ID: 1119020566

View in Genome Browser
Species Human (GRCh38)
Location 14:71108658-71108680
Sequence CTGGCTGGCTACTGAGGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119020566_1119020573 16 Left 1119020566 14:71108658-71108680 CCCGGGCCTCAGTAGCCAGCCAG 0: 1
1: 0
2: 3
3: 36
4: 303
Right 1119020573 14:71108697-71108719 GCAGCCGGCATTCATCCCTCCGG 0: 1
1: 0
2: 1
3: 6
4: 87
1119020566_1119020575 30 Left 1119020566 14:71108658-71108680 CCCGGGCCTCAGTAGCCAGCCAG 0: 1
1: 0
2: 3
3: 36
4: 303
Right 1119020575 14:71108711-71108733 TCCCTCCGGATGTCCACCACTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1119020566_1119020571 1 Left 1119020566 14:71108658-71108680 CCCGGGCCTCAGTAGCCAGCCAG 0: 1
1: 0
2: 3
3: 36
4: 303
Right 1119020571 14:71108682-71108704 CTTCCTACTGCTATAGCAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119020566 Original CRISPR CTGGCTGGCTACTGAGGCCC GGG (reversed) Exonic
900101984 1:965915-965937 TGGGCTGGGTACTGAGGCCGAGG + Intergenic
900226130 1:1534406-1534428 CTGCCTGGCTCCTGCTGCCCCGG - Exonic
900321731 1:2087875-2087897 CTGCCTGGCTCCCGAGGGCCTGG - Intronic
900495376 1:2973738-2973760 CAGGCTGGCTTCTGAGGCTCTGG + Intergenic
901746412 1:11376746-11376768 CTGGCTTGCTCTTGAAGCCCTGG + Intergenic
902079927 1:13813881-13813903 CTGGCTGGCTAGAGAGGCCTGGG + Intronic
902135999 1:14306081-14306103 TTGGCTGGCTGTTGTGGCCCTGG + Intergenic
902360984 1:15942556-15942578 CACGCTGGCTACCGAGGCACTGG - Exonic
902542134 1:17163019-17163041 CAGGCTTGGTACAGAGGCCCCGG - Intergenic
902543904 1:17174170-17174192 CTGGGAGGCTAGTGTGGCCCAGG - Intergenic
902599612 1:17532085-17532107 CTGGCTGGAGACTGCGGGCCAGG - Intergenic
902875802 1:19340032-19340054 CTGGCTGGGGACTCAGGCCAGGG + Intronic
902882863 1:19384313-19384335 CCTGCTGGGTGCTGAGGCCCTGG - Intronic
903279784 1:22243949-22243971 CTCGCTGGCTCCTGGGGCACAGG + Intergenic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905335262 1:37240543-37240565 CTGGCTGGCTCCTGGGGGCGTGG - Intergenic
906215190 1:44034399-44034421 CTTCCTGGCTACTGAGGCTGGGG - Intergenic
907314595 1:53560373-53560395 CTGCCTGACTCGTGAGGCCCAGG - Intronic
907810349 1:57863605-57863627 ATGGCTGGGCACTGAGGCCAGGG + Intronic
907931571 1:59005760-59005782 CTGGCTGGCTGCTCAGGGCAGGG + Intergenic
908511550 1:64853728-64853750 GTGGGTGCCTACTGTGGCCCAGG - Intronic
910146517 1:84086309-84086331 CTGTCTGGCCCCTGGGGCCCAGG + Intronic
911105029 1:94122941-94122963 CTGGCTGGCTAGTGAGACGGTGG + Intergenic
914196563 1:145450904-145450926 ATGGCTGGGAACTGAGGGCCTGG + Intergenic
915229763 1:154436646-154436668 CTGGCTGGTGGCCGAGGCCCTGG + Intronic
917940968 1:179921130-179921152 CTGGCTGACAACAGTGGCCCAGG + Intronic
919463649 1:197907896-197907918 CAGGCTGGAGACTGATGCCCAGG - Intergenic
