1065480724 10:26191374-26191396 GAATAGATGGAGGAGGTGGAGGG - Intronic
1065519584 10:26558666-26558688 ACAGAGGAGGCTGAGGTGGAAGG + Intronic
1065624235 10:27614402-27614424 TCGGGGGTGAAGGAGGAGGAAGG - Intergenic
1065653263 10:27916528-27916550 TCAGGGGTGGCAGAGATGGAAGG - Intronic
1065793026 10:29279023-29279045 GCAGAGGTGGAGGAGGTAGAAGG - Intergenic
1065972808 10:30818538-30818560 CCAGAGGTGGCGGGGGAGGAGGG + Intergenic
1066129750 10:32381354-32381376 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
1066268961 10:33803367-33803389 CTAGAGATGGAGGAGATGGAAGG + Intergenic
1066453041 10:35548728-35548750 AAAGAGGTGGAGAAGGTGGAAGG + Intronic
1066658169 10:37713477-37713499 CCACAGGTGGATGAGGAGGAAGG + Intergenic
1066668655 10:37813435-37813457 GCAGAAGTGGAGGAGATGGAAGG - Intronic
1066703802 10:38156814-38156836 TCAGAGGGTGAGGAGGAGGTCGG + Intergenic
1067031661 10:42882192-42882214 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1067090824 10:43265135-43265157 GCAGGGGAGGAGGAGGAGGAGGG - Intronic
1067555550 10:47267399-47267421 TCAGAGAGGGAGGAAGTGGCTGG + Intergenic
1067825331 10:49568029-49568051 GAAGAGGTGGAGGAGGTAGAAGG + Intergenic
1068190171 10:53641527-53641549 GAAGAGGTGAAAGAGGTGGAAGG + Intergenic
1068292843 10:55027417-55027439 TCAGAGGTGAATGAGGGGGTGGG + Intronic
1068522052 10:58087655-58087677 GCAGAGATGGAGGATGTGGAAGG - Intergenic
1068744403 10:60513932-60513954 GCTGAGGTGGAGGAAGGGGAAGG - Intronic
1068824553 10:61420355-61420377 GAAGAGGTGGAGGAGGTGAAAGG + Intronic
1068882878 10:62068468-62068490 TCTGAGGAGGAGGAGGTGGCTGG - Intronic
1069074469 10:64023910-64023932 GCAGAGGTGGTGGAGGTGGAAGG + Intergenic
1069094526 10:64242588-64242610 TAAGAGGTGGAAGAGGAGGCAGG - Intergenic
1069143632 10:64861117-64861139 TCAGAGGTGAAGGAGAAGCAAGG + Intergenic
1069191005 10:65489627-65489649 TCAGAAGTGGGGGAGGTGGGAGG + Intergenic
1069357787 10:67607521-67607543 GAAGAGATGGAGGAGGTGGAAGG + Intronic
1069441101 10:68428799-68428821 TCAGAGGTTAAGGAGGGGTAAGG + Intronic
1069452218 10:68527013-68527035 GCAGAGGCTGGGGAGGTGGAAGG - Intronic
1069612112 10:69780961-69780983 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1069613718 10:69792728-69792750 TCAGAGGTGGAGCAGGAGTAGGG - Intergenic
1069681551 10:70289053-70289075 GCAGTGGAGGAGGAGGTGGAGGG + Intergenic
1069705490 10:70456709-70456731 GCAGAGGTGGGGGAGCAGGAGGG + Intergenic
1069733272 10:70633330-70633352 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1070764257 10:79047484-79047506 GGAGAGGTGGAGGAGCTGCAGGG - Intergenic
1071347920 10:84710972-84710994 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1071531399 10:86392457-86392479 CTAGAGGTGGGGTAGGTGGAGGG + Intergenic
1071548285 10:86545309-86545331 TCTGTGGTGGAGGGGGTGGTGGG + Intergenic
1071571153 10:86698088-86698110 CCAGAGGTTAAGGAGGTGGGTGG - Intronic
1071816585 10:89238560-89238582 GAAGAGGGGGAGGAAGTGGAAGG - Intronic
1072001103 10:91196592-91196614 TCAGAGGTGGGGGATGGGGTGGG - Intronic
1072423603 10:95310475-95310497 ACAGAGGAGGAAGAGGGGGATGG + Intergenic
1072685395 10:97533586-97533608 TCAGACTTGGTGGAGGTGGGGGG - Intronic
1072741343 10:97911806-97911828 TAAGAGATGGAGGAGAGGGAGGG - Intronic
1072828511 10:98633008-98633030 GAAGAGGTGGGGGAGGTAGAAGG - Intronic
1073048135 10:100652017-100652039 GCAGAGGTGGTGGAGGTGGCGGG - Intergenic
1073323133 10:102627769-102627791 TCAGAGCTGGAGGAGCTGGCAGG + Intronic
1073336829 10:102715703-102715725 TGAGAGGTGGAAGGGGAGGAAGG + Intronic
1073597725 10:104817413-104817435 GAAGAGGAGGAGGAGGGGGAAGG - Intronic
1073597804 10:104817635-104817657 GGAGAGAAGGAGGAGGTGGAGGG - Intronic
1073723937 10:106208197-106208219 CCAGAGGTTGGGGAGGTGGATGG - Intergenic
1073870349 10:107855942-107855964 TCAGAGGTGGGGGAGCAAGAAGG + Intergenic
1074002895 10:109390144-109390166 TCAGAAGTCCAGGAGCTGGAAGG - Intergenic
1074301121 10:112234215-112234237 GCAGATGTGGGGGAGGAGGAGGG - Intergenic
1074369285 10:112886624-112886646 GCAGAGGAGGAGGAGGAGGAGGG - Intergenic
1074452033 10:113567290-113567312 GCACAGGTGGTGGTGGTGGAGGG + Intronic
1074768213 10:116716141-116716163 TCAGAGGAGGTGGGGGTGGGGGG + Intronic
1075083267 10:119397704-119397726 CAAGAGGTGCAGGAGGTTGAGGG - Intronic
1075118850 10:119649882-119649904 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1075300699 10:121321307-121321329 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
1075666067 10:124231803-124231825 TCAGAGCTGGAGGAGCAGAAAGG - Intergenic
1075685761 10:124364239-124364261 TGAGAGGTGGAGTGGGTGTATGG - Intergenic
1076035688 10:127196724-127196746 GAAGAGGAGGAGGAGGTGGAAGG + Intronic
1076068092 10:127464700-127464722 TCATAGGAGCAGGAGGAGGATGG + Intergenic
1076205681 10:128599554-128599576 GCTGAGGTGGAGGCGGTGGTGGG - Intergenic
1076287382 10:129313400-129313422 GAAGAGGTGGAGGACGTGGATGG + Intergenic
1076440193 10:130476324-130476346 TCAATGGTGGAGGAAGTGGTGGG - Intergenic
1077165874 11:1138047-1138069 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
1077287255 11:1773089-1773111 GCACAGGTGGGGGAGGGGGAGGG + Intergenic
1077287281 11:1773151-1773173 GCACAGGTGGGGGAGGGGGAGGG + Intergenic
1077571191 11:3339708-3339730 ACGGAGGTGGAGGGGGTGGCTGG + Intronic
1077677636 11:4210673-4210695 TTGGTGGTGGTGGAGGTGGAGGG + Intergenic
1077998904 11:7477024-7477046 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1078048506 11:7940474-7940496 TTAAAGGTAGAGGAGGTGAAGGG - Intergenic
1078063313 11:8061953-8061975 ACAGAGGAGGAGGAGCAGGAAGG - Intronic
1078145730 11:8720833-8720855 TCAGAGTTGGAGGAGACGGTAGG + Intronic
1078157283 11:8809849-8809871 TAAGAGGTGGAGGAGGGGGCTGG - Intronic
1078333805 11:10448165-10448187 TGAGAGGTGGAGGGGGTGAGGGG - Intronic
1078334918 11:10455734-10455756 TCAGAGGAGGAGGGGATGGAGGG + Intronic
1078373558 11:10773251-10773273 AAAGAGGTGGTGGTGGTGGACGG + Exonic
1078390563 11:10932149-10932171 GGAGAGGAGGAGGAGGTGGTGGG + Intergenic
1078645112 11:13134976-13134998 CCAGAGGAGGAGGAGGAAGAGGG + Intergenic
1078660659 11:13282895-13282917 TCAGGGACGGAGCAGGTGGAGGG + Intronic
1078836130 11:15031814-15031836 GAAGAGGTGGAGTAGGTGGAAGG - Intronic
1079492611 11:21006208-21006230 TTAGAGGTGGAGGCTTTGGAAGG + Intronic
1079687776 11:23382642-23382664 TCAGGGGTGGGGGAAGGGGAGGG + Intergenic
1079727365 11:23892311-23892333 TGAAAGGTGAAGGAGGTTGAAGG + Intergenic
1080232393 11:30032560-30032582 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1080517179 11:33035281-33035303 ACAGAGGTGGAGGAGGTGGAAGG - Intergenic
1080802012 11:35618336-35618358 GCGGAGGCGGAGGAGGGGGAGGG + Intergenic
1081262075 11:40972899-40972921 TCAGTGTTGGAGGAGGTGCCTGG + Intronic
1081279716 11:41193976-41193998 GAAGAGATGGAGGAGATGGAAGG - Intronic
1081305747 11:41509865-41509887 TAAGAGGAGAAGGAGGAGGAAGG + Intergenic
1081499639 11:43653543-43653565 TGTGAGGTGGGGGAGGGGGAAGG - Intronic
1081515397 11:43823918-43823940 CCAGAAGTGGAAGAGGCGGAAGG + Intronic
1081516304 11:43833753-43833775 TCAGAGGTGGAAGCAGTGGAAGG - Intronic
1081831798 11:46121139-46121161 GGAGAGGAGGAGGAGGAGGAGGG - Intronic
1081874066 11:46396987-46397009 TCAGAGTTGGAGGTGGTGTCTGG + Exonic
1082018984 11:47515257-47515279 ACAGAAGTGAGGGAGGTGGAGGG + Intronic
1082771564 11:57211567-57211589 GAAGAGGTGGAGGAGATGGAAGG - Intergenic
1083010653 11:59395213-59395235 GAAGAGGTGGAGGAAATGGAGGG - Intergenic
1083162691 11:60865035-60865057 GCAGAGCTGGAGGAGGAGGGAGG - Intergenic
1083430244 11:62610690-62610712 ACTGAGATGGAGGAGGTCGAGGG + Intronic
1083587757 11:63872851-63872873 GGAGAGGAGGAGGAGGAGGAAGG - Intronic
1083732857 11:64662303-64662325 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1083822180 11:65179063-65179085 TCAGAGGGGTAGGAGAGGGATGG - Intronic
1083953736 11:65971173-65971195 TCAGAAGCTGAGGAGGGGGATGG + Intronic
1084255641 11:67940599-67940621 TGAGTGGTTGAGGGGGTGGAGGG + Intergenic
1084309117 11:68305949-68305971 TCTGAGGTGGAGGTGTTGGCAGG + Intergenic
1084433553 11:69124642-69124664 TCAGAGGAGGAGGGGTAGGAAGG + Intergenic
1084569502 11:69950910-69950932 TTGGAGGTGGAGGAGGAGTAGGG + Intergenic
1084578449 11:70006444-70006466 GCAGAGGTAGGGGAGGTGGGTGG - Intergenic
1084623824 11:70292955-70292977 TCAAAGGTGGAGTAGGTGCAAGG - Intronic
1084907445 11:72358851-72358873 GCAGAGGTGGAGGAGGGGTGGGG - Intronic
1085184244 11:74561977-74561999 TCAGTTGTTGATGAGGTGGATGG + Intronic
1085496810 11:76978000-76978022 CCAGAGGGGGCGGAGGTGGCAGG - Intronic
1085508248 11:77072239-77072261 CAAGAGATGGAGGAGGTGGAAGG - Intronic
1085871887 11:80359822-80359844 TAGGAGGTGGAGGAGGTGGAAGG + Intergenic
1086078891 11:82882178-82882200 GAAGAAGTGGAGGAGGTGAAAGG + Intronic
1086952606 11:92906290-92906312 AAAGAAGTAGAGGAGGTGGAAGG + Intergenic
1087039487 11:93784676-93784698 TCCGAGGAGGAGGAGGCGGCGGG + Exonic
1087139410 11:94750665-94750687 TCAGGGCTTGAGGAGGAGGATGG - Intronic
1087974877 11:104532257-104532279 TAATAGGTGGAGGTGGTAGAAGG - Intergenic
1087987243 11:104697959-104697981 TGAGAGGTTGAGGAGTTGGTGGG - Intergenic
1088900446 11:114112403-114112425 TGAGAGATGGAGAAGGTAGAGGG + Intronic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089064890 11:115655282-115655304 TCAGAGGTGGTGGAGGAGTGAGG + Intergenic
1089194585 11:116686821-116686843 TGAGAGGTTGTGGGGGTGGAAGG + Intergenic
1089317321 11:117600861-117600883 CCAGAGCTGGAGGAGAAGGAGGG + Intronic
1089547005 11:119235604-119235626 GAATAGGTGGAGGGGGTGGAAGG + Intronic
1089615643 11:119693236-119693258 TCACAGGTGGAGGAGCTGAGGGG - Intronic
1089706771 11:120283735-120283757 ACACAGGTGGAGGTAGTGGAGGG - Intronic
1089747798 11:120629159-120629181 GGAGAGGTGGGGAAGGTGGAGGG + Intronic
1089858441 11:121567663-121567685 TCAGAGGGGGAGTGGGTGTAAGG - Intronic
1090086982 11:123658878-123658900 TCAGAGATTGAGGAAGAGGATGG + Intergenic
1090168731 11:124579429-124579451 GAAGAGGTGGAGGAGGGGGAAGG + Intergenic
1090407824 11:126487954-126487976 TCACAGAAGGCGGAGGTGGAGGG + Intronic
1090418995 11:126561158-126561180 GCAGAGGTGAAGGAGAGGGAGGG - Intronic
1090518447 11:127453010-127453032 TCAGGGGAGGAAGAGGTAGAAGG + Intergenic
1090620185 11:128553695-128553717 GCTGAGGAGGAGGAGGAGGAGGG - Intronic
1090765366 11:129871647-129871669 TCAGAGGTGGAGGGAGTAGTGGG - Intronic
1090899613 11:131016627-131016649 GAAGAGGTGGAAGAGGTAGAAGG + Intergenic
1091268532 11:134289375-134289397 GAAGAGGTGGAGGAGGTGGCAGG + Intronic
1091603184 12:1930082-1930104 GAGGAGGTGGAGGAGGAGGAAGG + Intergenic
1091636276 12:2199296-2199318 TCAGGGGTGGCAGAGATGGAAGG - Intronic
1091640679 12:2234820-2234842 CAAGAGGTGGAGGAGAGGGAGGG + Intronic
1092216628 12:6688534-6688556 TTAGAGATGGAGGAGGAGGAGGG + Intronic
1092385620 12:8033637-8033659 TCAAGGTTGGAGGAGGGGGAGGG - Exonic
1092425876 12:8375333-8375355 TGAGTGGTTGAGGGGGTGGAGGG + Intergenic
1092512078 12:9167538-9167560 GCAGGGGTGGAGGTGGGGGAGGG - Intronic
1093492710 12:19723775-19723797 TCACAGGTGGAGAAGTAGGAAGG + Intergenic
1093504326 12:19847509-19847531 TCAGAAGTGGGGGAGGTGGCGGG - Intergenic
1093601403 12:21028866-21028888 GTAGAGGTGGAGGCAGTGGATGG - Intronic
1093613187 12:21188207-21188229 GAAGAGGTGGAGGAGGTAGAGGG - Intronic
1093647928 12:21610239-21610261 TCTGAGGAAGAGGAGGTGCAGGG + Intergenic
1093770456 12:23011519-23011541 TGAGAGGAGGAGGAGTTGAAGGG - Intergenic
1094084389 12:26573774-26573796 GCAGAGTTGGAGGAGATGGAGGG + Intronic
1094122468 12:26988831-26988853 TCAGGGGTGGCAGAGGTGGAAGG - Intronic
1094151659 12:27291317-27291339 TCAGAGGAGGAAGAGCTGTAAGG - Intronic
1094167815 12:27460630-27460652 GAAGAGGTGGAGGACGTGGAAGG + Intergenic
1094272597 12:28633526-28633548 GAAGAGATGGAGGAGGTAGAAGG + Intergenic
1094528650 12:31251071-31251093 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1095195930 12:39317501-39317523 GCAGGGGTGGAGAAGTTGGAGGG - Intronic
1095669734 12:44844518-44844540 TCAAAGGTGGGGGATGGGGAAGG + Intronic
1095716975 12:45356717-45356739 AAAGAGGTGGAGGAAGTGGAAGG + Intronic
1095937085 12:47696551-47696573 GAAGAGGTGGAAAAGGTGGAAGG - Intronic
1095991516 12:48037666-48037688 TGGGAGGTGGAGGAGAGGGAGGG + Intergenic
1096065315 12:48735024-48735046 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1096078635 12:48819503-48819525 GCAGAGATGGAGGGGGTGGAAGG - Intronic
1096255347 12:50058779-50058801 GCCGAGGAGGAGGAGGTGGGTGG + Exonic
1096492280 12:52019328-52019350 GCAGAGGGGGTGGGGGTGGATGG + Intergenic
1096496628 12:52042721-52042743 TGAGAGGTGGAGGACGGGAATGG + Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096539357 12:52296330-52296352 GCAGAGGAGGAGGAGGTGGATGG + Intronic
1096693611 12:53335543-53335565 TGTGAGTTGGAGGAGGTGGGTGG + Intronic
1096721476 12:53526259-53526281 GAAGAGGTGGAGAAGTTGGAAGG - Intronic