919765570 1:201125051-201125073 CTGGCTGGCTCCAGAGTCCCTGG - Intronic
920048389 1:203148565-203148587 CTGGCTGGCTAGGGGGGCCAAGG - Intronic
920377516 1:205517094-205517116 CTGTCTGGACACTGGGGCCCTGG + Intronic
920682585 1:208084235-208084257 CTGGCTGGCTCCTGCATCCCTGG + Intronic
922767458 1:228163366-228163388 CTGGCGGGGGACTGAGGCCCAGG + Intergenic
924482696 1:244451565-244451587 CTGCCTGGCTCCTGGTGCCCGGG - Intronic
1062868613 10:878672-878694 CTGGCTGCCTTCCTAGGCCCCGG - Intronic
1063426470 10:5953872-5953894 CTGCCTGGGTGCTGATGCCCTGG + Intronic
1067521903 10:47014010-47014032 TGGGCTGGCTGCTGTGGCCCAGG + Intergenic
1069703342 10:70441712-70441734 CGGGGCGGCTGCTGAGGCCCAGG - Intronic
1069728274 10:70595100-70595122 CTGGCATCCTACTGGGGCCCTGG - Intergenic
1069894344 10:71671340-71671362 CTGGCTGGCCTGTGAGACCCTGG + Intronic
1070384592 10:75913175-75913197 CTGGCTGGGTACAGTGGCTCAGG + Intronic
1071294827 10:84211887-84211909 TTGCCTGGCTCCTGAGGTCCTGG - Intronic
1071829690 10:89359501-89359523 CAGGCTGGCTGCTAAGGCCCTGG - Intronic
1071858176 10:89646365-89646387 CTGGCTGGCTACTGGGTTGCTGG + Intergenic
1073070199 10:100788448-100788470 CTGCCTGGCTTCCCAGGCCCTGG + Intronic
1073346376 10:102785896-102785918 CTGGCAGGCTACAGAGGCACTGG - Intronic
1073476479 10:103757001-103757023 CTGGATGGTTACTGAGACCAGGG - Intronic
1074523491 10:114245425-114245447 CTGGCAGGAGACTGAGGCTCAGG - Intronic
1074540956 10:114364825-114364847 CAGGCTGGCTACAGAGGGCCAGG + Intronic
1074942894 10:118252141-118252163 CTGGCTGCCTGCTGAGACCCAGG - Intergenic
1075080982 10:119383716-119383738 CAGGTTGGCTTCTGAGTCCCTGG + Intronic
1076239624 10:128894647-128894669 GTGTCTGGCTACTGAGTCCTGGG - Intergenic
1076377841 10:130003396-130003418 CAGGCTGGATTCTGAGGCCGGGG + Intergenic
1076739986 10:132478236-132478258 CTGGGTGGGTGCTGGGGCCCAGG + Intergenic
1076899019 10:133328032-133328054 CCAGCTGCCTACTGAGGCCATGG - Intronic
1078928716 11:15896771-15896793 CAGTCTGGCTCCTGAGGCCATGG - Intergenic
1081047676 11:38296413-38296435 CAGGGAGGCGACTGAGGCCCGGG + Intergenic
1081657642 11:44868057-44868079 CAGGCTGGCTTCTGAGGGCAGGG + Intronic
1081906735 11:46675053-46675075 CTGTCTGGCTCCTGGGGCCTGGG + Intergenic
1082270526 11:50164890-50164912 CTGGCTAGCTCCTGATGCCATGG + Intergenic
1082848329 11:57743969-57743991 CTGCCTGGCTTCTGAGGCTTAGG + Exonic
1083424316 11:62575291-62575313 GTGGCTGGCGACTGAGGCTCAGG - Exonic
1083676010 11:64325218-64325240 CTGGCTGGCTGCAGTGGCTCAGG + Intergenic
1084692975 11:70737647-70737669 CTGGCTGCCCACTGGGGCCTGGG - Intronic
1086965194 11:93020073-93020095 CTGGAGGGATACTGAGGCACAGG + Intergenic
1087177079 11:95105988-95106010 CTGCCTGGCTGCTGTGGCTCTGG - Intronic