1096836110 12:54352337-54352359 ATAAAGGTGGAGGAGGGGGAGGG - Intergenic
1097137938 12:56875083-56875105 CCAGAGGTTGAGGGGGTGGGGGG - Intergenic
1097258094 12:57695904-57695926 TAAGAGGAGGAGGAGGAGGAGGG - Intronic
1097260396 12:57716528-57716550 TCAGAGGAGCAGGATGGGGATGG + Intronic
1097452943 12:59757674-59757696 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
1097730918 12:63127106-63127128 GAAGGGGTGGAGGAGGTGAAAGG - Intergenic
1097891439 12:64781085-64781107 ACAGAGGAGGAGGAGGCGGCGGG + Intergenic
1098075993 12:66732148-66732170 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
1098111509 12:67126819-67126841 TCAGTGGTGGAAGAGCTGGAAGG - Intergenic
1098128038 12:67320482-67320504 TCAGATGTGGTGGAAGTGGGAGG + Intergenic
1098214932 12:68205631-68205653 AAAGAGGTGGAGGAAGTGGAAGG + Intronic
1098509360 12:71293275-71293297 TCAGAAGAGGAGAAGGTGGGAGG + Intronic
1098542384 12:71671089-71671111 GCAAAGGTGAAAGAGGTGGAAGG + Intronic
1098815336 12:75153929-75153951 GAAAAGGTGGAGGAGGTGGAAGG + Intronic
1098986063 12:77013673-77013695 GAAGAAGTGGAGAAGGTGGAAGG - Intergenic
1099147353 12:79063559-79063581 ACATAAGTGGAGGAGGGGGAAGG + Intronic
1099211809 12:79800264-79800286 TCAGAGGTGGTGGAGGTGGAAGG - Intronic
1099227418 12:79986430-79986452 TGAGAAGGGGAAGAGGTGGATGG - Intergenic
1099279629 12:80627391-80627413 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1100081774 12:90861270-90861292 TCAGGGGTGGAGTTGGGGGAAGG - Intergenic
1100571706 12:95849053-95849075 TGAGGGGTGAAGGAGGTGGGGGG + Intergenic
1101018433 12:100526826-100526848 TCAAAGGTGTTGGAGGTGAAGGG - Intronic
1101193770 12:102361759-102361781 GAAGAGGAGGAGGAGGAGGACGG + Intergenic
1101293171 12:103392923-103392945 TCAGTGGTGGAGGTGGTGGCAGG + Intronic
1102311958 12:111852296-111852318 GCAGAGGTAGAAGAGGTGAAGGG - Intronic
1102432265 12:112892820-112892842 TCAGAGGCAGTGGAGGTGGGGGG - Intronic
1102534887 12:113574189-113574211 TCAGAGGGGCAGGAGGGGGTCGG + Intergenic
1103507417 12:121451114-121451136 GAAGAGATGGAGGAGGTAGAAGG - Intronic
1103576796 12:121883446-121883468 GTAGAGGTGGAGGAGATGGGTGG + Intergenic
1103610396 12:122120705-122120727 GAAGAGGGGGTGGAGGTGGAAGG - Intronic
1103821333 12:123701233-123701255 CCGGAGGTGGAGGAGTTGGGAGG + Intronic
1104164444 12:126214449-126214471 TCTGATGAGGAGGAGGTGAAAGG - Intergenic
1104390987 12:128390471-128390493 TTAGAGGTGGAGGAGGGAGGTGG - Intronic
1104402275 12:128485867-128485889 TTAGAGGAGGAGGAGGAAGAAGG - Intronic
1104451414 12:128871704-128871726 TCAGAGGAGGAGGAAGTAGGGGG - Intronic
1104788233 12:131465305-131465327 TGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1104901684 12:132192784-132192806 TTAGAGGAGGAGGAGGAGGGAGG - Intergenic
1105486252 13:20835787-20835809 ACAGAAGTGGAGGAGGTGAAGGG - Intronic
1105503866 13:20993501-20993523 GCAGAGGAGCACGAGGTGGAAGG + Intronic
1105592260 13:21803596-21803618 TCAGAAGTGGGGAGGGTGGAAGG - Intergenic
1105592976 13:21811541-21811563 TCAGGGCAGGAGGAGGAGGAGGG + Intergenic
1105775918 13:23659964-23659986 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
1106220009 13:27738629-27738651 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1106288439 13:28338472-28338494 TCTGAGCTGGAGGAACTGGAAGG + Intronic
1106763979 13:32895412-32895434 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1106810614 13:33355230-33355252 TCAGATGTGTAGGTGGTGGGTGG - Intergenic
1106924618 13:34600883-34600905 TCAGTGGTGGTGCAGCTGGAGGG + Intergenic
1107015522 13:35705548-35705570 GGAGAGGTGGAGTAGGTGGAAGG + Intergenic
1107053883 13:36082145-36082167 GAAGAGGTGGAGGAGGTGAAAGG - Intronic
1107058555 13:36131443-36131465 GCGGAGGAGGAGGAGGAGGAGGG - Intergenic
1107135934 13:36944127-36944149 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1107437346 13:40391735-40391757 TCTGAGGTGGAGAAAGTAGAGGG - Intergenic
1107462151 13:40614665-40614687 TCAGAGGCCGAGGGGTTGGAAGG - Intronic
1107497874 13:40946599-40946621 GAAGAGATGGAGGAAGTGGAAGG - Intronic
1108038359 13:46315877-46315899 TCAGAGTTGGATCAGGTGGCAGG - Intergenic
1108253993 13:48593400-48593422 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1108467377 13:50730195-50730217 GCAGAGCTGGAAGAGGTGGAAGG + Intronic
1108560108 13:51634856-51634878 TCAGAGTTGGAGTAGAGGGAAGG + Intronic
1108716101 13:53079328-53079350 CCAGAGGTGGAGGAAGAAGATGG - Intergenic
1108781129 13:53835525-53835547 GCAGAGGTGGAGGAGGTGGAAGG - Intergenic
1108908707 13:55514583-55514605 GAAGAGGTGGAAGAGGTGGAAGG + Intergenic
1109608410 13:64730518-64730540 GAAGAGGTGGAGGAGTTGAAAGG - Intergenic
1109862780 13:68222658-68222680 TGAGAGATGGAGGTGGTAGAAGG - Intergenic
1110227119 13:73131399-73131421 TCAGAAGTGGAGGCTGTGGTGGG - Intergenic
1110268739 13:73569277-73569299 GAAGAGGTGGAGGAGGTGAAAGG + Intergenic
1110611356 13:77491584-77491606 GCAGATGTGGAGAAGGTGGAGGG + Intergenic
1110867342 13:80409988-80410010 TAGGAGGTGGAAGAAGTGGAGGG - Intergenic
1110935265 13:81279709-81279731 GCAGAGGTGAAAGAGGTGGAAGG - Intergenic
1111043395 13:82782076-82782098 GAAAAGGTGGAGGATGTGGAAGG + Intergenic
1111230805 13:85341558-85341580 GGAGGGGTGGAGGAGGGGGAGGG + Intergenic
1111495569 13:89044743-89044765 GAAGAAGTGGAGGAGGTGGAAGG + Intergenic
1111743022 13:92228140-92228162 TAAGAGATGGAGAAGATGGAAGG + Intronic
1111897856 13:94163330-94163352 TCAAGGGAGGTGGAGGTGGAAGG - Intronic
1111929340 13:94497739-94497761 GCAGAGGTGGAAGAGGTAGAGGG + Intergenic
1112067322 13:95807328-95807350 GAAGAGGTGGAGGAGGTAGAAGG + Intronic
1112102880 13:96209641-96209663 TGAGAGGTGGGGCAGGTGGCAGG - Intronic
1112160441 13:96861373-96861395 GAAGAGGTAGAGGAGGTGGAAGG - Intergenic
1112389536 13:98970398-98970420 TCAGAGATGGGGGATCTGGAGGG + Intronic
1112463705 13:99624955-99624977 TCTGAGGTGAAGGTGGGGGAAGG - Intronic
1112513030 13:100026847-100026869 GAAGACGTGGAGGAGTTGGAAGG - Intergenic
1112542269 13:100326615-100326637 GGAGAGGTGGAGGAGGTGGAAGG - Intronic
1112672191 13:101653177-101653199 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1112839121 13:103553677-103553699 GAAGAGATGGAGGAGGTAGAAGG - Intergenic
1112855022 13:103757892-103757914 CCAGAGGTGGAGGAGGAGGCAGG - Intergenic
1112855243 13:103760557-103760579 TCAGTGTTGGAGGAGGGGCATGG + Intergenic
1113088404 13:106592180-106592202 AAAGAGGTGGAGGAGGTAGAAGG - Intergenic
1113177331 13:107579815-107579837 TAAAAGGTGGGGGAGGGGGAAGG - Intronic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114417302 14:22553467-22553489 TCAGAGGTGCAGGGAGTGGGAGG - Intergenic
1114551521 14:23535180-23535202 TCAGAGGTGGAGGAGGCAGCAGG + Exonic
1115014559 14:28594229-28594251 TCAGAGCAAGAGGAAGTGGAGGG + Intergenic
1115253475 14:31373786-31373808 GAAGAGGTGGAGCAGGTGGAAGG - Intronic
1116129736 14:40839687-40839709 GCAGAAGTGGAGGAGTTGGAAGG - Intergenic
1116520124 14:45836196-45836218 GAAGATGTGGAGGAGGTGGAAGG + Intergenic
1116665124 14:47764850-47764872 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1117246280 14:53889752-53889774 TGGGAGGTAGAGGAAGTGGAAGG + Intergenic
1117263520 14:54061713-54061735 GAAGAGGTAGAGGAGGTGAAAGG - Intergenic
1117272922 14:54163435-54163457 TCAGAGGTGTGGGAGGTCTAAGG - Intergenic
1117623492 14:57611730-57611752 GAAGAGGTGAAGGAGGTGGAAGG + Intronic
1117639623 14:57784789-57784811 TCATGGGTGGCAGAGGTGGAAGG - Intronic
1117951660 14:61089331-61089353 CCACAGGAGGAGGAGGAGGAGGG - Intergenic
1118171814 14:63395816-63395838 GGAGAGGAGGAGGAGGGGGAGGG + Intronic
1118285977 14:64473259-64473281 TTTGAGGTGGAGGAGGTGGCAGG - Exonic
1118347108 14:64948400-64948422 GCAGAGCTGGAGGAGGAGGAGGG - Exonic
1118735517 14:68698378-68698400 TCAGAGGTGGAGTTGGGGGAGGG + Intronic
1118758545 14:68863468-68863490 GCAGAGGTGCAGAAGATGGAAGG + Intergenic
1118759786 14:68873220-68873242 CCAGTGATGGAGGAGGTGGGTGG + Intergenic
1118773734 14:68960175-68960197 GAAGAGGTGGAGGAGGAGGAAGG + Intronic
1118832246 14:69445238-69445260 GAAGAGGTGAAGGAGGTGGAAGG - Intronic
1118970239 14:70630370-70630392 GAAGTGGTGGAGGAGATGGAAGG - Intergenic
1119019302 14:71093720-71093742 TCAGAGGTGGAGGAGGTGGAAGG - Intronic
1119055710 14:71417643-71417665 GCAGAGGTGGAGGAGGAGGAAGG + Intronic
1119071738 14:71592627-71592649 TCAGGTGGGGAGGGGGTGGAGGG + Intronic
1119092392 14:71796792-71796814 GAAGAGGTGGAGGAGGTAGATGG - Intergenic
1119173230 14:72550313-72550335 TAAGAGGTGGGGGAGAGGGAAGG + Intronic
1119205134 14:72788415-72788437 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1119460613 14:74799305-74799327 CCAAAGGTGGAAGAGGTGGGAGG - Exonic
1119623020 14:76147149-76147171 GCAGCAGTGGAGGAGGGGGAAGG - Intergenic
1119679910 14:76584600-76584622 GCAGAGGGGGAAGAGGTGGAGGG + Intergenic
1119680803 14:76591033-76591055 TCAGAGGCAGAGGAGGGGGTTGG + Intergenic
1119709215 14:76809277-76809299 CTGGAGGTGGAGGGGGTGGAGGG - Exonic
1119712370 14:76831399-76831421 TGAAACCTGGAGGAGGTGGAGGG + Intronic
1119733316 14:76964917-76964939 TCAGTGGTGGTGGTGGCGGAGGG + Intergenic
1119936079 14:78593686-78593708 CCAGAGGTCGAGGAGGGGGTGGG + Intronic
1119961395 14:78860848-78860870 GAAGATATGGAGGAGGTGGAAGG + Intronic
1120064089 14:80019430-80019452 GCAGAGGTGGAGGAGAAGGCAGG + Intergenic
1120265736 14:82248517-82248539 TCAGTGTTGGAGGAGGGGCATGG + Intergenic
1120527590 14:85595090-85595112 GCAGAGGTGGAAGAGATGAAGGG + Intronic
1121085860 14:91145626-91145648 TGTGAGGAGGAGGAGGGGGATGG - Intronic
1121303451 14:92890089-92890111 CCAGAGCTGGAGGCAGTGGAGGG - Intergenic
1121692721 14:95889462-95889484 GCGGAGGAGGAGGAGGGGGAGGG - Intergenic
1121836772 14:97099233-97099255 TCAGAGTTGGAGCAGGTGGATGG + Intergenic
1121914473 14:97824093-97824115 GAAGCGGTGCAGGAGGTGGAAGG + Intergenic
1122053320 14:99074920-99074942 TCAGAGGTGAGGGAGGTAAAGGG - Intergenic
1122082438 14:99274772-99274794 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1122123140 14:99565260-99565282 GCAGGGGTGGTGGAGGAGGAGGG - Intronic
1122160751 14:99782154-99782176 AGAGAGGTGGTGGGGGTGGAGGG - Intronic
1122249683 14:100429197-100429219 TCAGAGTTCTAGAAGGTGGATGG - Intronic
1122292379 14:100686793-100686815 GCAGAGGGGGCTGAGGTGGAGGG - Intergenic
1122470666 14:101964008-101964030 TCAGAGGGGGAGGAGATGAGGGG - Intergenic
1122877742 14:104676706-104676728 TCAGAGGTGGGTGTTGTGGAGGG + Intergenic
1123468253 15:20531601-20531623 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1123649863 15:22469463-22469485 GCACAGGTGAAGGATGTGGAGGG - Intergenic
1123728570 15:23126811-23126833 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1123740264 15:23278282-23278304 GCACAGGTGAAGGATGTGGAGGG - Intergenic
1123746734 15:23324276-23324298 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1123953477 15:25308937-25308959 AAAGAGGTGGAGGTGGAGGAAGG - Intergenic
1124007454 15:25806158-25806180 AGAGAGGTGGAGGAGGTGGAAGG - Intronic
1124104566 15:26725348-26725370 TCTGAGGAGGGGAAGGTGGAGGG - Intronic
1124279001 15:28347592-28347614 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1124391841 15:29266295-29266317 TCACAGGGGGTGAAGGTGGAGGG + Intronic
1124465111 15:29931249-29931271 GCAGAGGAGGAGGAAGAGGAGGG + Intronic
1124654742 15:31499126-31499148 ACAGAGGAGGAGGAAGTGGGTGG + Intronic
1124816787 15:33001709-33001731 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1124913615 15:33947084-33947106 TAACTGGTGGAAGAGGTGGAGGG + Intronic
1125050553 15:35293751-35293773 ACAGAGGTGGTGGATGTGAAAGG + Intronic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1125638939 15:41213596-41213618 GCTGAGTGGGAGGAGGTGGAGGG - Intronic
1125978889 15:43981478-43981500 GAAGAGGTAGAGGAGGTGGAAGG + Intronic
1125979112 15:43983778-43983800 CCAGAGGTGGAGACGGTGGATGG - Intronic
1126103652 15:45134423-45134445 TGAGAGGTGGAGGAGGCAGTGGG + Intronic
1126292680 15:47099711-47099733 TCAGAGGGGGCTGAGGTGGCAGG + Intergenic
1126415231 15:48411244-48411266 TCAGAGTTGTAAGAGCTGGAAGG + Exonic
1127097719 15:55529672-55529694 TCAGCGGGGGTGGAGGGGGAGGG - Intergenic
1127165658 15:56243398-56243420 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1127830639 15:62747987-62748009 GCAGAGGTGGAAGAGGTGGAAGG + Intronic
1127973107 15:63977628-63977650 TCAGGGGTGGCAGTGGTGGAAGG + Intronic
1128154600 15:65384792-65384814 CCAAAGGTTGAGTAGGTGGAGGG - Intronic
1128173297 15:65531200-65531222 CCGGAGGTGGGGGAGGGGGAGGG + Intronic
1128560218 15:68660004-68660026 GAAGTGGTGGTGGAGGTGGAAGG + Intronic
1128635850 15:69301968-69301990 TCAGGGGTGGTGGGGGTGGTAGG + Intronic
1128740032 15:70077539-70077561 CCAAGGGTGGAGGGGGTGGAGGG - Intronic
1129328274 15:74813299-74813321 TCAGAGGTAGAGGAAGGGCAGGG - Intronic
1129609103 15:77038825-77038847 CCCCAGGTGGAGGAGCTGGAGGG + Intergenic
1129674245 15:77623685-77623707 TCTGAGGAGGAGGAGGGGAAAGG - Intronic