1088752162 11:112853170-112853192 CTGACTTGATACTGAGGCCCGGG - Intergenic
1089074184 11:115724860-115724882 CTAGCTGGCTTCTGCTGCCCTGG + Intergenic
1089696970 11:120221903-120221925 CAGGCAGGCTCCTGAGGCTCAGG - Intronic
1090647506 11:128777627-128777649 CTGGCTGACTACTGGGTCCAGGG - Intronic
1091336109 11:134767460-134767482 CTGGCTGACTAAAGAGGCCTGGG + Intergenic
1091688153 12:2578364-2578386 CTGGCTGGTCCCTGAGGCTCTGG + Intronic
1091768326 12:3136296-3136318 CAGGCTGGCTCCAGAGTCCCGGG + Intronic
1094522355 12:31206191-31206213 CCAGCTGCCTACTGAGGCTCTGG - Intergenic
1097982004 12:65744456-65744478 CTGGCTGGCCCCGCAGGCCCCGG + Intergenic
1100120655 12:91365655-91365677 CAGGCTGGGTGCTGTGGCCCAGG - Intergenic
1102596466 12:113996541-113996563 TAGGCTGTCTACTGTGGCCCAGG + Intergenic
1102617021 12:114163628-114163650 CTGGCTGACTGCTGAGGACCTGG + Intergenic
1102958876 12:117078940-117078962 CTGGCTGAGTACTGTGTCCCAGG + Intronic
1103191663 12:119006879-119006901 CTGGCTGGAGACCGAGGCCAAGG + Intronic
1104988861 12:132613409-132613431 CTGGCTGGGTGCTGTGGCTCAGG + Intergenic
1106501625 13:30334853-30334875 CTGGCTGGCTCCCAAGGCACTGG + Intergenic
1106548695 13:30752724-30752746 CTGGCCAGCTTCTGTGGCCCTGG + Intronic
1108476200 13:50820444-50820466 CTGGTTGGCCACTAAGGCTCTGG - Intronic
1111964298 13:94845675-94845697 CAGCTTGGCTACTGAGGCCATGG - Intergenic
1112205319 13:97318668-97318690 CTGGCTGGATACTTAAGCTCTGG - Intronic
1113869407 13:113549018-113549040 CTGGCTTGTTACTGTGGCCCGGG + Intronic
1113885800 13:113657867-113657889 CTGGGAGGCAAGTGAGGCCCTGG + Intronic
1114248209 14:20934374-20934396 CTGGCAGACCACTGAGGCTCTGG + Intergenic
1114792219 14:25672373-25672395 CTGGCTTGCCCCTGAGCCCCGGG + Intergenic
1117999670 14:61511281-61511303 CTGGCAGGTGACTGTGGCCCAGG + Intronic
1118192753 14:63595027-63595049 CAGGGTGGCTGCTCAGGCCCAGG + Intergenic
1118493831 14:66288262-66288284 CGTGCTGGCCAGTGAGGCCCAGG + Intergenic
1119020566 14:71108658-71108680 CTGGCTGGCTACTGAGGCCCGGG - Exonic
1119325650 14:73758565-73758587 GAGGCTGGCCACGGAGGCCCCGG - Intronic
1120070877 14:80100801-80100823 CTGGCTGGAAACTGGGCCCCAGG - Intergenic
1121328133 14:93033731-93033753 CTCCCTGGTTCCTGAGGCCCTGG - Intronic
1122236235 14:100332149-100332171 CTGGCTGGGCCTTGAGGCCCAGG - Intergenic
1122248569 14:100422228-100422250 CTGGCTGTCTGCTGGGACCCTGG + Intronic
1122975830 14:105170369-105170391 CTGCCCGGCTCCAGAGGCCCAGG + Intergenic
1122985376 14:105209366-105209388 CAGGCTGGCTACTGAGCTCTGGG + Exonic
1124357147 15:29004123-29004145 CTGGAGGGAGACTGAGGCCCAGG + Intronic
1125717265 15:41826452-41826474 CTGGCTGGCTGCTGTGTGCCTGG + Exonic
1127971553 15:63966120-63966142 CCTGCTGACTACAGAGGCCCTGG - Intronic