1130009204 15:80135051-80135073 GCAGAGGTGGAGAAGGTAAAAGG - Intronic
1130065376 15:80598659-80598681 TCAGGGCTGGCAGAGGTGGATGG - Intergenic
1130293837 15:82628694-82628716 TCAGGGGTGGCAAAGGTGGAAGG - Intronic
1130349710 15:83080241-83080263 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1130551998 15:84895197-84895219 CCAGGGCTGGAGGAGGAGGAAGG + Intronic
1130682059 15:86005619-86005641 CCAGGGGAGGAGGAGGAGGAGGG + Intergenic
1131077838 15:89507231-89507253 AAAGATGTGGGGGAGGTGGAAGG - Intergenic
1131135525 15:89931952-89931974 GCAAAGGTGGAAGAGGTGGAAGG + Intergenic
1131149164 15:90036235-90036257 ACAGAGGCGGAGGGGGTGGGGGG - Intronic
1131379728 15:91953886-91953908 TCTGAGGTGGAGGATGGGAATGG + Intronic
1132020731 15:98359733-98359755 GAAGAGGTGGAAGAGTTGGAAGG + Intergenic
1132583168 16:694492-694514 TCCGAGGCGGAGGAGGAGGGAGG - Intronic
1132845685 16:1999879-1999901 ACACAGGAGGAGGAGGAGGACGG - Exonic
1132929138 16:2449788-2449810 CCAGGGGTGGAGGGGATGGAGGG - Intronic
1132930954 16:2459088-2459110 TCAGCGGTGGGGGAGGGTGACGG - Intergenic
1133032330 16:3017417-3017439 TCAGTGTTGGAGGTCGTGGAGGG + Intronic
1133460724 16:5984122-5984144 GGAGAGGAGGAGGAGGGGGAGGG - Intergenic
1133863267 16:9616879-9616901 GCAGATTTGGAGGAGGTGGGAGG + Intergenic
1133978901 16:10619290-10619312 TCTGGGCTGGAGGAGGTGGGTGG - Intergenic
1134024044 16:10941444-10941466 TTAGACCTGGAGGAGGTGAACGG + Intronic
1134653118 16:15926436-15926458 TGCGGGGTGGAGGTGGTGGAGGG - Intergenic
1134692062 16:16197600-16197622 GAAGAGGAGGAGGAGGGGGAAGG + Intronic
1134862237 16:17570677-17570699 GAAGAGGTGGAGGAGATGGAAGG - Intergenic
1135114519 16:19713563-19713585 ATGGAGGTGGAGGAGGAGGATGG + Intronic
1135120630 16:19763387-19763409 TCAGAGGTGGCAGAGGTGGAAGG + Intronic
1135162403 16:20108912-20108934 GCAGGGGTCGGGGAGGTGGATGG - Intergenic
1135834336 16:25811220-25811242 GAAGAGGTGGAGCAGATGGAAGG - Intronic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136028397 16:27484977-27484999 CCAGAGCTGGAGCAGATGGAGGG + Intronic
1136147817 16:28325992-28326014 TGGGAGGTGGAGGAGGTTGGAGG - Intergenic
1136280679 16:29208645-29208667 TCAGGGCTGGAAGAGGTGGGAGG - Intergenic
1137257532 16:46789465-46789487 GAAGAGGAGGAGGAGGGGGAGGG - Intronic
1137708372 16:50549882-50549904 TCAAAGGTGGAGGTGGAGTAGGG + Intronic
1138070636 16:53989777-53989799 GCAGAGGCAGAAGAGGTGGAAGG - Intronic
1138096323 16:54214804-54214826 TCAGAGGTTAGGGAGGAGGAAGG - Intergenic
1138178855 16:54929277-54929299 TCATAGGTGAAGGAGGTGTCAGG + Intergenic
1138277600 16:55747351-55747373 TTAGAGCGGGAGGAGGTGGGGGG - Intergenic
1138288912 16:55830908-55830930 CCAGAGGTGGGGGAAATGGAAGG + Intronic
1138323440 16:56139421-56139443 TCAGGGGTGGGGGAAGGGGAGGG - Intergenic
1138596704 16:58032990-58033012 TGAGTGCTGGAGGAGCTGGAAGG + Intronic
1138597606 16:58037372-58037394 GCAGCGGTGGTGGAGGTGGTGGG + Intronic
1138758082 16:59513050-59513072 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1138857288 16:60709699-60709721 GAAGAGGTGGAGGAAGTGGAAGG + Intergenic
1138894803 16:61190713-61190735 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1138944889 16:61837135-61837157 TAAGGGGAGGAGGAGGAGGAGGG - Intronic
1138955113 16:61962155-61962177 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1139010795 16:62631459-62631481 TGTGAGGTGGAGGAGGGGGAAGG - Intergenic
1139059006 16:63225441-63225463 ACATGGGTGGAGCAGGTGGAAGG + Intergenic
1139069468 16:63362611-63362633 TCAGAGGTGGGGTGGGTGGAGGG + Intergenic
1139118966 16:63992228-63992250 TGAAAGGAGGAGGTGGTGGAGGG - Intergenic
1139877375 16:70157061-70157083 TATTAGGAGGAGGAGGTGGAAGG - Exonic
1140655175 16:77132442-77132464 GGAGAGGGGGAGGAGGGGGAGGG - Intergenic
1140976381 16:80063631-80063653 TCAGAGTAGGAGGAGGAGAAGGG + Intergenic
1141001361 16:80311464-80311486 TTGGAGGTGGAGGAGGTGTTTGG + Intergenic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141173588 16:81705411-81705433 GCAGAGGTGGAGGAAAGGGATGG - Intronic
1141530509 16:84643395-84643417 TGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1141574025 16:84952721-84952743 TCAGAGGTTGAGCAAGGGGAGGG + Intergenic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141708020 16:85680002-85680024 GCAGACTTGTAGGAGGTGGACGG - Intronic
1142034926 16:87856841-87856863 GCAGTGGTGGGGGAGGCGGATGG + Intronic
1142085038 16:88174581-88174603 TCAGGGCTGGAAGAGGTGGGAGG - Intergenic
1142125886 16:88410087-88410109 TCAGATGTGGGGGTGGGGGAAGG + Intergenic
1142423419 16:89987411-89987433 GAGGAGGTGGAGGAGGTGGTGGG + Intergenic
1142494299 17:298200-298222 GCAGAGCTGGAGGACGTGGACGG - Intronic
1142696820 17:1638579-1638601 TCAGAGGTGATGGAGGTAGTTGG - Intronic
1143046601 17:4085785-4085807 TCAGTGGTGGACAAGGTGGATGG - Exonic
1143244131 17:5468713-5468735 GCAGAGGAGGAGGAGGAGGCCGG - Exonic
1144074235 17:11702527-11702549 TCAGAGCCAGAGGAGGAGGAAGG + Intronic
1144288469 17:13802711-13802733 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1144554190 17:16267347-16267369 GAAGAGGTGGAGGAAGTGGATGG + Intronic
1144554199 17:16267377-16267399 GAAGAGGTGGAGGAAGTGGATGG + Intronic
1144669968 17:17127287-17127309 TCAGTGGTGGTGGGGGTGGGAGG + Intronic
1144837814 17:18166411-18166433 TCAGAGATGGAGCAGGTGGACGG + Exonic
1144952564 17:19002118-19002140 TTAGAGGAAGAGGAGGAGGAGGG - Intronic
1145221642 17:21094265-21094287 GAAGTGGTGGAGGAGATGGAAGG + Intergenic
1145273826 17:21418488-21418510 TAAGGAGGGGAGGAGGTGGAGGG - Exonic
1145774265 17:27516518-27516540 TGAAAGGGGGAGGAGGAGGAGGG - Intronic
1145792992 17:27639343-27639365 TGGGGGGTGGGGGAGGTGGAGGG - Intronic
1145857616 17:28177163-28177185 AAAGTGGTGGAGGAGGTGGAAGG + Intronic
1145863609 17:28226840-28226862 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1145923895 17:28631737-28631759 ACAGAGATGGAGGAGGGGAATGG + Intronic
1146117213 17:30151628-30151650 GAAGAGGTGGAGGAGGTGAAAGG + Intronic
1146581303 17:34040430-34040452 ACAGTGGGGGAGGAGGGGGAGGG + Intronic
1146915607 17:36676444-36676466 GTAGAGGAGGAGGAGGAGGAGGG + Intergenic
1147042789 17:37731177-37731199 CCAGAGATGGAGGAGGTGGCCGG + Intronic
1147126739 17:38375279-38375301 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
1147178732 17:38672390-38672412 TGAGAGGGGGTGGAGGTGGAAGG - Exonic
1147413827 17:40273932-40273954 TCAGGGGCGGTGGAGGAGGAGGG - Exonic
1147424250 17:40338290-40338312 ACAGAGGAGGAGGAGGAAGAAGG - Intronic
1147424877 17:40341757-40341779 GCCGTGGTGGAGGAGGTGGTGGG - Intronic
1147519188 17:41152995-41153017 GCAGGGGTGTAGGAGGGGGAAGG - Intergenic
1147737780 17:42651773-42651795 TCTGAGTTGGAGGAGTTGCACGG - Intergenic
1147841009 17:43371356-43371378 TTACACGTGGAGGAGGTGGGTGG + Intergenic
1147927337 17:43953866-43953888 GCAGACGAGCAGGAGGTGGAAGG + Exonic
1148026820 17:44594381-44594403 TCAGAGGCAGATGAGGTGGTAGG - Intergenic
1148107626 17:45127839-45127861 TCATGGGTGGAGAGGGTGGAAGG + Intronic
1148123998 17:45227686-45227708 ACAGAGGCAGAAGAGGTGGAGGG - Intronic
1148189337 17:45667729-45667751 ACAGAGGTAGAGAAGGAGGATGG - Intergenic
1148337387 17:46851201-46851223 TCCGAGGTAGAGAAGGTGGAGGG - Intronic
1148402237 17:47375397-47375419 TGAGAGGCTGAGGAGGTGGGAGG - Intronic
1148448731 17:47759163-47759185 GAAGAGTTGGAGGAGGTGGAAGG + Intergenic
1148535665 17:48436674-48436696 TGAGAGTTGGAGGAGGTAGAGGG - Intergenic
1148539861 17:48471939-48471961 CCAGAGGTGGAGGAGGGGGCTGG - Intergenic
1148646407 17:49222116-49222138 CCAGGGGTGGAGGAGGAGGCAGG - Exonic
1148890111 17:50801065-50801087 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1149097979 17:52867957-52867979 CCAGAGGCTGGGGAGGTGGAGGG - Intronic
1149121777 17:53177048-53177070 GAAGAGGTGGAGGAAATGGAGGG - Intergenic
1149259128 17:54859812-54859834 GCAGAGGTGGAGGAGGTTAAAGG + Intergenic
1149304648 17:55335875-55335897 GCAGTGGTGGAGGAGGGGGTAGG + Intergenic
1149613696 17:57978360-57978382 GTAGAGGTGGAGGAGGAAGAAGG + Intronic
1149819866 17:59765750-59765772 AAGGAGGTGGAGGAGGTAGATGG + Intronic
1149866933 17:60156360-60156382 TCTGTGGAGGAGGAGGAGGAGGG + Intronic
1149926358 17:60705958-60705980 GAGGAGATGGAGGAGGTGGAAGG - Intronic
1150407572 17:64915990-64916012 TCAGAGGCTGAGGTGGTGGGAGG + Intronic
1150650245 17:67005428-67005450 TCAGAGGGGCAGAAGGTGGGTGG - Intronic
1150892381 17:69167929-69167951 AAAGAGGTGGAAGAGGTGGAAGG - Intronic
1151325399 17:73376867-73376889 TCTGGGGTGAAGGAGGAGGAAGG - Intronic
1151355771 17:73557636-73557658 AGAGAGGAGGAGGAGGAGGATGG - Intronic
1151784831 17:76270405-76270427 TGGGCGGTGGAGGTGGTGGAAGG - Exonic
1151829439 17:76540919-76540941 GCAGAGGAGGAGGAGGGGGAAGG - Intronic
1151991920 17:77580771-77580793 TCAGAGCAGGAGCAGGTGGCAGG - Intergenic
1151997307 17:77618208-77618230 TGGGAGGTGAAGGAGGTGGAGGG - Intergenic
1152043045 17:77917423-77917445 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152202328 17:78954393-78954415 TCAGAGGTGGAAAGGGTGGGCGG - Intergenic
1152540042 17:80970258-80970280 CCCAAGGTGGAGGAGGGGGAAGG - Intergenic
1152615513 17:81336123-81336145 ACAGGGGTGGAGGAGGGGGAGGG - Intergenic
1152678302 17:81652982-81653004 GCAGGGATGGAGGAGGGGGAAGG - Intronic
1152703067 17:81829041-81829063 CCTGAGGTGGTGGATGTGGAGGG + Intronic
1152774407 17:82191532-82191554 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
1153141522 18:1977914-1977936 GAAGAGGTGGAGGAGGAGGAAGG - Intergenic
1153335871 18:3924373-3924395 GCAGTGGGGGAGGAAGTGGAGGG - Intronic
1153514534 18:5891618-5891640 ACGGACGTGGAGGAGGAGGACGG + Exonic
1153781489 18:8498984-8499006 GAAGAGGTGGAGGAAGAGGAGGG + Intergenic
1153944833 18:10009409-10009431 TGAGAGGAGAAGGAGGTGGTAGG + Intergenic
1153951116 18:10058550-10058572 TCAGAGGTGGTGGCCCTGGAAGG + Intergenic
1154263787 18:12861763-12861785 ACAGAAGTGGAAGAAGTGGAGGG - Intronic
1154373158 18:13784762-13784784 GCTGAGGAGGAGGAAGTGGAGGG - Intergenic
1155076765 18:22364250-22364272 GAAGAGGAGGAGGAGGTGGAAGG - Intergenic
1155244502 18:23894449-23894471 TAAGGGTGGGAGGAGGTGGAAGG + Intronic
1155565546 18:27130000-27130022 GCAAAGGTGGAGGAGGGGAAGGG + Intronic
1155581025 18:27306386-27306408 TTAGAGGTGGATGAGGTGATAGG - Intergenic
1155759518 18:29548381-29548403 TCAGGGGCGGGGGTGGTGGAGGG + Intergenic
1155844316 18:30686402-30686424 GCAGAAGTGGAGGAGGTGGAAGG + Intergenic
1156048169 18:32900608-32900630 TCAGAGGTGGGCCAAGTGGATGG + Intergenic
1156211978 18:34954206-34954228 GCAGATGTGGATGAAGTGGATGG - Intergenic
1156407505 18:36796842-36796864 TTAGAAGTGGAGGAAGTGGAGGG + Intronic
1156681748 18:39598319-39598341 GAAGAGGTGAAGGAGGTGGCAGG - Intergenic
1156918165 18:42485959-42485981 GCAGTGGAGGAGGAGGAGGAAGG - Intergenic
1156957720 18:42988845-42988867 GCAGAGCTGCAAGAGGTGGATGG + Intronic
1157098278 18:44707099-44707121 TCAAAGGAGGAGGAGCTGGAAGG + Intronic
1157398782 18:47368277-47368299 GCAGAGATGGAGGAGGTAGAAGG + Intergenic
1157409865 18:47454580-47454602 TCAGGGGTGGTGGAGGTGGTGGG + Intergenic
1157445511 18:47743722-47743744 TCAGGGGTGGCAGAGGCGGAAGG - Intergenic
1157572879 18:48724550-48724572 TAAGGGGTGGAGGAGTAGGAAGG - Intronic
1157607177 18:48933241-48933263 CCATAGGTGGGGGAGGTGCAGGG - Intronic
1157656105 18:49390319-49390341 TCTGAGGAGGCTGAGGTGGAAGG + Intronic
1157723985 18:49948960-49948982 TCAGAGGTGGATGAGTTTGTTGG + Intronic
1157739650 18:50081132-50081154 GGAGAGGTGAAGGAGGAGGAAGG - Intronic
1157799544 18:50608199-50608221 TCAGGGGTGAAGGAGGAGCAGGG - Intronic
1158381730 18:56938052-56938074 ACTGAGGGGGAGGAAGTGGAGGG + Intronic
1158525490 18:58209315-58209337 GGAGAGGAGGAGGAGGGGGAGGG - Intronic
1158593636 18:58797926-58797948 TCAGAGGTGGTGGTGGTAGCAGG - Intergenic
1159079793 18:63724254-63724276 ACAGAGGAGGAGGAGGAGGAAGG - Intronic
1160082869 18:75746092-75746114 GAAGAGGTGGAGGTGGTGAAGGG - Intergenic
1160153460 18:76412892-76412914 TCAGAGGTGGGCGAGGTGGAGGG - Intronic
1160476235 18:79191118-79191140 TGAGGGGTGGAGGGTGTGGAAGG - Intronic
1161021049 19:2011717-2011739 TCCGGGGTGGCAGAGGTGGAAGG - Intronic
1161151661 19:2713269-2713291 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151673 19:2713313-2713335 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151707 19:2713445-2713467 TTAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151762 19:2713665-2713687 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151787 19:2713753-2713775 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151812 19:2713841-2713863 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151836 19:2713929-2713951 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151848 19:2713973-2713995 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151874 19:2714061-2714083 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151911 19:2714193-2714215 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151950 19:2714325-2714347 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161370514 19:3908577-3908599 GAAGAGGAGGAGGAGGAGGACGG - Intronic