1128232701 15:66046729-66046751 TTGGCTGGGTATTGAGGCTCAGG - Intronic
1128345950 15:66852543-66852565 CTGGCTGGCACCTGGGGCCCAGG - Intergenic
1128349608 15:66880179-66880201 CTGGCTGGGTAATGAGGTCTGGG + Intergenic
1128765141 15:70246797-70246819 CTTGCTGGCCACAAAGGCCCTGG + Intergenic
1129115409 15:73362875-73362897 CTGCCTGGCTAGAGAGGCCTCGG - Intronic
1129667692 15:77588588-77588610 CAGGCCGGTTACTGAGGTCCTGG + Intergenic
1129681537 15:77661140-77661162 CTGGCTGGCTCCTGAGGGCAAGG - Intronic
1130117089 15:81014673-81014695 CTGGGTGGCTTCCAAGGCCCTGG + Intronic
1130859803 15:87875796-87875818 CTGGGTCTCTACTGAGTCCCAGG - Intronic
1132588823 16:717563-717585 CTGGCGGGAGACTGAGGCTCAGG + Exonic
1132810363 16:1794099-1794121 ACGGCTGGCTACTCAGGCCAGGG - Intronic
1132847745 16:2008337-2008359 CTGGCTGGCAAGGCAGGCCCTGG + Intronic
1133138180 16:3726473-3726495 GTGGCTGGGAACTGTGGCCCAGG - Exonic
1133610729 16:7431047-7431069 CTGGCTTTCTACTAAGGCACAGG + Intronic
1133988303 16:10685001-10685023 CTGCCTGGCTAATGAGGCTCTGG + Intronic
1134607699 16:15583965-15583987 TTGGGTAGCTACTGAGGCTCAGG + Intronic
1136000666 16:27290307-27290329 CTGGCTGCCGACTTAGGCCATGG - Exonic
1136672340 16:31869911-31869933 CTGGCAGCCTACGGAGACCCTGG + Intergenic
1136991363 16:35153130-35153152 CTTGCTGGCTTTTGAGACCCAGG - Intergenic
1137668665 16:50266647-50266669 CTGGCCGGCTGCTGGGGCCGGGG + Intronic
1137692421 16:50438199-50438221 CTGGCTGGAGACCGTGGCCCTGG + Intergenic
1139280452 16:65765938-65765960 CTGGCAGGGTACGGAGGCTCAGG - Intergenic
1139355560 16:66365333-66365355 ATGGCTGGCATCTGAGGCCATGG - Intergenic
1139398646 16:66662034-66662056 CTTGCAGGCTGCTGGGGCCCTGG - Intronic
1140472849 16:75224852-75224874 CTGGCTGCCAACTGAGCCCGCGG + Exonic
1141760113 16:86022704-86022726 CTGGCTGGCTGCTGGGGCTCTGG + Intergenic
1141947065 16:87317642-87317664 CTTGCAGGCTACCGAGACCCTGG - Intronic
1142412392 16:89923335-89923357 CGGGCTGGCTGCTGAGGGTCGGG - Intronic
1142542873 17:674642-674664 CAAGCTGGCTAATGAGGCCATGG + Intronic
1143105759 17:4529981-4530003 CAGGCTGGGTTCTCAGGCCCCGG + Intronic
1143204722 17:5133727-5133749 TTGGCTTGCTACTGAGGCCAGGG - Intronic
1143282831 17:5767492-5767514 CAGCCTGGCTACTGAGGCAAAGG + Intergenic
1143727444 17:8859154-8859176 CTGGCTGTCTTCTGAGTTCCTGG + Intronic
1144338838 17:14296832-14296854 CTGGCTGGCTCCTGAAGGGCTGG - Intergenic
1145999650 17:29123418-29123440 CTGGCTGGGTCCTGACCCCCTGG + Intronic
1146280622 17:31541927-31541949 CAAGCTGGCTACAGAGGTCCTGG - Intergenic
1146456775 17:33014981-33015003 CTGGCTGGATCCTAAGGCTCCGG - Intronic
1149660505 17:58331992-58332014 GTGGCTGGGGACTGAGGCCCTGG - Intergenic
1150267470 17:63840861-63840883 CTGGCTGGCTGGTTAGGCCTGGG - Intronic
1151990442 17:77570848-77570870 CTGGCTGGTTCCACAGGCCCTGG + Intergenic