1161484214 19:4525980-4526002 GCAGATGTGGAGGGGGTGGGTGG - Intronic
1161803560 19:6429568-6429590 ACAGAGGAGGAAGAGGTGAACGG + Intronic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1162043614 19:7984910-7984932 TCAGAAAAGGAGGAGGTGGGGGG + Intronic
1162153788 19:8663409-8663431 ACTGAGGTGGGGAAGGTGGAGGG + Intergenic
1162315909 19:9937705-9937727 GCAGAGGTGGAGGAGGGGGGCGG + Intergenic
1162339225 19:10081934-10081956 TCAGAGCTGGAGAAGCTGTAGGG - Intergenic
1162391938 19:10395220-10395242 CTAGAGGTGGAGGAGGTGAGTGG - Exonic
1162578477 19:11513307-11513329 TCAGAGATGGAGGGGGAGGAGGG + Intronic
1162722714 19:12672065-12672087 GCAGAGGAGGAGGAAGAGGAGGG + Intronic
1162771606 19:12952758-12952780 TCAGATGTGGAGGGGGAGGTGGG + Exonic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1163163902 19:15482278-15482300 GCAGAGGTGGAAGAGGAGGAAGG - Intronic
1163164014 19:15483042-15483064 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
1163286606 19:16352343-16352365 CCCGAGGAGGAGGAGGAGGAAGG - Intergenic
1163290814 19:16377917-16377939 TGTGGGGTGGAGGATGTGGATGG - Intronic
1163440977 19:17322435-17322457 GCAAAGGCGGAGAAGGTGGAAGG - Exonic
1163465949 19:17468829-17468851 GCAGAGGAGGGGGAGCTGGAAGG + Intronic
1163514489 19:17754869-17754891 TCAGAACTGGACTAGGTGGAGGG - Intronic
1163558895 19:18007696-18007718 GGAGAAGTGGAGGAGGTGGGTGG - Intronic
1163715600 19:18870482-18870504 GCAGAGTTGGAGGGGGTGGAGGG + Exonic
1164249610 19:23465629-23465651 TAGGAGGTGGAAGAGGAGGAGGG - Intergenic
1164249999 19:23467971-23467993 GGAGAAGTGGAGGAGGAGGATGG - Intergenic
1164551932 19:29219264-29219286 CCAGAGGTGGAGGTGGGAGAGGG - Intergenic
1164792378 19:30998360-30998382 TCTTAGGAGGATGAGGTGGAAGG + Intergenic
1165084458 19:33333954-33333976 ACAGAGGTGGGGTGGGTGGAGGG - Intergenic
1165367310 19:35376156-35376178 TCAGGGCCGGCGGAGGTGGAAGG + Intergenic
1165420652 19:35720577-35720599 GGAGGGGTGGAGGAGGTGAAGGG - Exonic
1165439254 19:35815092-35815114 TGGGAGGTGGAGGTGGTGGGTGG - Intergenic
1165611853 19:37161591-37161613 GAAGAGGAGGAGAAGGTGGAAGG - Intronic
1165712936 19:38025021-38025043 GCAGAGGTGGGGCAGGAGGAAGG - Intronic
1165819000 19:38662631-38662653 TCAGAGTGGGAAGAGGTGCATGG + Intronic
1165823678 19:38693377-38693399 TCAGAACTGAAGGGGGTGGAGGG - Intronic
1165824636 19:38698738-38698760 TGAGAGGTGGTGGTGGGGGATGG + Intronic
1165889285 19:39100892-39100914 TCAGGGGTGGAGGGGGAGGTGGG - Intronic
1166008634 19:39925157-39925179 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1166266825 19:41689617-41689639 GCAGAGGTAGAAGAGGTGGAGGG - Intronic
1166567932 19:43776447-43776469 TCAGATCAGGAGGAGGAGGAGGG + Intronic
1166672445 19:44719004-44719026 GAGGAGGTGGAGGAGGAGGAGGG + Intergenic
1166730705 19:45057579-45057601 TCAGATGTGGAGGAAGAGGGAGG + Intronic
1166960290 19:46492917-46492939 AAAGAGGAGGAGGAGGGGGAGGG - Exonic
1167130503 19:47582209-47582231 GCAGAGGAAGAGGAGGAGGAGGG - Intergenic
1167161898 19:47773345-47773367 TCAGAGGTGGGGCAGGTGCAGGG + Intergenic
1167191241 19:47991594-47991616 GAAGAGGGGGAGGAGGAGGAGGG - Intronic
1167253063 19:48411214-48411236 TCACAGGAGGCTGAGGTGGAAGG + Intronic
1167345680 19:48944349-48944371 GCAGGGGTTGAGGAGCTGGAGGG - Exonic
1167401050 19:49269696-49269718 TCTGAGGGAGAGGAGGAGGAAGG - Intergenic
1167428845 19:49443010-49443032 CCAGAGGCGGAGGCGGTGGGCGG - Intergenic
1167596442 19:50430803-50430825 TCCCAGGAGGAGGAGGAGGAAGG + Exonic
1167601097 19:50455349-50455371 CCAGAGGTGGACGGGGTTGATGG - Intronic
1167657547 19:50775352-50775374 TGAGAGGGCGAGGAGGTGGGAGG - Intergenic
1167687527 19:50965975-50965997 GCATAGTTGGAGGAGCTGGAGGG - Intronic
1167748740 19:51367708-51367730 TCAGAGCGGGAGGAGCAGGAAGG - Intronic
1167799227 19:51729574-51729596 TCAGAAGAGGAGGAGGAGAATGG + Intergenic
1168096320 19:54117220-54117242 TCAGAGGCAGAGGAAGTGGGGGG + Intronic
1168111935 19:54197539-54197561 CCAGAGGTGGAGGAGGTAAAAGG - Intergenic
1168162144 19:54517962-54517984 TCGGGGGTGGGGGAGGGGGAGGG + Intergenic
1168218155 19:54941560-54941582 TCTGAGGTGGAAGAGGCTGATGG - Exonic
1168266718 19:55227523-55227545 CCAGACGTAGAGGAGGTGGGCGG + Exonic
1168292273 19:55362473-55362495 GCAGAGGTGGACGAGGTCCAGGG + Exonic
1168451839 19:56472517-56472539 GAAGAGGTGGAGGAGCCGGAAGG - Intronic
925323588 2:2997645-2997667 CCAGAGGAGGAGGAAGTGAAGGG - Intergenic
925387283 2:3470894-3470916 ACAGAGGTGAAAGGGGTGGACGG + Intronic
925537096 2:4929408-4929430 TCAGCGGTGGAGGAGGCTGAGGG + Intergenic
925579408 2:5395358-5395380 TCAAAGGTGGAGGTGGAGGAAGG + Intergenic
925651437 2:6093738-6093760 GAAGAGATGGAGGAGGTGAAAGG + Intergenic
925662458 2:6217421-6217443 TGTGAGGTGGAGGAGGGAGAGGG - Intergenic
925742792 2:7020296-7020318 ACAGCGGAGGTGGAGGTGGAAGG + Intronic
925746917 2:7051321-7051343 TTGGAGGTGGAGCAGGTGGACGG + Intronic
926175360 2:10586612-10586634 TCAGAAGAGGAGGAAGTGGAAGG - Intronic
926377077 2:12241554-12241576 TCTGAGGAGGAGGAGGAAGAGGG + Intergenic
926544135 2:14217954-14217976 AAGGAGGTAGAGGAGGTGGAAGG + Intergenic
926989851 2:18666745-18666767 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
926999971 2:18784317-18784339 TATGAGGTGGAGGAGGTGCTTGG + Intergenic
927024194 2:19048956-19048978 GTAGAGGTGGAGGATCTGGATGG - Intergenic
927681079 2:25139437-25139459 ACAGAGGGGCAGGAAGTGGAGGG - Intronic
927718938 2:25370880-25370902 TCAAAGGTGGGGGAGGGGGAAGG - Intergenic
927803561 2:26123904-26123926 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
927812478 2:26187685-26187707 TCAGAAGAAGAGGAGGAGGAGGG - Exonic
927929380 2:27034324-27034346 TGAGAGGAGGGGGAGGTGGATGG + Intronic
928088920 2:28362222-28362244 TCACGCGTGGAGGAGGAGGATGG - Intergenic
928168904 2:28990806-28990828 TGAGAGCTGGAGGGGGTCGAAGG + Intronic
928218305 2:29380829-29380851 TCAGTGTTGGAGGAGGGGGCTGG - Intronic
928724212 2:34152126-34152148 TCAGGGGTGGAAGAGGTAAAGGG - Intergenic
928850635 2:35741087-35741109 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
929161414 2:38836276-38836298 GCAGAGGTGGAAGAAGTGGAAGG - Intronic
929355852 2:41023426-41023448 GAAGAGGTGAAGGAGGTGAAAGG - Intergenic
929553842 2:42911622-42911644 TCAGAGGTGGTGGAGGAGAGGGG - Intergenic
929590183 2:43140465-43140487 GCAGAGGTGGAGGATGGGGTAGG - Intergenic
929849838 2:45576065-45576087 GAAGTGGTGGAGGAGGTGGAAGG - Intronic
929880355 2:45831391-45831413 TCAGAGGTGGCTGGGATGGAGGG + Intronic
929949320 2:46394070-46394092 TCTAAGCAGGAGGAGGTGGACGG + Intergenic
930073455 2:47388013-47388035 GAAGAGGTGGAGGAGGTAGAAGG + Intergenic
930120296 2:47755261-47755283 GCAGAGGTGGGGGGGGTGGGGGG + Intronic
930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG + Intergenic
930299024 2:49592417-49592439 TCAGAGGGGGAAGAGTAGGAGGG + Intergenic
930364654 2:50424182-50424204 GAAGAGGGGGAGGAGGAGGAGGG + Intronic
930717793 2:54609057-54609079 GTAGAAGTGGAGGAGGTAGAAGG + Intronic
931014806 2:57964429-57964451 TCAAGAGTGGTGGAGGTGGAAGG + Intronic
931282681 2:60807925-60807947 TGAAAGCTGGGGGAGGTGGAAGG + Intergenic
931320399 2:61170320-61170342 GAAGAGGTGGAGGAGGTAGAAGG - Intergenic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931638819 2:64363624-64363646 ACAGAGAAGGAGGAGGTGAAAGG - Intergenic
931992766 2:67807740-67807762 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
932029271 2:68166535-68166557 GCAGAGGAGGAAGATGTGGAAGG + Intronic
932144706 2:69307111-69307133 GCACAGGTGGAGGTGGTGGCAGG + Intergenic
932336665 2:70935691-70935713 TGAGAGCTGGAGGATGTGGAGGG - Intergenic
932429419 2:71665197-71665219 GAAGAGGTGGAGGAGCTGGGAGG - Exonic
932558959 2:72850680-72850702 TGGGAGCTGAAGGAGGTGGAAGG - Intergenic
932614922 2:73225878-73225900 GAAGAGGAGGAGGAGGAGGAAGG + Exonic
932635632 2:73385825-73385847 GCAGAGGAGGAGGAGGAGGGGGG - Exonic
932898647 2:75671384-75671406 ACAGAGGTCTAGGAGGTGGTTGG - Intronic
932954999 2:76341334-76341356 AAAAAGGTGGAGGAGGTGGAAGG + Intergenic
932989957 2:76774664-76774686 GAAAAGGTAGAGGAGGTGGAAGG + Intronic
933260298 2:80124758-80124780 TCAGAGGAAGAGGAAGGGGAGGG - Intronic
933348416 2:81121034-81121056 TCAGGGGTTGAGGAGGTTGTAGG - Intergenic
933644844 2:84802598-84802620 TCAGAGGAGCAGGGGGTGGGGGG + Intronic
933830673 2:86205439-86205461 GAAGAGGTGGAGGAGTTAGAAGG + Intronic
933841094 2:86286172-86286194 ACAGCTGTGGAGGAGGTGGGTGG - Intronic
933901934 2:86856293-86856315 TCAGAGTCTGAGAAGGTGGAGGG - Intronic
934561438 2:95315526-95315548 TCAGGGGTCAGGGAGGTGGAGGG - Intronic
934653205 2:96104077-96104099 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
935078815 2:99772078-99772100 TCTGAGGTGGAGGATGGGAAAGG - Intronic
935106166 2:100045630-100045652 GCAGAGGTGGGAAAGGTGGAGGG - Intronic
935593503 2:104862479-104862501 TCAGAAGAGGCGGAGGGGGAGGG + Intergenic
935778609 2:106492972-106492994 TCAGAGTCTGAGAAGGTGGAGGG + Intergenic
935803394 2:106722675-106722697 GAAGAGATGGAGGAGATGGAAGG + Intergenic
936066848 2:109339148-109339170 GAAGAGGTAGAGGAGGTGGACGG + Intronic
936074148 2:109390995-109391017 CCAGAGGCGGACAAGGTGGACGG + Intronic
936087717 2:109480625-109480647 TGGGAGGAGGAGGAGGAGGATGG + Intronic
936496554 2:113027262-113027284 GAAGAGGTGGAGGAGTTAGAGGG + Intronic
936964131 2:118110435-118110457 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
937098725 2:119252377-119252399 TCAGAGGAGGAGGGGGTGGCAGG - Intronic
937162360 2:119776574-119776596 GAAGAGGTGGAGGAAGTGGAAGG - Intronic
937217705 2:120323311-120323333 ACAGAGGAGGAGGAGGAGGGGGG - Intergenic
937687742 2:124717197-124717219 TCAGAGGTGACGGAGGAGCAGGG + Intronic
937854008 2:126659862-126659884 CAGGAGGTGGAGGAGGTGGAGGG - Intronic
938387822 2:130880237-130880259 TCAGAAGTGGAGGCTGAGGAAGG + Intronic
939283150 2:140091043-140091065 GCAGAGGTGAAGAAGGTAGAAGG - Intergenic
939680786 2:145129516-145129538 GCAGAGGTGGAGGAGGTTGGAGG - Intergenic
939831626 2:147079559-147079581 ACAGAGGTGGAGAAGATGGAAGG + Intergenic
939911097 2:147984191-147984213 GAAGAGGTGGAGGAGGTAGAAGG - Intronic
940022934 2:149174780-149174802 TCAGAGGTTGGGGGGGTGGGAGG + Intronic
940113805 2:150185052-150185074 GCAGAGGAGGGGGAGGTGGATGG - Intergenic
940594241 2:155769234-155769256 TTAGAGCTGGAGGAGCTGCAAGG - Intergenic
940884320 2:158975594-158975616 TCAGGGGTGTAGGAGGCGGGCGG + Intronic
942369958 2:175273104-175273126 TCAGAGCTGGAGGTGCTGGGAGG - Intergenic
942524809 2:176841808-176841830 AGAGAGGAGGAGGAGGAGGAAGG - Intergenic
942757702 2:179361811-179361833 TGAGGGGTGTGGGAGGTGGAAGG + Intergenic
943047089 2:182872328-182872350 GCAGAGGTGAAAGAGGTGGGTGG - Intergenic
943239692 2:185366624-185366646 GCACAGGTGGAAGAAGTGGAAGG - Intergenic
943439830 2:187915214-187915236 GCAGAGGAGGAGGAAGAGGAGGG + Intergenic
943536780 2:189162075-189162097 TGAGAGGTGGAGGACTGGGATGG - Intronic
943806218 2:192130281-192130303 ACAGAGGAGAAGGAGGAGGAAGG - Intronic
944476112 2:200108442-200108464 GAAGAGGTGGAAGAGGTGAAAGG - Intergenic
944627442 2:201585945-201585967 GAAGAGGTGGAGGAGGTAGAAGG - Intronic
944663957 2:201943905-201943927 GCAGAGATGGAGGAGGTGGAAGG + Intergenic
944747591 2:202674019-202674041 TCAGAGGTGGGGGGGGTGCAGGG - Intronic
944822050 2:203441032-203441054 TTGGGGGTGGAGGAGGGGGAGGG + Exonic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945273586 2:207966022-207966044 ACAGAGGTGGAAGAGTTGGAAGG + Intronic
945988971 2:216377589-216377611 GAAGAGGAGGAGGAGGGGGAGGG + Intergenic
946065985 2:216987623-216987645 ACAGAGGGTGAGGAGCTGGAAGG - Intergenic
946122814 2:217531169-217531191 TGAGAGGTCCAGGAGATGGAGGG - Intronic
946307844 2:218866135-218866157 ACAGGGGTGGGGGAGGTGGGTGG - Intronic
946310971 2:218882456-218882478 TCTGAGGTGGAGATGCTGGATGG - Intronic
946566693 2:220973075-220973097 TAAGAGTTGGAGGTGGTGGCCGG - Intergenic
946846646 2:223864901-223864923 GAAGAAGTGGAGGAGGAGGAGGG - Intronic
946846652 2:223864923-223864945 GAAGAGGTGGAGGAAGAGGAAGG - Intronic
947035625 2:225851127-225851149 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
947119374 2:226799661-226799683 TCCGAGGAGGAGGAGGAGGAGGG - Exonic
947430181 2:230021153-230021175 TCAGATGTGAAGGCCGTGGAAGG - Intergenic
947557087 2:231102707-231102729 GAAGAGGTGGAGGAGGTAGAAGG + Intronic
947682770 2:232050882-232050904 ACAGAGATGAAGGAGGTGTATGG + Intronic
947698258 2:232211108-232211130 GGGGAGGTGGAGGAGGAGGAGGG - Intronic
947760945 2:232603411-232603433 GAGGAGGAGGAGGAGGTGGAAGG + Intergenic
947762593 2:232614321-232614343 TAAGAGATGGAGGAGGTGGGAGG - Intronic
947885827 2:233570254-233570276 GAATTGGTGGAGGAGGTGGAAGG - Intergenic
948042706 2:234916350-234916372 TCAGAGGTGGAGCAGTTTCAGGG + Intergenic
948406302 2:237722596-237722618 TAAGATGGGGAGGAAGTGGATGG + Intronic
948458843 2:238119521-238119543 GGGGAGATGGAGGAGGTGGATGG + Intronic
948502773 2:238407106-238407128 CCCGAGGAGGAGGAGGAGGAGGG + Intergenic
948617017 2:239205684-239205706 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
949037002 2:241820532-241820554 TCAGAGCTGGAAGAGGCTGAAGG + Intergenic
1168989429 20:2081429-2081451 CCAGACATTGAGGAGGTGGAGGG - Intergenic
1169309299 20:4521589-4521611 TCAGAGGGGGCTGAGGCGGAAGG - Intergenic
1169315016 20:4583194-4583216 TAAGAGATGGAAGAGGTTGATGG + Intergenic
1169451523 20:5716079-5716101 GCGGAGGTGAAGGAGGTAGAAGG + Intergenic
1169664081 20:8015144-8015166 GAGGAAGTGGAGGAGGTGGATGG + Intronic
1169807473 20:9574334-9574356 TCAGAGGTGGAGGAAGAGCCTGG - Intronic
1169929398 20:10816165-10816187 TAAGAGGTGGAGGTAGTGAATGG - Intergenic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170732598 20:18987638-18987660 TCTTTGGTGGAGGAGGTGGATGG - Intergenic
1170779626 20:19412611-19412633 CAAGAGGAGGAGGAGGAGGAGGG + Intronic
1170854364 20:20037121-20037143 TCAGAGGTGGAGAACGGGAAGGG - Intronic
1171258602 20:23710964-23710986 TCAGACTTGGAGGAGGGGGCTGG + Intergenic
1171265920 20:23772426-23772448 TCAGACTTGGAGGAGGGGGCTGG + Intergenic
1171418120 20:24997412-24997434 GAAGAGGTGGAGCAGGTGGAAGG - Intergenic
1171486438 20:25489627-25489649 TCAGTGGTGGGGGGCGTGGAGGG - Intronic
1171967565 20:31542131-31542153 GAAGTGGTGGTGGAGGTGGAGGG - Intronic
1172014491 20:31864886-31864908 TCTGTGGTGGGGGAGGGGGAGGG - Intronic
1172126490 20:32627765-32627787 TCTGAGGCTGAGGAGGTGGCGGG - Intergenic
1172213107 20:33214712-33214734 CCAGAGGTGAAGGAGGTGGGAGG - Intergenic
1172281381 20:33710448-33710470 ACAGAGGTGGGGGTGATGGAAGG - Intronic
1172357937 20:34292611-34292633 TCAGAGGGGCCGGAGGTGGCTGG - Intronic
1172408965 20:34708818-34708840 TCGGAGGAGGATGAAGTGGACGG + Exonic
1172678589 20:36694188-36694210 GAAGAGGTGGAGGAGGTGAAAGG + Intronic
1172771938 20:37387003-37387025 TGGCAGGTGGAGGTGGTGGAAGG + Intronic
1172864429 20:38084892-38084914 GGGGAGGTGGAGGAGGTGGCAGG - Intronic
1172941723 20:38658994-38659016 TCGGAGGTGGAGGACTTGGGAGG - Intergenic
1173139685 20:40471028-40471050 TCAGAGGAGGACGAGGCGGAGGG + Intergenic
1173323015 20:42006449-42006471 TAAGGGGTGGAGGAGCAGGATGG - Intergenic
1173377156 20:42496221-42496243 GAAGAAGTGGAGGAGGTGGAAGG + Intronic
1173538996 20:43837659-43837681 AAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1173925779 20:46780167-46780189 ATACAGATGGAGGAGGTGGAGGG - Intergenic
1174213554 20:48898986-48899008 GCAGAGGTGGATGAGGTGAAGGG - Intergenic
1174405987 20:50303779-50303801 TCAGAGGAGGGGAGGGTGGATGG + Intergenic
1174412452 20:50344715-50344737 GCCAAGATGGAGGAGGTGGAGGG - Intergenic
1174520385 20:51125347-51125369 GAAGATGGGGAGGAGGTGGAAGG - Intergenic
1174520529 20:51126757-51126779 GCAGAGGCAGAGGAGGTGGAAGG - Intergenic
1175134798 20:56815151-56815173 AGAGAGGAGGAGGAGGGGGAGGG + Intergenic
1175226154 20:57445070-57445092 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1175262191 20:57681639-57681661 CCAGCAGGGGAGGAGGTGGAGGG - Intronic
1175300208 20:57937725-57937747 GCAGAGGTGGAGGGGGTGAGAGG + Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175517040 20:59576610-59576632 TCAGTGGTGGAGGAGGGGAGTGG + Intergenic
1175681775 20:60994644-60994666 CCTGAGGTAGAGGAGGTGGGAGG - Intergenic
1175806130 20:61830315-61830337 TCTGAGGCAGAGGATGTGGATGG - Intronic
1175948784 20:62571567-62571589 CCTGAGGTGGGGGAGGGGGATGG + Intergenic
1176072959 20:63236283-63236305 ACAGAGGAGGAAGAGGAGGAGGG + Exonic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1176306076 21:5123793-5123815 TGAGAGGTGGAGGTGGTGCCAGG - Intronic
1176385693 21:6137696-6137718 TCAGGGGTGGAGGAACTGGTGGG + Intergenic
1177201783 21:17965439-17965461 GAAGAGGAGGAGGAGGAGGATGG - Intronic
1177692900 21:24533797-24533819 GAAGAGGTGGAGGAGATTGAAGG + Intergenic
1177758325 21:25373733-25373755 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1177762843 21:25421257-25421279 CCAGAAGTGGGAGAGGTGGAAGG - Intergenic
1177877930 21:26657422-26657444 GCAGAGGTGGAGGAGGTAGAAGG - Intergenic
1177928341 21:27248142-27248164 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1178043093 21:28662988-28663010 TCAGTGCTGGAGGTGCTGGAAGG - Intergenic
1178375539 21:32064598-32064620 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1178389392 21:32185799-32185821 TCAGAGGGAGGGGAGGTGGCAGG - Intergenic
1178403303 21:32305525-32305547 TCAGAGGAGGAGGAGGTTGGGGG + Intronic
1178558884 21:33619253-33619275 GCAGAGGTGGAGAAGAGGGATGG - Intronic
1178577962 21:33812034-33812056 TCAGGGCGGGAGGAAGTGGAGGG + Intronic
1178794149 21:35728106-35728128 GCAGAGATGGAGGAGGTGGAAGG - Intronic
1178824520 21:36004754-36004776 GCAGTGGGGGAGGAGGTGGGGGG + Intergenic
1178876949 21:36420967-36420989 TGAGAGGTGGTGGTTGTGGAGGG + Intergenic
1179043981 21:37829164-37829186 CCAGGGGTGGAGGTGGTGGGAGG + Intronic
1179270454 21:39846673-39846695 TCAGAACTGGAGGCAGTGGAGGG + Intergenic
1179345895 21:40556983-40557005 GGAGAGGTGGAGAAGGTGGAAGG + Intronic
1179391514 21:40996491-40996513 AAGGAGGTGGAGGAGTTGGAAGG + Intergenic
1179454667 21:41490844-41490866 GCAGAGGTGGAGGAGAGGGGAGG + Intronic
1179714371 21:43280060-43280082 GGAGGGGAGGAGGAGGTGGAGGG + Intergenic
1179737780 21:43400556-43400578 TCAGGGGTGGAGGAACTGGTGGG - Intergenic
1179772483 21:43632600-43632622 GTAGAGGTGGAGGAGGTGGAAGG - Intronic
1179850981 21:44138238-44138260 TGAGAGGTGGAGGTGGTGCCAGG + Intronic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1179888184 21:44323398-44323420 GCAGAGGTGTAGGTGCTGGACGG + Intronic
1179906563 21:44426019-44426041 TCACAGCTGGAGGTGGTGGAGGG + Intronic
1179984762 21:44914136-44914158 CCAGAGCTGGAGGATGAGGAGGG - Intronic
1180059076 21:45375464-45375486 ACAGAGGTGGGGGAGGAGGAGGG + Intergenic
1180280975 22:10695167-10695189 AAAAAGGTGGAGGAGGGGGAGGG - Intergenic
1180280985 22:10695202-10695224 AAAAAGGTGGAGGAGGGGGAGGG - Intergenic
1181084019 22:20430977-20430999 CCAGGGAGGGAGGAGGTGGAAGG - Intronic
1181528195 22:23501993-23502015 GCGGAGGTGGAGGCAGTGGATGG - Intergenic
1181554127 22:23657865-23657887 GAGGAGGTGGAGGAGGAGGAGGG - Intergenic
1181687935 22:24542330-24542352 ACAGAGCTGGAGGACCTGGAGGG + Intronic
1181720993 22:24774375-24774397 TCATGGCTGGAGGAGGTGCATGG - Exonic
1181877685 22:25952801-25952823 TAAGTGGTTGAGTAGGTGGACGG - Intronic
1181883372 22:25999522-25999544 GAAGAGGGGGAGGAGGGGGAGGG - Intronic
1181886074 22:26023476-26023498 GTAGAGGAGGAGGAGGAGGAGGG - Intronic
1182407611 22:30150495-30150517 AGAGAGGTAGAGGAGGTGGGTGG - Intronic
1182520461 22:30881812-30881834 TCCGGGCTGGGGGAGGTGGACGG + Intronic
1182539543 22:31030803-31030825 GACGAGGTAGAGGAGGTGGAAGG - Intergenic
1182662839 22:31937151-31937173 TCACAGTGGGAGTAGGTGGAAGG + Intronic
1182744265 22:32593602-32593624 GCAGAGGAGGAGGAGAAGGAGGG + Intronic
1182764004 22:32745393-32745415 TCGGGGGTGGAGGGGGTGGATGG + Intronic
1183253139 22:36744283-36744305 GCAGAGGTGGAGGAGAAGGTAGG - Intergenic
1183290688 22:37000046-37000068 TCAAGGGAGGAGGAGTTGGAGGG - Intronic
1183320830 22:37164202-37164224 GGAGAGGTGGAGGAGGTTGGGGG - Intronic
1183371275 22:37433801-37433823 GGAGAGCTGGAGGAGGAGGAAGG + Intergenic
1183473224 22:38020802-38020824 CGAGAGGGGGTGGAGGTGGAGGG - Intronic
1183929875 22:41229870-41229892 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1183946092 22:41326610-41326632 GGAGAGGAGGAGGAGGAGGAAGG - Intronic
1184092468 22:42299786-42299808 GCAGAGGAGGAGGAAGTGGTGGG + Intronic
1184116627 22:42426321-42426343 GCTGAGGTGGAGGAGGGGCAGGG - Intronic
1184185854 22:42864840-42864862 AAAGAAGTAGAGGAGGTGGAAGG - Intronic
1184387870 22:44186550-44186572 TCAAAGGTGGGAAAGGTGGATGG - Intronic
1184482998 22:44759061-44759083 AAAGAGGTGAACGAGGTGGATGG + Intronic
1184841525 22:47055047-47055069 TCCGAGGTGGAGGAGGTGAGGGG + Intronic
1184866596 22:47205035-47205057 GCAGAGGTGGAGGGAGTGGCTGG + Intergenic
1185263501 22:49884812-49884834 TCAGGGGAGGAGGAGGCCGAAGG - Exonic
1185392276 22:50569022-50569044 TCTGAGCTGGGGGAGGGGGAGGG + Exonic
949198546 3:1342958-1342980 AAAGAGGTGGAGGAGGTGAAAGG - Intronic
949278628 3:2319459-2319481 ACAGAGGTGAAAGAGATGGAAGG - Intronic
949364272 3:3263682-3263704 GAAGAGGTGGAGGAGGTAGAAGG + Intergenic
949364383 3:3264821-3264843 GAAGAGGTGGAGGAGGTAGAAGG - Intergenic
949521831 3:4863411-4863433 TAAAAGGTGGAGTAGGTAGAGGG - Intronic
949563554 3:5224784-5224806 TCAGGAGTGGCAGAGGTGGAAGG + Intergenic
949604073 3:5634532-5634554 TCAGAGGTGGAGGGCATGGTGGG - Intergenic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
950047468 3:9958127-9958149 ACCGAGGAGGATGAGGTGGAAGG - Intergenic
950066848 3:10118843-10118865 TCATGGGTGGCAGAGGTGGAAGG - Intronic
950127587 3:10519572-10519594 TCAGAGGTGGGGTAGGGGCAGGG - Intronic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950479657 3:13236614-13236636 TCACAGGCAGAGAAGGTGGAGGG - Intergenic
950540125 3:13607428-13607450 TAGGAGGGGGAGGAGGAGGAGGG + Intronic
950955827 3:17052646-17052668 GAAGAGGTGGAGGAGGCAGAAGG - Intronic
951744518 3:25962325-25962347 TCAGAGTTGGAGGGGGTAGTTGG + Intergenic
951987713 3:28639300-28639322 TCAGGGGTGGCAGAGGTGGGAGG + Intergenic
952088972 3:29861309-29861331 TAAGAGTGGGAGGAGCTGGATGG - Intronic
952107560 3:30087630-30087652 GGGGAGGAGGAGGAGGTGGAGGG - Intergenic
952263151 3:31760226-31760248 GAAGAGTTGGAGGAGGTGAAAGG + Intronic
952355957 3:32584176-32584198 TCAGAGATGGAGGAAGAGGGAGG - Intergenic
952600696 3:35078611-35078633 TCAGAAGTGGCAGAGGTGGAGGG + Intergenic
953016302 3:39080105-39080127 TTGGAGGTGGAGGAGGGGGCAGG + Intronic
953379607 3:42458392-42458414 GCAGGGGAGGAGGAGGTGGAAGG + Intergenic
953778773 3:45846778-45846800 AAAGAGTTGGAGGAGGTGGAAGG + Intronic
953796348 3:45989077-45989099 TCAGGGGAGGAGGAGGTTGGAGG + Intronic
953902569 3:46851626-46851648 CCAGAGGTGGAGGTGGAGAATGG + Intergenic
954000106 3:47549898-47549920 TGGGAGGGGGAGGAGGAGGAAGG - Intergenic
954680546 3:52343697-52343719 TCAGATGTGGCAGAGGTGGGAGG + Intronic
954707222 3:52487470-52487492 CCAGACGTGGAGGAGGAGGAGGG + Exonic
954744197 3:52777829-52777851 TCAGAAGTGGTGGAGGTGGTGGG - Intronic
955382559 3:58451519-58451541 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955889591 3:63635800-63635822 TCAAAGGTACAGGAGGTGGGCGG + Intergenic
955947567 3:64210037-64210059 ACAGTGGTGGAGGAGGAGGGAGG - Intronic
956150675 3:66238850-66238872 GAAGAAGTAGAGGAGGTGGAAGG + Intronic
956340096 3:68212773-68212795 TCAGAGTTGGAGAAAGGGGATGG + Intronic
956572168 3:70709003-70709025 GAAGAGGGGGAGGAGGTGGGAGG + Intergenic
956699181 3:71943809-71943831 GAAGAGGTGGAGGAGCTGGAAGG + Intergenic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957060780 3:75479687-75479709 AGGGTGGTGGAGGAGGTGGAAGG - Intergenic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
958059984 3:88467188-88467210 GAAGTGGAGGAGGAGGTGGATGG - Intergenic
958085973 3:88807593-88807615 GCAGAGGTGGAGGTGGGGCAGGG - Intergenic
959146912 3:102557698-102557720 GAAGAGGTAGAGGAGGTGAAAGG - Intergenic
959256961 3:104027583-104027605 GCAGAAGTGGAAAAGGTGGAAGG + Intergenic
959467976 3:106713599-106713621 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
959601350 3:108190012-108190034 TCAGAGGTGGCAGAGGCAGAAGG + Intronic
959922094 3:111879541-111879563 GCAGAAGTGGAGGAGGTAGAAGG + Intronic
959969228 3:112390141-112390163 AAAGAGGTGGAAGAGGTGGAAGG - Intergenic
960047388 3:113211478-113211500 TGCGAGGAGGAGGAGGAGGAGGG - Exonic
960488565 3:118282347-118282369 TCTGAGGAGGAGGAGGAGCATGG - Intergenic
960616927 3:119604596-119604618 TCAGAGGCTGAGAAGGGGGAAGG + Intronic
961236789 3:125374798-125374820 TCAGAGGTAGGGGAGGAGGTGGG - Intronic
961236945 3:125375261-125375283 GAAGAGGAGGAGGAGGAGGAGGG - Exonic
961366228 3:126401688-126401710 TGGGAGGGGGAGGAGATGGAGGG + Intronic
961481683 3:127184506-127184528 CCACAGGTGGAGGGGGTGGCAGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962404229 3:135086325-135086347 TCAGAAGTGGGGGTGGGGGAGGG + Intronic
962989591 3:140566152-140566174 GAAGAGGAGGAGGAGGAGGAAGG + Exonic
963001683 3:140687513-140687535 TCAGAGGGGGAAGAAGGGGAAGG + Intronic
963015944 3:140823946-140823968 GAAGAGGTGGAGGAAGTGGAAGG - Intergenic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
963888241 3:150604056-150604078 TGACAGCTGGAGGGGGTGGAAGG + Intronic
964033987 3:152173171-152173193 GAAGAGGTGGAGAAGGTGGAAGG - Intergenic
964453937 3:156839947-156839969 ACACAGGTGGAGAAAGTGGAAGG - Intronic