1152036994 17:77879706-77879728 CTGGCTGGGCCCTGCGGCCCTGG - Intergenic
1152073251 17:78144468-78144490 CTGGCTGGCTGCCCAGGCCCTGG - Intergenic
1152316316 17:79582688-79582710 GTGGGAGGCTACTGAAGCCCGGG + Intergenic
1152347645 17:79763225-79763247 CTGGCTGGCCACAGTGGCTCAGG + Intergenic
1152422497 17:80201688-80201710 CTGGCTGGATTCAGAGTCCCGGG + Intronic
1152609094 17:81306932-81306954 CTGGGCGGCTCCTGAGGCCCAGG - Intergenic
1152894286 17:82901681-82901703 CCGGCTGCCTACTGTGGTCCAGG + Intronic
1155172904 18:23280342-23280364 GTGGCTGGGTACTGAGGCTGAGG + Intronic
1160091639 18:75832816-75832838 CTAGTTGTCTCCTGAGGCCCTGG + Intergenic
1160995502 19:1880351-1880373 CTGGCTGGCCTCTGCAGCCCAGG - Intronic
1161156034 19:2732327-2732349 CCAGCTGGCTCCTGAGGCACAGG + Intronic
1162698484 19:12495756-12495778 CCGCGCGGCTACTGAGGCCCGGG + Intronic
1162950675 19:14070578-14070600 CTGGCTGGAAGCTCAGGCCCCGG + Intergenic
1162996466 19:14338969-14338991 CTTGCTGGCCTCTGAGGCTCTGG - Intergenic
1163353853 19:16796895-16796917 CTGGCTGGGTACGGTGGCTCAGG + Intronic
1165772851 19:38388715-38388737 CTGGCTGGCTCCGGCGGCGCTGG - Intronic
1165948579 19:39459669-39459691 CTGGCAGGCCACGGAGACCCGGG - Intronic
1166289606 19:41854029-41854051 CAGGCTGGGTACTGAAGGCCGGG - Intergenic
1166695783 19:44850947-44850969 CTGGCTGGCTCCCCAGGGCCTGG - Intronic
1166881486 19:45933135-45933157 CTGACTGGACACTGAGGCCCTGG + Intergenic
1167233179 19:48297882-48297904 CTGGCTGGCGGATGTGGCCCTGG - Intronic
1167348728 19:48962441-48962463 CTGGCTGGCGACTGAGAGGCTGG + Intergenic
926308736 2:11659292-11659314 CTGTCCAGCCACTGAGGCCCCGG + Intronic
928405848 2:31014308-31014330 CTGGATAGCTAGTGAGGCTCTGG + Intronic
930161063 2:48156352-48156374 CAGGCTGGCTACTGGGCCTCTGG - Intergenic
930247854 2:49003424-49003446 CTGGCTGACTTGTGAGTCCCTGG + Intronic
932141234 2:69280185-69280207 CTCACTGGCTCCTGAGCCCCAGG - Intergenic
932488894 2:72105816-72105838 CTGGGAGGCTACTGAGCTCCGGG + Intergenic
932493601 2:72136005-72136027 CTGGCTGCGTACAGTGGCCCTGG - Intronic
934766669 2:96883696-96883718 CAGCCAGGCTGCTGAGGCCCAGG + Intronic
935297891 2:101666309-101666331 GTGGCAGGCTACTGAGGAACAGG - Intergenic
937221801 2:120346248-120346270 CTGGCTGGGGCCTGAGGCCTGGG + Exonic
937274229 2:120673766-120673788 CTGCCTGGCTCCTCTGGCCCAGG + Intergenic
937478483 2:122236216-122236238 CTAGCTGGATGCTGAGGCCCTGG + Intergenic
937503618 2:122511471-122511493 CTGGGAGGCTACAGAGGACCAGG - Intergenic
938314246 2:130315264-130315286 CTGGCAGCCCACTGAGCCCCAGG + Intergenic
938876065 2:135532041-135532063 GTGGCTGGCTCCCGAGTCCCTGG - Intronic
941069581 2:160940828-160940850 CTTTCTGGCCATTGAGGCCCAGG + Intergenic