964537947 3:157746150-157746172 GTAGAGGTAGAGGAGGTAGAAGG + Intergenic
965216984 3:165875371-165875393 ACAGGGGTGGAGGAGGTAGCTGG - Intergenic
965358086 3:167702213-167702235 TCAGAAGTAGAGAAGGTGAATGG - Intronic
965586684 3:170325219-170325241 TCAGATGTGGAGGAGAGGTATGG + Intergenic
966171548 3:177087052-177087074 GGAGAGGTAGAAGAGGTGGAAGG + Intronic
966637344 3:182150560-182150582 TCAGGGGTAGAGGTGGGGGAGGG - Intergenic
966732272 3:183161239-183161261 TCAGAGGTGGAGGCCTTTGAGGG - Intronic
966863348 3:184242611-184242633 GCAGAGCTGCAGGATGTGGAAGG + Exonic
966908531 3:184544637-184544659 TAGGAGGGGGAGGAGGAGGAGGG - Intronic
966956054 3:184880320-184880342 TCAGAGGTTAAGGAGGGGGTGGG - Intronic
967280663 3:187820217-187820239 GCAGAGGTGGAAGAAGTGGCAGG - Intergenic
967313708 3:188130770-188130792 GCAGAGGTGAAAGAGGTGGAAGG + Intergenic
967501281 3:190201000-190201022 TCAGGGGTGGGGGTGGTGGAAGG + Intergenic
967566261 3:190977044-190977066 AAAGATGTAGAGGAGGTGGAAGG - Intergenic
967668163 3:192199754-192199776 TCAGAGTGGGAGGAGGAGGGAGG - Intronic
967999189 3:195191239-195191261 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
968293294 3:197555247-197555269 CCGGAGGAGGAGGAGGAGGAGGG + Intronic
968474257 4:795632-795654 TGAGAGGTGGAGGCGGTGGGGGG + Intronic
968482063 4:837668-837690 TCAGGTGGGGAGGAGGTGGTCGG - Intergenic
968505198 4:968196-968218 TGGGAGGTGGAGGAGTTGGCGGG - Intronic
968543341 4:1179670-1179692 ACAGAGCTGGAGGGGGTGGGTGG - Intronic
968711470 4:2122432-2122454 TCAGAGGTAGAGGAGGGGCAGGG + Intronic
968969866 4:3788184-3788206 GCAGAGGGGCAGGAGCTGGAGGG - Intergenic
969200891 4:5604884-5604906 GAAGAGTTGAAGGAGGTGGAAGG - Intronic
969370326 4:6727658-6727680 GGAGAGGGGGAGGAGGGGGAGGG - Intergenic
969649702 4:8458287-8458309 GAAGACATGGAGGAGGTGGAAGG - Intronic
969978145 4:11126092-11126114 TTAGAGAGGTAGGAGGTGGAGGG - Intergenic
970807134 4:20050183-20050205 GAAGAGGTGGAGAAAGTGGAAGG - Intergenic
971436602 4:26632584-26632606 AAAGAGGTAGAGGAGGTGGAAGG + Intronic
972257562 4:37374204-37374226 ACAGAGGAGGAGGAGGTGCCAGG - Intronic
972751552 4:41994635-41994657 AAAGAGGTTGAGGAGGAGGAGGG - Intronic
972847633 4:43008964-43008986 TAAGAGGTGCAGGAGAAGGAAGG - Intronic
973219045 4:47704774-47704796 TCAGTGGTGGAGGGTGTGGGAGG + Intronic
973267569 4:48226393-48226415 GAAGATGTGGAGGAGGTTGAAGG - Intronic
973267797 4:48228840-48228862 TGAGATGTGGAGGAGCAGGATGG - Intronic
973588719 4:52418858-52418880 TCTGAGGTAGTGGAGGTGGTGGG - Intergenic
973690754 4:53428113-53428135 GAAGAAATGGAGGAGGTGGAAGG - Exonic
974086179 4:57263831-57263853 CCAGAGGTGGAGGATGTGTGTGG - Intergenic
974540751 4:63230980-63231002 GAAGAAGTGGAGGAGGTGGGAGG + Intergenic
974832928 4:67211397-67211419 TCAGGGGTGGAGGGGGTGGGGGG + Intergenic
974856145 4:67463898-67463920 TCAGAGGTGAGGGAGATGGGAGG + Intergenic
975423399 4:74196505-74196527 ACAGATGTGGGGGAAGTGGAAGG + Intronic
975485945 4:74934050-74934072 TCAGAGGTGGTGCAGGGGGAGGG - Intronic
976131338 4:81887591-81887613 AGAGAGGGGAAGGAGGTGGAAGG + Intronic
976172064 4:82314569-82314591 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
976231338 4:82846509-82846531 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
976321190 4:83717909-83717931 GGAGAGTTAGAGGAGGTGGAAGG - Intergenic
976426834 4:84913849-84913871 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
976668772 4:87628685-87628707 TAAGAGGTGGAGCCTGTGGAAGG + Intergenic
976704692 4:88008025-88008047 GAGGAGGAGGAGGAGGTGGAAGG + Exonic
977099685 4:92795130-92795152 GAACAGGTGGAGGAGGTGGAAGG + Intronic
977184306 4:93917416-93917438 ACAGAGGTTGAGGAGAAGGAAGG + Intergenic
977233293 4:94477765-94477787 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
977273533 4:94947824-94947846 CCAGAGGTGGTGCAGGTGGGAGG - Intronic
977317444 4:95468040-95468062 GCAGAGGTGGAGGAAGTGAAAGG + Intronic
977537397 4:98270774-98270796 GCAGAGGTGGAGGAGGTAAAAGG - Intronic
977984072 4:103361090-103361112 TCAGTGTTGGAGGAGGGGGCTGG + Intergenic
978011782 4:103695309-103695331 GGTGAAGTGGAGGAGGTGGAAGG - Intronic
978291779 4:107150534-107150556 GCAGAGGTGGGGGATGGGGAGGG + Intronic
979038143 4:115751866-115751888 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
979459722 4:120968143-120968165 GTAGAGGTGGAGGAGGTAGAAGG - Intergenic
980950278 4:139368708-139368730 TTTGAGGTGGCGGGGGTGGAGGG + Intronic
981175401 4:141677183-141677205 GAAGAAGTGGAGGAGGTGGAAGG - Intronic
981288656 4:143048494-143048516 TGAGAGGAGGAGAAGGAGGAAGG - Intergenic
981571719 4:146158735-146158757 GAAGAGGTGGAGGAGATGGAAGG - Intergenic
981666617 4:147234239-147234261 GAGGAGGTGGAGGAGGTGGAAGG + Intergenic
981923284 4:150110631-150110653 TCAGAAGTGGGGAGGGTGGAAGG - Intronic
982111549 4:152061033-152061055 GAAGAGGTAGAGGAGGTGGAAGG + Intergenic
982114279 4:152084382-152084404 GAAGAAGTGGAGAAGGTGGAAGG + Intergenic
982148950 4:152430641-152430663 TCAGTGGTGGTGGTGGTGGTAGG + Intronic
982745948 4:159103867-159103889 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
983010177 4:162537335-162537357 CCAGAGATGGAGTAGGAGGAGGG + Intergenic
983248808 4:165321231-165321253 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
983279127 4:165658480-165658502 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
983413357 4:167425048-167425070 GCAGTGGTGGTGGAGGGGGATGG - Intergenic
983741896 4:171145307-171145329 GAAGAGGTAGAGGAGGTGGAAGG - Intergenic
983933779 4:173481578-173481600 GAAGAGGTGGAGGATGTGGAGGG - Intergenic
983978175 4:173962643-173962665 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
984019713 4:174470298-174470320 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
984190873 4:176604321-176604343 GAAGAGGTGGAGGAGTTGGAAGG + Intergenic
984375742 4:178926637-178926659 GCAGAGGAGGAGGAAGAGGAGGG + Intergenic
984375754 4:178926693-178926715 GAATAGGTGGAGAAGGTGGAAGG + Intergenic
984798421 4:183688852-183688874 TCAGAGGAGGCTGAGGTGGGAGG - Intronic
985061640 4:186085936-186085958 TCAGAGGTGGAGGTTGCGGTGGG - Exonic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985223372 4:187731981-187732003 GAAGAAGTGGAGGAGGTGGGAGG - Intergenic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
985569772 5:638630-638652 GCAGAGATGGGGGAGGTGGGCGG + Intronic
985571337 5:647160-647182 CCAGAGGTGGGGAAGGTGGTGGG - Intronic
985867806 5:2528976-2528998 TAAGAGGTGGACAAGGTGGGTGG + Intergenic
986019778 5:3790391-3790413 ACAGAGGTGGTGGTAGTGGAGGG + Intergenic
986387232 5:7246704-7246726 TCAGAAGGGTAGGAGGAGGAAGG + Intergenic
986394669 5:7316543-7316565 TTAGAGGGGGAGAAGCTGGAAGG - Intergenic
986613878 5:9597110-9597132 ACAGAGGAGGAGGAAGGGGAAGG - Intergenic
986763167 5:10898385-10898407 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
987181478 5:15372734-15372756 TCAGAGGGGGCCGAGGTGGGGGG - Intergenic
987309307 5:16667299-16667321 TCCCAGCTGGAGGAGGTGGCTGG - Intronic
987455132 5:18134876-18134898 GAAGAGGTGGAGGAGGTAGATGG - Intergenic
987505030 5:18757681-18757703 TCTGAGGAGGAGGAAGAGGAGGG + Intergenic
987505039 5:18757737-18757759 GAAGAGGTAGAGGAAGTGGAAGG + Intergenic
988296034 5:29363437-29363459 GAAGAGGTGGAGGAGGTGAAAGG + Intergenic
988383677 5:30533524-30533546 TCAGAGAATGAGGGGGTGGAAGG + Intergenic
988401007 5:30760434-30760456 GCAGAGATGGAGGACGTGAAAGG - Intergenic
988880140 5:35493592-35493614 GAAGAGGTGGAGGAGGTAGAAGG + Intergenic
989167564 5:38446204-38446226 GCAAAAATGGAGGAGGTGGAAGG - Intronic
989978497 5:50613333-50613355 GCAGAAGTGGAAGAGGGGGACGG - Intergenic
990079757 5:51898923-51898945 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
990109047 5:52300779-52300801 TCATAGGAGAGGGAGGTGGAAGG - Intergenic
990403090 5:55459812-55459834 TCAGGGGTGAGGGAGGTAGAAGG - Intronic
990558479 5:56960636-56960658 TCGGAGATGGAGGAGGGAGAAGG - Intronic
990589753 5:57249974-57249996 TCAAACGAGGAGGAGGGGGAGGG - Intronic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
991046083 5:62224186-62224208 GCAGATGTTGAGGAGTTGGATGG + Intergenic
991061480 5:62380835-62380857 GCAGAAGTGGAGGAGGTGGAAGG + Intronic
992015034 5:72566997-72567019 CCAGAGGTGGTGGTGGTGGTGGG + Intergenic
992206340 5:74434018-74434040 TCAGATGGGGAAGAGGTGGGTGG + Intergenic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992636334 5:78728987-78729009 GCAGAGATGGAGGAGGTGGTAGG + Intronic
992738889 5:79753011-79753033 TTGGAGATTGAGGAGGTGGAAGG + Intronic
992887626 5:81174464-81174486 GCAGAGGTGGAGAGGCTGGAGGG + Intronic
993027161 5:82660472-82660494 TCAGAGCTGGAGATGATGGATGG + Intergenic
993033361 5:82729830-82729852 GCAGAGGTGGAGGAGGTAGAAGG - Intergenic
993302455 5:86227587-86227609 GAAGAGGTGGAGGAGGTGAAAGG - Intergenic
993503292 5:88684994-88685016 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
993558473 5:89372615-89372637 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
993760955 5:91796592-91796614 TCAGTGGTGGGGGAGGTGGGGGG + Intergenic
994703411 5:103166924-103166946 GAAGAGGTGAAGGAGGTGGAAGG + Intronic
994960496 5:106595542-106595564 GCAGTGGTGGAAGAGGAGGAAGG - Intergenic
994965208 5:106661020-106661042 TTAGAGGAAGAGGAGGGGGATGG + Intergenic
995684632 5:114759062-114759084 TCAGAGGTGGAGGATGGACAGGG - Intergenic
996347012 5:122498441-122498463 TCAGCGGTGGAGGTGTTGGAAGG - Intergenic
997053894 5:130416973-130416995 TCAGAGCTGGAAAAGGGGGATGG + Intergenic
997206505 5:132053478-132053500 TCAGGTGTAGAGAAGGTGGAAGG + Intergenic
997373755 5:133382444-133382466 TGAGAGGAGGAGGAGGAGGAGGG - Intronic
997736125 5:136213766-136213788 TCAGTGGTGGGGGAGCTGGGTGG - Intronic
997745830 5:136299374-136299396 TGTGTGGTGGAGGAGGAGGAGGG + Intronic
997884718 5:137619898-137619920 TCAGTGGTGGGGGAGGGGCAGGG + Exonic
997958556 5:138300089-138300111 TCTCAGGAGGCGGAGGTGGAAGG + Intronic
998049325 5:139018479-139018501 ACAGAGATGGCTGAGGTGGAAGG + Intronic
998082734 5:139290530-139290552 TCAGGGGTGGCTGATGTGGAAGG - Intronic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
998610784 5:143685856-143685878 TTAGAGGAGTAGGAGGAGGATGG + Intergenic
998754203 5:145358256-145358278 TATGAGAGGGAGGAGGTGGATGG + Intergenic
999038347 5:148378973-148378995 TCAGTGTTGGAGGAGGGGCATGG - Intergenic
999593095 5:153170734-153170756 GCAGAGGTTTAGGAAGTGGAAGG - Intergenic
999682771 5:154075395-154075417 TCTGACGTGGAGGATGGGGAAGG - Intronic
999921754 5:156329184-156329206 ACAGAGGTGGAGGCAGTGAAGGG + Intronic
1000034364 5:157432339-157432361 AGAAAGGTGGAGGAGGTGGAAGG - Intronic
1000316060 5:160092788-160092810 GAGGAAGTGGAGGAGGTGGAAGG + Exonic
1000752465 5:165113889-165113911 GAAGAGTTGGAGGAGGTGGAAGG - Intergenic
1000922380 5:167153501-167153523 GAAGAGGGGGAGGAGGTGGAAGG + Intergenic
1000985997 5:167861251-167861273 TCAGGGTTGTAGGGGGTGGAAGG + Intronic
1001056448 5:168454017-168454039 GAGGAGGTGGAGGAGGAGGAGGG + Exonic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600113 5:172923131-172923153 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600127 5:172923190-172923212 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001633282 5:173192363-173192385 TCAGATGAGGATGAGGTAGAGGG + Intergenic
1001663542 5:173413989-173414011 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1002097680 5:176840998-176841020 TCTCCGGTGAAGGAGGTGGATGG - Intronic
1002322103 5:178382416-178382438 CCAGAGGAGGAGGAGGGCGAAGG - Intronic
1002322298 5:178383142-178383164 CCAGAGCTGGAGGAGGGGGAGGG - Intronic
1002471112 5:179436750-179436772 TCCGAGGTGAAGGAAGTGGCAGG + Intergenic
1002637330 5:180614852-180614874 TCAGAGGGGGAGGAGCAGGATGG - Intronic
1002876903 6:1218765-1218787 TCATAAGAGGAGGAGGAGGAGGG + Intergenic
1002958594 6:1893075-1893097 TCAGGTGGGAAGGAGGTGGATGG - Intronic
1002958699 6:1893757-1893779 TCAGAGGGGGTGGAGGTGAAAGG + Intronic
1003232516 6:4267501-4267523 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1003494691 6:6653854-6653876 GTAGAGGTGGAGGTGGGGGAAGG - Intronic
1003532201 6:6947074-6947096 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1003765736 6:9234398-9234420 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1004065898 6:12243375-12243397 GAAGAGGTGGAGGAGGTGGGAGG + Intergenic
1004292409 6:14380354-14380376 TCAGGGGCCGAAGAGGTGGATGG + Intergenic
1004433606 6:15568598-15568620 GCAAAGGTAGAGGAGGTGGAAGG - Intronic
1004446673 6:15706551-15706573 GAAGAGGTGGGGGAGGTGGAAGG - Intergenic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004834187 6:19512467-19512489 GAAGAGGTGGAAGAGGTGGAAGG - Intergenic
1004840660 6:19580495-19580517 GCAGAGGTGGAGGAGTTGGAAGG - Intergenic
1004918534 6:20355068-20355090 GAAGAGGTGGAAGAGGTGGAAGG - Intergenic
1005142527 6:22649781-22649803 TCAGAGGGGGATGAACTGGAAGG - Intergenic
1005255379 6:23997270-23997292 GCAGAGGTGGAGGAGGGGGAAGG - Intergenic
1005429550 6:25741014-25741036 TGAAAGGTGGAGGAGGTGGTAGG + Intergenic
1005504615 6:26458677-26458699 GCTGAGGAGGAGGAGGAGGAGGG - Exonic
1005925759 6:30444222-30444244 TCAGTGGAGCAGGAGGAGGAAGG - Intergenic
1006312613 6:33271593-33271615 TCAGATATGGAGGAGGAAGAGGG - Exonic
1006371428 6:33646367-33646389 GCAGTGGTGGAGGGGGTGGGGGG - Intronic
1006620240 6:35358896-35358918 ACTGAGGTGGGGGAAGTGGAGGG + Intronic
1006716532 6:36124044-36124066 GAGGAGGTGGAGGAGGTGCAGGG + Intergenic
1006984072 6:38166271-38166293 CCGGTGGTGGGGGAGGTGGAGGG - Intergenic
1006984083 6:38166304-38166326 CCGGTGGTGGGGGAGGTGGAGGG - Intergenic
1006984165 6:38166578-38166600 CCGGTGGTGGGGGAGGTGGAGGG - Intergenic
1007208680 6:40173450-40173472 TGAGAAGTGGGGGAGATGGAGGG - Intergenic
1007266277 6:40598704-40598726 TAAGAGCTGGAGGATGTGGGTGG - Intergenic
1007369881 6:41419744-41419766 TCAGAGGAGGAGGAAATAGATGG + Intergenic
1007380777 6:41488807-41488829 TCAGAGGTGGTGGCGGGGGCTGG + Intergenic
1007634513 6:43290412-43290434 GCAGGGGTGGAGGAGATGGAGGG + Intergenic
1007665640 6:43511333-43511355 AAAGAGGTGGTGGGGGTGGATGG + Intronic
1007732837 6:43959812-43959834 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1008063788 6:47026368-47026390 TCAGAGCTGGGGGCGGGGGAGGG - Intronic
1008095670 6:47337023-47337045 GCAGACATGTAGGAGGTGGAGGG + Intergenic
1008137249 6:47791011-47791033 TTGGAGGAGGATGAGGTGGAAGG + Intronic
1008637404 6:53424566-53424588 TGAGGGGGGGAGGAGGTGGCAGG + Intergenic
1008666288 6:53720249-53720271 TCAGAAGTACAGAAGGTGGAAGG - Intergenic
1008942784 6:57065286-57065308 TCAGAGGAGGAGGAGAAAGAGGG + Intergenic
1009201293 6:60749827-60749849 GCAGTGATGGAGGTGGTGGAGGG - Intergenic
1009307068 6:62103543-62103565 TCAGAGGTGGGGGTGGGGGGCGG - Intronic
1009333902 6:62460980-62461002 TCTGATGTGGAGGAGGAGAAAGG - Intergenic
1009542031 6:64972430-64972452 GCAGAGGTGGAAGAGGTGGAAGG - Intronic
1009690997 6:67031673-67031695 CCACAGGGGGAGGGGGTGGACGG + Intergenic
1010176154 6:73030588-73030610 TCATAGGTAGAAGAGGAGGAAGG + Intronic
1010232218 6:73545113-73545135 TAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1010828626 6:80503501-80503523 GAAGATGTGGAGGAGGTGAAAGG - Intergenic
1010941648 6:81926129-81926151 GTAGAGATGGTGGAGGTGGAGGG + Intergenic
1011566487 6:88678978-88679000 GAAGAGGTGGAAGAGGTGGAAGG - Intronic
1011614282 6:89183857-89183879 TCGGAAGTGGAGAAGGTGGGAGG + Intronic
1011712837 6:90072002-90072024 GAAGGGGTGGAGGAGGTGGAAGG + Intronic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1012106021 6:95159349-95159371 GAAGAGGTAGAGGAGGTGGAAGG + Intergenic
1012450563 6:99349527-99349549 GCAGAGGAGGAGGAGGAGGAAGG + Exonic
1012809209 6:103936565-103936587 GCGGAGGAGGAGGAGGAGGAAGG + Intergenic
1012969056 6:105707042-105707064 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1013181147 6:107718040-107718062 TCAGAGCTGGAGGCTGAGGAAGG + Intronic
1013236950 6:108205532-108205554 AGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1013363326 6:109415112-109415134 AGAGAGGTGGACGAGGTAGAAGG + Intronic
1013504420 6:110785624-110785646 GCAGAGGCGGAGGAGGTAGAAGG + Intronic
1013552699 6:111224131-111224153 TCAGAGGCTGAGGTAGTGGAAGG + Intronic
1013891247 6:115030535-115030557 GAAAAGGTGGCGGAGGTGGAAGG - Intergenic
1014041995 6:116838749-116838771 TCTGGGGTGGAGGAGGGGGGAGG + Intergenic
1014269006 6:119314825-119314847 GCCGAAGTGGAGGAGGAGGAAGG - Intronic
1014340337 6:120197654-120197676 CCAGAGCTTGAGGAGGAGGAGGG - Intergenic
1014443461 6:121499430-121499452 ACACAGGTGGATGAGGTGGGAGG - Intergenic
1015138182 6:129897912-129897934 GAAGAGGTGGAGGAGGTGAAAGG + Intergenic
1015493632 6:133856259-133856281 ACCAAGGTGGAGGAGGGGGAGGG - Intergenic
1016778869 6:147936442-147936464 GCAGTGGTGGGGGAGGGGGAGGG + Intergenic
1016779598 6:147943471-147943493 GCAAAGGAGGAGGAGGAGGATGG - Intergenic
1017014438 6:150088826-150088848 TCAGTGGTGGAGGGAGGGGAAGG + Intergenic
1017601096 6:156082128-156082150 TTAGTGGAGGAGGAGGGGGAAGG + Intergenic
1018202138 6:161405064-161405086 TCAGAGCTGGAGGAGAAGGTGGG - Intronic
1018317456 6:162570802-162570824 TCAGAGGTTGGGAAGGTAGAGGG + Intronic
1018445148 6:163851141-163851163 TCAGGGATGGAAGAGGTAGAAGG - Intergenic
1018581130 6:165309245-165309267 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1018897994 6:168034605-168034627 GCAGGGGTGGAGGTGGGGGATGG + Intronic
1018991662 6:168678422-168678444 TCAGAAGAGGAGGAGGTGGGGGG + Intergenic
1019096540 6:169585818-169585840 GAAGAGGTGGAGGAGGTGGAAGG + Intronic
1019516530 7:1442624-1442646 GCAATGGTGGGGGAGGTGGAGGG - Intronic
1019551755 7:1606708-1606730 GAAGAGGAGGAGGAGGGGGAAGG - Intergenic
1019563716 7:1669875-1669897 TAAAAGGTGGAGGGGGTGGGTGG - Intergenic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020106404 7:5424137-5424159 TCCGAGCTGGTGGAGGGGGAGGG - Intronic
1020475016 7:8583815-8583837 TGAGAGGTGGAGGAGAGGTAGGG + Intronic
1020555923 7:9670208-9670230 CAATGGGTGGAGGAGGTGGAAGG + Intergenic
1020577353 7:9949902-9949924 GAAGAGGGGGAGGAGGAGGAGGG + Intergenic
1021120630 7:16791278-16791300 TCAGTGGTGGAGGAGACTGATGG + Intergenic
1021345737 7:19525641-19525663 TCAGTCTTGGAGGAGGAGGAGGG + Intergenic
1021364495 7:19760099-19760121 CCTGAGGGGGAGGAGGTAGAAGG - Intronic
1021580036 7:22142767-22142789 ACAGAGGTGGGGGATGGGGATGG + Intronic
1021644698 7:22777627-22777649 GCAGAGGTGGAAGAGGTAGAGGG - Intergenic
1021717157 7:23470552-23470574 GGAGAGGAGGAGGAGGAGGAGGG + Intergenic
1021726196 7:23550193-23550215 GCAGAGGAGGAGGAGGAGGCTGG - Intergenic
1021746602 7:23746774-23746796 ACAGAGATGGAAGAGGTGGAGGG + Intronic
1021975269 7:26006386-26006408 CCAGAGGTGGATGAGGGGGCAGG - Intergenic
1022044337 7:26611248-26611270 TCAGATGTGGACAGGGTGGATGG - Intergenic
1022145884 7:27540022-27540044 GAAGAGGTGGAGGTGGTAGAAGG + Intronic
1022567029 7:31413750-31413772 TCAGAGGAGGAAGTGGAGGAGGG - Intergenic
1022732357 7:33041302-33041324 CCAGGGCTGGAGGAGGAGGATGG + Intronic
1022820616 7:33956561-33956583 GAGGAGGTAGAGGAGGTGGAAGG - Intronic
1023115693 7:36859890-36859912 AGAGAGGTGGAAGAGGTGGAAGG - Intronic
1023215153 7:37854394-37854416 GAAGAGGTGGAGGAAGTGGAAGG + Intronic
1023596385 7:41833340-41833362 GGAGAGGTGGGGGAGGTGGTGGG - Intergenic
1023636398 7:42215428-42215450 TCAGAGCAGGAGGTGGTGGGAGG + Intronic
1023769752 7:43545815-43545837 CTCGGGGTGGAGGAGGTGGAAGG + Intronic
1024080762 7:45853363-45853385 TCAGTGGATGAGGAGGTGTAAGG + Intergenic
1024196426 7:47063890-47063912 GAAGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196446 7:47063966-47063988 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196455 7:47064001-47064023 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196559 7:47064898-47064920 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024198039 7:47079375-47079397 TCAGAGGTGGAAGGGGTAGCTGG - Intergenic
1024353974 7:48395606-48395628 GCTGAGGAGGAGGAGGAGGAAGG - Intronic
1024581090 7:50801763-50801785 TCCAAGGTGGAGGAAGGGGAGGG + Intergenic
1024587671 7:50855686-50855708 TCAGAGGCTGAGGATGGGGAAGG - Intergenic
1024674839 7:51629042-51629064 TCAGAGGTGCTGGAGGCTGATGG + Intergenic
1025102147 7:56144264-56144286 TCAGATGTGTAGGATATGGAGGG - Intergenic
1025813224 7:64888593-64888615 TGGGTGGTGGAGAAGGTGGAGGG - Intronic
1025978673 7:66390008-66390030 GCAGAGAAGGGGGAGGTGGAGGG - Intronic
1026132962 7:67635539-67635561 GCAGAGGTGAATGGGGTGGATGG - Intergenic
1026148623 7:67769813-67769835 GAGGAGGTGGAGGAGGAGGAGGG - Intergenic
1026176335 7:68001043-68001065 GAAGAGGTGGAAGAGCTGGAAGG + Intergenic
1026321328 7:69269906-69269928 CCGGAGGAGGTGGAGGTGGAGGG + Intergenic
1026442657 7:70457644-70457666 ACAGAGGTGGGGGTGGTGGAGGG + Intronic
1026862411 7:73799481-73799503 GCAGAGTGGGAGTAGGTGGATGG - Intergenic
1026946696 7:74320790-74320812 TGAGAAGAGGAGGAGGAGGAAGG + Intronic
1027204260 7:76084711-76084733 GCAGAGAAGGGGGAGGTGGAGGG - Intergenic
1027544024 7:79503789-79503811 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1027700175 7:81459930-81459952 TCAGAGAGGGAAGAGGTGGGGGG - Intergenic
1027837009 7:83257109-83257131 GAAAAGGTGGAGGACGTGGAAGG + Intergenic
1028307704 7:89286923-89286945 AAAGAAGTGGAGAAGGTGGAAGG - Intronic
1028394135 7:90348633-90348655 GTGGGGGTGGAGGAGGTGGAAGG + Intronic
1028684766 7:93579051-93579073 TCAGAGTAGGAGGAGATGGCAGG + Intergenic
1029153838 7:98500888-98500910 TCACGTGTGGAAGAGGTGGAGGG + Intergenic
1029167473 7:98603092-98603114 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1029419979 7:100467381-100467403 TCAAGGGTGGAGGTGGTGGCAGG + Intronic
1029433634 7:100548742-100548764 TCATGGGAGGAGGAGGAGGAGGG - Intronic
1029709198 7:102290336-102290358 CCAGAGGTGGTGGAGGTTGCAGG - Intronic
1029745661 7:102514519-102514541 TCAGAGGTGGGGCAAGAGGACGG + Intronic
1029763600 7:102613498-102613520 TCAGAGGTGGGGCAAGAGGACGG + Intronic
1030005267 7:105112391-105112413 AAGGAGGTGGAGGAGGTGGAGGG - Exonic
1030093259 7:105876347-105876369 TAAAAGGAGGAGGAGGTGGTGGG + Intronic
1030131307 7:106203756-106203778 TAAGAGGTGGAGAAGGTGGGAGG + Intergenic
1030149070 7:106384683-106384705 TCTGAGGTGTGGGAGGTGGCAGG - Intergenic
1030175955 7:106653777-106653799 TGAGAGGTCTAGGAGTTGGATGG - Intergenic
1030308726 7:108047307-108047329 GCAGGGGTGGAGGAGGTGGAAGG - Intronic
1030626220 7:111848840-111848862 TAAGAGGTGGTGGAAGGGGAGGG - Intronic
1031060701 7:117048206-117048228 GCAGAGATGGAGGAGGTGAAAGG + Intronic
1031209787 7:118808363-118808385 AAAGAGATGGAGGAGGTGGAAGG + Intergenic
1031354888 7:120778398-120778420 TCAGCGGGGGAGTAGGTGGGAGG + Intergenic
1031796192 7:126176936-126176958 GAAGCGGTGGAGGAGGTGGAAGG - Intergenic
1031976917 7:128099947-128099969 TCAGTGGTGGAGGATATGGTTGG + Intergenic
1031982132 7:128134973-128134995 CAAGAGGTGGAAGAGCTGGATGG + Intergenic
1032075996 7:128836476-128836498 CCAGAGCTGGAGGAGGGGGACGG - Intronic
1032128596 7:129211850-129211872 TCGGAGGAGGAGGAAGAGGAAGG + Intronic
1032280181 7:130493560-130493582 TAAGAGGAGGAGGGTGTGGAGGG + Intronic
1032400389 7:131620333-131620355 GCAGAGGTGGAAGGGCTGGAAGG - Intergenic
1032441087 7:131943616-131943638 TCAGAGCTGCAGGTGGAGGACGG + Intergenic
1032491633 7:132328487-132328509 ACAGAGGTGGTGGAGGTGTGGGG - Intronic
1032500022 7:132393194-132393216 TCAGTGGTGGTGGTGGTGGGGGG - Intronic
1032533680 7:132643081-132643103 TCAGACCTGCAGGAGGAGGAGGG + Intronic
1032867162 7:135937735-135937757 TCAGAGGAGGAAGAGGTGGAAGG - Intronic
1033422282 7:141214400-141214422 TCAGGGGTGGAGGAGGGTGGGGG + Intronic
1033847073 7:145446551-145446573 TCAGAGGTGGTGGTGGAGGTAGG + Intergenic
1034116653 7:148589578-148589600 GCAGAGCTGGAGGGGCTGGAGGG - Intergenic
1034430953 7:151040933-151040955 TCAGAGGGTGAAGAGGTGGTGGG - Intronic
1034472832 7:151264755-151264777 GCAGTGGTGGTGGCGGTGGAGGG + Intronic
1034488510 7:151380935-151380957 TCACTGGTGCAGGAAGTGGATGG - Intronic
1034527727 7:151676236-151676258 TCTGAGGAGGGGGAGGGGGAGGG + Intronic
1034691394 7:153017249-153017271 CCAGAGGGAGAGGAGGAGGAAGG + Intergenic
1034718167 7:153262914-153262936 GCAGAAGAGGTGGAGGTGGAAGG - Intergenic
1034937611 7:155210031-155210053 TGGGAGGTGGGGGAGCTGGAGGG + Intergenic
1034954773 7:155327650-155327672 TCAGAGGTGGGGGTGGAGGTTGG - Intergenic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035201296 7:157268468-157268490 TCAGGGGAGGTGGAGGAGGAGGG + Exonic
1035564351 8:631270-631292 ACAGAGGTGGAGCAGGGGCACGG - Intronic
1035587112 8:785365-785387 TCAGAGGGGCATGAGGTGCAGGG - Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035958333 8:4108106-4108128 ACGGAGGAGGAGGAGGAGGAGGG + Intronic
1036145205 8:6248577-6248599 TCAGAGGTGGAGGGGGTGGTGGG - Intergenic
1036213880 8:6863503-6863525 GCAGAGGTGGGGAAGCTGGAGGG + Intergenic
1036236228 8:7041969-7041991 TATGAGGAGGAGGAGGAGGAGGG - Intergenic
1036459276 8:8937583-8937605 GAAGAGGTGGAAGAGGTGGAAGG + Intergenic
1036494118 8:9253792-9253814 GAAGAGTTGGAGGAAGTGGAAGG + Intergenic
1036678945 8:10856664-10856686 AGAGAGGTGGAGGTGGAGGAGGG + Intergenic
1037497012 8:19450118-19450140 GGAGAAGAGGAGGAGGTGGAGGG + Intronic
1037568858 8:20141615-20141637 GAAGAGGGGGAGGAGGAGGAGGG + Intergenic
1037593058 8:20329507-20329529 ACAGAGGCGGAAGAGGAGGAGGG + Intergenic
1037603962 8:20422102-20422124 TAGGGGCTGGAGGAGGTGGAGGG - Intergenic
1037613810 8:20498990-20499012 GAAGAGGTGAAGGAGGTGGAAGG - Intergenic
1037702088 8:21284510-21284532 GAAGAGGTAGAGGAGATGGAAGG + Intergenic
1038230647 8:25696286-25696308 TTTGGGGTGGAGGAGGTGGTGGG + Intergenic
1038234791 8:25742156-25742178 TCAGAGTTGGCGGGGGTGGGTGG + Intergenic