941156294 2:161982187-161982209 ATAGCCAGCTACTGAGGCCCTGG - Intronic
941925909 2:170894495-170894517 CTGGCTTGCTACTGCAGCCAAGG - Intergenic
942348421 2:175027887-175027909 CTGACTTGCTCCTGAAGCCCTGG + Intergenic
945029734 2:205652131-205652153 ACAGCTGGCTACTGAGACCCAGG + Intergenic
946230209 2:218286660-218286682 CTGTCTGCCTACTGAGGCCCCGG + Exonic
946283614 2:218685073-218685095 CTGTCTGGCTCCTGAGGCAGAGG - Exonic
946456809 2:219833084-219833106 CTGCCTGGCCCCTCAGGCCCAGG + Intergenic
947089667 2:226495879-226495901 CTGGCTGGCTACAGAGACTTGGG - Intergenic
947219969 2:227782471-227782493 ATGGTTGTCTACTGAGGCCAAGG + Intergenic
948327199 2:237134377-237134399 CTAGCTGGCTACAGAAGTCCAGG - Intergenic
948518820 2:238522964-238522986 CTGGTTGGCTTCTGTGGCACTGG - Intergenic
948689642 2:239693913-239693935 CTGGCTAGGTACAGAGGCTCAGG - Intergenic
1168888152 20:1274842-1274864 CTGGCTGCCTAATGAGGCTTTGG - Intronic
1170389653 20:15858307-15858329 ATGCCTCGCTATTGAGGCCCAGG - Intronic
1170460084 20:16569118-16569140 CTGGCTGTCTTCTGAGAGCCAGG - Intronic
1171181709 20:23095708-23095730 CAGGCTGGCTCCTGCAGCCCTGG + Intergenic
1172827257 20:37800009-37800031 CTGGCTGGCTAGTCTGACCCAGG + Intronic
1173241717 20:41302723-41302745 CTGGCAGGCCACTGACACCCAGG + Intronic
1173789286 20:45817339-45817361 CTGGCTGTCTCCCCAGGCCCTGG - Intergenic
1173847527 20:46197602-46197624 CTGGGTAGCAACTGAGGCTCTGG - Intronic
1174193624 20:48757655-48757677 CTGGCTGGATCCTGGGGGCCGGG - Intronic
1174304360 20:49604609-49604631 CTGGCTGACTACTGAGCCTCTGG + Intergenic
1175828681 20:61950746-61950768 CTGACTGGCTCCTGAGGCGGAGG - Intergenic
1176065347 20:63191376-63191398 CTGGCTTCCTGCTGTGGCCCAGG - Intergenic
1177324766 21:19570823-19570845 GTGGCTGCCTAATGAGGTCCAGG + Intergenic
1178074565 21:29002968-29002990 CTGGCTGCCTACAGACACCCGGG - Intergenic
1180950037 22:19716832-19716854 CAGGCTGGCATCTCAGGCCCAGG - Intronic
1181862117 22:25827133-25827155 TTGAGTGGCTACTGAGGGCCAGG + Intronic
1182775897 22:32830733-32830755 CTGGCTGGCTCCCCAGGCCTGGG - Intronic
1183303710 22:37070886-37070908 CTGCCTGGCTGCCGGGGCCCTGG - Intronic
1183384232 22:37505842-37505864 CTAGCTGGTCTCTGAGGCCCAGG + Intronic
1183438640 22:37810055-37810077 CAGGGTGGCTGCTCAGGCCCAGG - Exonic
1183980947 22:41539777-41539799 CTGGTTGGTTACTGGGGGCCTGG - Intronic
1184159296 22:42688428-42688450 CCGGCTGTCGCCTGAGGCCCTGG + Intergenic
1184495462 22:44838695-44838717 CTGGCTGGCTACTGTTCCCGGGG - Intronic
1184661579 22:45967876-45967898 CTGGCTGGAGCCTGAGGCCCTGG + Intronic
1185074511 22:48676118-48676140 GAGGCTGGCTGCTGTGGCCCAGG - Intronic
1203268311 22_KI270734v1_random:32077-32099 CTGCCTAGCTACTAATGCCCAGG + Intergenic
953879354 3:46683652-46683674 CTGGCAGGCTTCTGGGGACCTGG - Intronic