1038433561 8:27519065-27519087 TCAAAGGTGGAACAGGAGGATGG - Intronic
1038848599 8:31252704-31252726 ACAGAGGTGGAAGAGGGGGCAGG + Intergenic
1039809051 8:41028348-41028370 TGAGAGGTGCAGGAGGTAGAAGG - Intergenic
1040951373 8:52941148-52941170 GCCGAGGTGGAGGAAGAGGAGGG + Intergenic
1041151694 8:54942465-54942487 TCAGTTGTGGGGGAGGAGGATGG - Intergenic
1041300644 8:56407785-56407807 GCAGAGGGGGAAGGGGTGGAGGG + Intergenic
1041353474 8:56973952-56973974 TCTCGGGTGGAGGAGGTGGAAGG - Intronic
1041611331 8:59853314-59853336 AAAGAGGTGGAGGAGGTGAAAGG + Intergenic
1041625466 8:60020925-60020947 TGAGGGGTGGGGGAGGTGGAGGG - Intergenic
1041720834 8:60973864-60973886 TCCTGGGTGGGGGAGGTGGAGGG + Intergenic
1041823130 8:62062550-62062572 TCAGAGGTGGAGCAAGATGATGG + Intergenic
1042567521 8:70127547-70127569 TCAGAGGTGGAGGGTGGAGAGGG + Intronic
1043379527 8:79687700-79687722 GCAGAGGTGGAGGTGGAGGGTGG + Intergenic
1043423951 8:80130146-80130168 TGAGATGAAGAGGAGGTGGAGGG + Intronic
1043540013 8:81251135-81251157 GCAGAGGTGGAAGAGGTGTGAGG - Intergenic
1043650034 8:82579348-82579370 CCAGAGGTGGTGCATGTGGATGG - Intergenic
1043665007 8:82799371-82799393 ACACAGGTGGAGGAGGTGAAAGG + Intergenic
1044014202 8:87030933-87030955 GAAGAGGGGGAGGAGGGGGAAGG - Intronic
1044014375 8:87032583-87032605 GAAAAGGTGGAGGATGTGGAAGG + Intronic
1044106101 8:88209204-88209226 GAAGAGGTGCAGGAGGTGGAAGG - Intronic
1044642691 8:94401274-94401296 GAAGAGGTGGAGGAGATAGAAGG - Intronic
1044762031 8:95530064-95530086 GAAGAAGTGGAGAAGGTGGAAGG + Intergenic
1045165357 8:99598736-99598758 TAAGTGGAGGAGGAGGAGGAAGG - Intronic
1045218555 8:100174451-100174473 GAAGAGGTGGAGGAGATGAAAGG + Intronic
1045405016 8:101857216-101857238 ACAGAGTTGGAGGAGGAAGATGG - Intronic
1045832154 8:106475467-106475489 GAAGAGGTGGAGGAGGTGGAAGG + Intronic
1045981774 8:108198016-108198038 GAGGAAGTGGAGGAGGTGGAAGG - Intergenic
1046604379 8:116354592-116354614 TCTGATGTGGGGGAGGGGGAAGG - Intergenic
1047308190 8:123670214-123670236 TCAAAGGAGGAGGAGGAGGAAGG - Intergenic
1047322228 8:123797426-123797448 ACAGAGGCAGAAGAGGTGGAAGG - Intronic
1047414678 8:124654374-124654396 ACAGAGGTGGAGAGAGTGGATGG - Intronic
1047561840 8:125994358-125994380 TAAGAGGTGAAGGGGGTGGGGGG - Intergenic
1047695108 8:127395633-127395655 TCAGTGGTGGAGGAGGTTAAGGG - Intergenic
1048525141 8:135195778-135195800 TCACAGATGGTGGATGTGGACGG - Intergenic
1048651583 8:136484315-136484337 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1048863311 8:138739995-138740017 TCAGAGCTGGATCAGATGGATGG - Intronic
1048879371 8:138860064-138860086 TCAGAGGTGGGGTGGGTGAAGGG - Intronic
1048986018 8:139735444-139735466 ACAGAGGTAGAGGAGGGAGAAGG - Intronic
1049697261 8:143990353-143990375 CCAGAGGTGGCGGCGGTGGTGGG + Intronic
1049927257 9:421356-421378 TCAGTCATGGATGAGGTGGAAGG + Intronic
1049941397 9:549698-549720 TCAGAGGACGAGGAGGAGAAAGG - Exonic
1049973213 9:839343-839365 TCAGTGCTGTGGGAGGTGGAAGG + Intergenic
1049978303 9:881112-881134 GCACAGGAGGAGGAGGTGGGGGG - Intronic
1050033985 9:1415618-1415640 TGGGAGCAGGAGGAGGTGGAAGG + Intergenic
1050224261 9:3433246-3433268 GAAGAGGCGGAGGAGGTAGAAGG - Intronic
1050253703 9:3772264-3772286 TCGGAGGTGGAAGAGGAGGTGGG + Intergenic
1050299242 9:4240179-4240201 ACAGATGTGGGGGAGGTGGGGGG + Intronic
1050319591 9:4437687-4437709 GGAGAAGTGGAGGAGGTGGAAGG - Intergenic
1050744238 9:8858093-8858115 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1050796791 9:9556351-9556373 AAAGAGGTGGAGGAGGTAGAAGG + Intronic
1050835202 9:10068727-10068749 TCCAAGTTGGAGCAGGTGGAAGG + Intronic
1050957482 9:11683095-11683117 GCAGACATGGAGGAGGTAGAAGG - Intergenic
1051731175 9:20144592-20144614 TCAGAGGAGGAGGAGATGGATGG + Intergenic
1051796126 9:20872531-20872553 GCAGAAGAGGAGGAGGGGGAGGG - Intronic
1051930054 9:22374170-22374192 CCAGAGGGTGAGGGGGTGGAAGG + Intergenic
1052077327 9:24159238-24159260 TCATAGATAGAGGAGGTGGAGGG - Intergenic
1052205255 9:25831143-25831165 CAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1052431897 9:28377191-28377213 GAAGAGGTGGGGGAGGTGGAAGG - Intronic
1052500657 9:29285242-29285264 GCAGAGGTGGCAGAGGTGGGGGG + Intergenic
1052975334 9:34405939-34405961 TCAGAGATGGAGGCGGCGGCTGG + Exonic
1053095925 9:35328352-35328374 ATAGAGGTGGGAGAGGTGGAGGG - Intronic
1053173032 9:35904600-35904622 TGTGAGGAGGAGGAGGAGGAAGG - Intergenic
1053184947 9:36008175-36008197 GAAGAGGTGGAGGAGGTAAAAGG - Intergenic
1053724033 9:40978127-40978149 TTAGAAGTGGAGGAGGGTGAAGG + Intergenic
1054341932 9:63873872-63873894 TTAGAAGTGGAGGAGGGTGAAGG - Intergenic
1054785091 9:69202756-69202778 GAAGAGGTGGAGGAGGTGAAGGG + Intronic
1054991409 9:71331661-71331683 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1055107035 9:72523680-72523702 GTAGAGGTGCAGGAGGTGGAAGG + Intronic
1055416332 9:76087844-76087866 TCAGATGTGGAGGAAGAGGAGGG + Intronic
1055766772 9:79672025-79672047 GCAGAGGTGGTGGTGGGGGAGGG + Intronic
1056000177 9:82207137-82207159 TCAAAAATGGAGGTGGTGGAAGG - Intergenic
1056024213 9:82475732-82475754 GAAAAGATGGAGGAGGTGGAAGG + Intergenic
1056412044 9:86338954-86338976 TGAGAGGTGGGGGAGGAGGATGG + Intronic
1057482626 9:95457252-95457274 GCAGAGGTGGAGGGAGGGGAAGG + Intronic
1057556950 9:96095546-96095568 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1057677884 9:97149944-97149966 TGGGAGGTGGATGGGGTGGAAGG - Intergenic
1057802166 9:98197172-98197194 GGGGAGGTGGAGGAGGGGGAGGG + Intergenic
1058328554 9:103728576-103728598 GCAGTGGTGGTGGGGGTGGAAGG - Intergenic
1058453537 9:105118668-105118690 GAAGAGGTTGAGGAGGTGGGTGG + Intergenic
1058580200 9:106447540-106447562 AAAGAGGTGGAGAAGGTGGAAGG - Intergenic
1058665030 9:107305445-107305467 GCAGAGATGGAGGAGGTAGAAGG + Intronic
1059117238 9:111610604-111610626 TGGGAGGTTGAGGTGGTGGATGG + Intergenic
1059384164 9:113950975-113950997 TCTGAGGAGGAGGAGTGGGAGGG + Intronic
1059947356 9:119424125-119424147 GAACAGGTGGAGGAGTTGGAAGG + Intergenic
1060123933 9:121023899-121023921 ACAGAAGTGGAGGTGGGGGATGG + Intronic
1060416210 9:123432515-123432537 TCAGAGCAGGAGGAGCTGGAGGG + Intronic
1060434874 9:123584767-123584789 TCTGACGATGAGGAGGTGGATGG - Intronic
1060452395 9:123755493-123755515 GCTGAGGTGGAAGAGGAGGAAGG - Intronic
1060452416 9:123755609-123755631 GCAGAGGTGGAAGAGGTGGAAGG - Intronic
1060501113 9:124156580-124156602 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1060514016 9:124254718-124254740 TGAGGGATGGAGGAGGAGGAAGG + Intergenic
1060579486 9:124731570-124731592 AAAGAGGTAGAGGAGGTGAAAGG - Intronic
1060610952 9:124963937-124963959 GGAGAGGTGAAGGAGATGGAAGG + Intronic
1060759902 9:126238316-126238338 ACAAAGGAGGAGGAGTTGGAGGG + Intergenic
1060920308 9:127415966-127415988 AGAGAGGTGGGGGAGGGGGAAGG - Intergenic
1061204810 9:129156744-129156766 GAAGAGGAGGAGGAGGGGGAGGG - Intergenic
1061218256 9:129234553-129234575 GCACAGGTGGAGGATGTGGACGG - Intergenic
1061255997 9:129454366-129454388 TGGGTGGTGGAGGTGGTGGATGG + Intergenic
1061256016 9:129454414-129454436 TGGGTGGTGGAGGTGGTGGATGG + Intergenic
1061256094 9:129454635-129454657 GCGGAGGTGGAGGTGGTGGATGG + Intergenic
1062086028 9:134648952-134648974 ACGGAGGTCCAGGAGGTGGATGG + Intronic
1062255517 9:135619019-135619041 GCCAAGGTGAAGGAGGTGGAAGG - Intergenic
1062607529 9:137354873-137354895 GCAGAGGTGGAGGACGGTGAAGG - Intronic
1203770395 EBV:47213-47235 TCACAGGTGGAGGAGGTCCCAGG + Intergenic
1203582211 Un_KI270746v1:19448-19470 AAAAAGGTGGAGGAGGGGGAGGG - Intergenic
1185459858 X:328923-328945 AGAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185608470 X:1380517-1380539 GAAGAGGGGGAGGAGGGGGAAGG + Intronic
1185661959 X:1735285-1735307 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1185662053 X:1735650-1735672 AAAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185822248 X:3216831-3216853 TCAGACCTGGAGAAGATGGAAGG + Intergenic
1185940201 X:4309392-4309414 TTGGGGGTGGAGGAGGTGGTGGG + Intergenic
1186418485 X:9404419-9404441 TCAGAGGTAGAAGAGGTTGTTGG - Intergenic
1187061904 X:15794668-15794690 GAAGAGGTGGAGGAGGTAGAAGG + Intronic
1187102408 X:16207618-16207640 GAAGAGGTGGAGAAGGTGAAAGG + Intergenic
1187121642 X:16413441-16413463 GAAGAGGTGGAGGAGATGGAAGG - Intergenic
1187155037 X:16714027-16714049 CAAGAGGGTGAGGAGGTGGAGGG + Intergenic
1187342784 X:18436279-18436301 GAAGAGGTAGAGAAGGTGGAAGG + Intronic
1187670069 X:21658274-21658296 TCCGGGGTGGACGAGGAGGACGG + Exonic
1187736913 X:22314145-22314167 CCAGAGGAGGAGGAGGAGGGAGG + Intergenic
1187999780 X:24969806-24969828 TCAGAGGGGGCTGAGGTGGGAGG - Intronic
1188138253 X:26516356-26516378 GAAGAGGTAGAGAAGGTGGAAGG - Intergenic
1188303625 X:28535317-28535339 GAAGAGGAGGAGGAAGTGGAAGG - Intergenic
1189332977 X:40154413-40154435 ACAAAGGGGGAGGAGGGGGACGG - Intronic
1189546996 X:42051610-42051632 GGAGAGAGGGAGGAGGTGGAAGG - Intergenic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1189746090 X:44170427-44170449 TCAGAGGAGGAGGAGGAGGCAGG + Intronic
1189884825 X:45531673-45531695 GAAGAGGTGGAGGAGGAGAAAGG - Intergenic
1189916746 X:45863135-45863157 TCAGAATTGGGGGTGGTGGAGGG - Intergenic
1190072738 X:47292456-47292478 TTACAGGTGGAGAAGGAGGAGGG + Intergenic
1190119541 X:47649298-47649320 TAAGAGGTGGAGGACAGGGAAGG + Intronic
1190413053 X:50156120-50156142 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1190795029 X:53732998-53733020 GAAGAGTTGGAGGAGGTGGAAGG - Intergenic
1191039848 X:56067736-56067758 TTAGAAGTGTAGGAGGGGGACGG - Intergenic
1191104202 X:56762334-56762356 AGAGAGGAGGAGGAGGAGGAGGG - Intergenic
1191217945 X:57952450-57952472 CCAGAGGTGGAAGACGTGGCTGG + Intergenic
1191641646 X:63433643-63433665 TCAGAGGAGGAGGAGGAGGAGGG + Intergenic
1191705911 X:64094359-64094381 TTGGAGGTGGAGGAGGTGAGGGG + Intergenic
1191779974 X:64854460-64854482 ACAGGGGTGAAGGAGGTGGCAGG - Intergenic
1191805466 X:65130782-65130804 TCAGTGGGGGAGTAGGTGGGAGG + Intergenic
1192105990 X:68317460-68317482 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1192267153 X:69546818-69546840 TCAGAGGGGGCCGAGGTGGCAGG - Intergenic
1192273530 X:69607276-69607298 TCAGAGGTGTAGTGGGAGGAGGG + Intergenic
1192432714 X:71123291-71123313 CGAGAGATGGAGGTGGTGGAGGG + Intronic
1193448276 X:81633728-81633750 TCAGGGGTGGGGAAGGGGGAGGG - Intergenic
1193721996 X:84997957-84997979 TCAGAGGTGTGGGAGGTGGGAGG + Intergenic
1194033950 X:88847968-88847990 TCAGATGCGGAAGAGGAGGATGG - Intergenic
1194647253 X:96472733-96472755 TCAGGGGTGATGGAGCTGGAAGG - Intergenic
1194737196 X:97526599-97526621 TTAGAGATGGAGAAGGTAGAAGG - Intronic
1195392397 X:104376315-104376337 GCAGAGGTGGAAGAGGTTGAAGG - Intergenic
1195711696 X:107777860-107777882 TCAGAGGTGAAAGAGGTGCTGGG + Intronic
1195771234 X:108353641-108353663 TCAGTGGAGGAGGAGGTGGTGGG + Intronic
1195859231 X:109363494-109363516 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1196025048 X:111033315-111033337 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1196046548 X:111261793-111261815 GGTGAGGTGGAGGAGGTGGGAGG - Intronic
1196080913 X:111629996-111630018 TAAGAAGTGGAGGTGGTGGAAGG - Intergenic
1196230827 X:113219060-113219082 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1196631497 X:117945337-117945359 TCAGTAGTGGAGGAGGTTGTGGG - Intronic
1196964172 X:121037762-121037784 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1197006413 X:121507333-121507355 GCAGAGGTGGAAGAGGTAGAAGG - Intergenic
1197441521 X:126496413-126496435 GAAGAGGCGAAGGAGGTGGAAGG - Intergenic
1197792502 X:130269697-130269719 TCAGAGAAGGAGGAGGAGAAAGG - Intergenic
1198118584 X:133568736-133568758 TGAGAGGAGGAGTAAGTGGAAGG + Intronic
1198455990 X:136818303-136818325 GCTGAGGTGGAAGAGGTGGAAGG + Intergenic
1198538344 X:137609012-137609034 TGGGGGGTGGGGGAGGTGGAAGG + Intergenic
1198576521 X:138016156-138016178 GAAGAGGAGGAGGAGGAGGATGG - Intergenic
1199488364 X:148372452-148372474 TCAGAGGTGGAGCCGGTAGATGG + Intergenic
1199547221 X:149019011-149019033 CCAGAGGTGGAGGTTGTGGCAGG - Intergenic
1199690172 X:150303742-150303764 GCAAAGATGGAGGAGGGGGATGG - Intergenic
1199866248 X:151852661-151852683 TCAGAGGTGGGGGAGATTGGAGG - Intergenic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200360366 X:155598967-155598989 TCAGGAGTGGCAGAGGTGGAAGG - Intronic
1201266277 Y:12210275-12210297 ACAGATGAGGAGGAGGAGGAGGG + Intergenic
1201349121 Y:13019968-13019990 AGAGAGGTGGAGGAGAAGGAGGG - Intergenic
1201645540 Y:16225859-16225881 TCAATGGTGGCAGAGGTGGAAGG + Intergenic
1201657273 Y:16359455-16359477 TCAATGGTGGCAGAGGTGGAAGG - Intergenic
1201735805 Y:17260249-17260271 TCAGAGGTGGCAAAGGAGGAAGG + Intergenic
1202582432 Y:26395981-26396003 TGAGAGGTGGAGGCGGAGGCGGG + Intergenic