954369685 3:50163678-50163700 CTGGCTGGCCAAGGAGCCCCTGG - Intronic
960872291 3:122261911-122261933 CTGGCTGGCCAGCGAGGCCTGGG + Exonic
961216617 3:125165026-125165048 GTGGCTGGAGACTGAGGCCTGGG + Intronic
961524698 3:127489337-127489359 CTAGCTGACAACTGAGCCCCTGG + Intergenic
961651915 3:128421053-128421075 CACGCTGGCTCCTGGGGCCCAGG - Intergenic
961786055 3:129347600-129347622 CTGGCTGTCTAGTGCGGCACTGG + Intergenic
961824061 3:129589592-129589614 CTGGCTGGGATCTCAGGCCCTGG + Intronic
963046099 3:141103781-141103803 CTGCCTGGCTCCTGAGGGCTGGG - Intronic
963607399 3:147423005-147423027 CAGGCTGGCCACTAAGTCCCTGG + Intronic
966758142 3:183390644-183390666 GTGGCTGGGTACTGAGGCCGAGG + Intronic
967025600 3:185561351-185561373 CTTGCTGCCTACAGAGGCCTGGG + Intergenic
967882495 3:194311812-194311834 CTGGCAGGGAAATGAGGCCCAGG - Intergenic
968516917 4:1019366-1019388 CTGGCTGGCTACCTGGGCACAGG - Intronic
968522332 4:1039636-1039658 CTGGCCAGCTCCTGCGGCCCCGG - Intergenic
968904909 4:3446613-3446635 CTGGCTCCCTACTGAGAGCCAGG - Intronic
968977056 4:3827563-3827585 CTGGCTTGCTCCTGAGATCCAGG + Intergenic
969360266 4:6658834-6658856 CGGGCTGGGTGCTGGGGCCCGGG - Intergenic
972194584 4:36638242-36638264 TTGGCTGGCTCCTGAGGCCCAGG - Intergenic
976113166 4:81698805-81698827 CTGGCTGGCTCCTGGGGAACAGG - Intronic
978124769 4:105122546-105122568 GTGGCAGGCTACTGGAGCCCAGG + Intergenic
978191377 4:105916501-105916523 TTGGCTGGGTACAGTGGCCCAGG - Intronic
981760161 4:148185431-148185453 CTGGCTGGCTGATCAGGACCAGG - Intronic
983494507 4:168428014-168428036 AAGGCTGGCTCCTGGGGCCCAGG - Intronic
986329758 5:6709050-6709072 CTGGCTGGCAGCTGGGGCACTGG - Intergenic
987128720 5:14840746-14840768 CTGGCTTTCTAATGATGCCCAGG + Intronic
987518482 5:18947120-18947142 CTGGCTGGCTTGTGGGGCCCTGG - Intergenic
987760611 5:22158224-22158246 ATGGTGGGCTACTGAGGCCAGGG - Intronic
990004530 5:50930745-50930767 CTGGCTGGGTGCAGAGGCTCAGG + Intergenic
991895388 5:71391671-71391693 ATGGTGGGCTACTGAGGCCAGGG - Intergenic
991987787 5:72308031-72308053 CTGGCTGGCTGCTGAGAGCGCGG + Intronic
992694108 5:79267694-79267716 CTGGGTGGGCACTGTGGCCCAGG - Intronic
992774665 5:80078976-80078998 GTGAGTGGCAACTGAGGCCCTGG - Intronic
993074320 5:83208870-83208892 ATGGCTGCATACTAAGGCCCTGG + Intronic
993789189 5:92186028-92186050 CTGTCTGGCTTCGGAAGCCCAGG + Intergenic
997232384 5:132254304-132254326 CTGGCTGTTTGCTGAGGCCCTGG + Intronic
997558462 5:134822158-134822180 CTGGCTGGGCACGGTGGCCCAGG - Intronic
997591174 5:135073231-135073253 CTGGCTGGGTCCTGTTGCCCTGG + Intronic
998109234 5:139488282-139488304 CTTCCTAGGTACTGAGGCCCTGG - Intergenic
998467548 5:142357518-142357540 CTGGAGGGAAACTGAGGCCCAGG + Intergenic
998951430 5:147396289-147396311 CTGGCTGGCTCCACAGTCCCAGG - Intronic
999730473 5:154473497-154473519 CGGGCCGGGTACTGAGGCCGAGG + Intergenic
1002099667 5:176851114-176851136 CAGGCTGGCTACAGTGCCCCGGG - Intronic
1006113574 6:31763281-31763303 CAGACTGGCCACTGAGGACCTGG - Intronic
1006139707 6:31920911-31920933 CAGGGTGGCCTCTGAGGCCCAGG + Intronic
1006518323 6:34556741-34556763 CTGTCTGGCTACTCAGGCCAGGG + Intergenic
1006629392 6:35420301-35420323 GTGGCTGGCCACTGAGGCTGTGG + Intronic
1007362939 6:41371717-41371739 CTGCCCGGCTACTGCGGCCCGGG - Intergenic
1007472092 6:42097615-42097637 CTGGCTGGCTTCTGCCACCCTGG + Intergenic
1007722794 6:43895304-43895326 CTTGCTGGCCACCGAGGCCTTGG + Intergenic
1010175065 6:73018302-73018324 CTGCCTGGCTACAGTGACCCTGG - Intronic
1010794820 6:80106716-80106738 CCGGCTGGCTACTCAGGCTCAGG + Exonic
1011089286 6:83577559-83577581 CTAGCTTGCAACAGAGGCCCAGG - Intronic
1012103084 6:95116281-95116303 GTGGGTGGATACTGAAGCCCAGG + Intergenic
1013330308 6:109094566-109094588 CCGGCCGGCTGCTGAGGCGCTGG - Exonic
1013416891 6:109933616-109933638 CTGCCTGGCTGCAGAGGCTCAGG + Intergenic
1013538779 6:111087648-111087670 CTGGCGGGCTAACGAGGCCGAGG - Exonic
1013647133 6:112156171-112156193 CTGTCTCACTCCTGAGGCCCAGG - Intronic
1014107483 6:117583175-117583197 CTGGCTGGCTGCTTTGGCACTGG - Intronic
1017732211 6:157326665-157326687 GTGGCAGGCTTCTGAGGCTCTGG - Intergenic
1019172021 6:170138063-170138085 CTGGCAGGGAACTGAGGGCCAGG - Intergenic
1019547299 7:1584666-1584688 CGAGCTGGCTACAGATGCCCAGG - Intergenic
1020101605 7:5397149-5397171 CTGACTGGCCACCGAGGCCCCGG - Intronic
1022028214 7:26468099-26468121 AAGGCTGGCTGCTGAGGCCCGGG + Intergenic
1023866918 7:44242731-44242753 CTGCCTAGCTCCTGTGGCCCTGG + Intronic
1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG + Intronic
1025086151 7:56025102-56025124 ATGGCTGGGTACTGTGGCTCTGG - Intronic
1028439952 7:90848380-90848402 CTGGCTGGGCACTGTGGCTCAGG - Intronic
1028651799 7:93158198-93158220 CTGGCTATCTGCTGAGGGCCAGG + Intergenic
1029606870 7:101604501-101604523 CTGGCTGGCTGCCGGGGCCTAGG + Intergenic
1030266709 7:107629107-107629129 CAGGCTGGCTACAGAGCCACTGG - Intronic
1031221526 7:118972519-118972541 CTGGCTGGGCACTGTGGCTCAGG - Intergenic
1032021255 7:128408221-128408243 CCAGCTGGGTACTGAGGTCCAGG + Intronic
1033788536 7:144763335-144763357 CTGGCTGGCCACTGGGCCACTGG + Intronic
1034551698 7:151824773-151824795 CTGGCTTGCTGCTGAGGACGTGG + Intronic
1034957709 7:155344884-155344906 CAGGGCGGCTGCTGAGGCCCCGG + Intergenic
1035315877 7:157997432-157997454 CTGGCTGGCGCCTGGAGCCCAGG + Intronic
1037533484 8:19802632-19802654 CTGGCTGGCTGCTTTGGCGCTGG - Intergenic
1037876165 8:22549660-22549682 CTGCCTGTCTACTTAGGCCTGGG - Intronic
1038142796 8:24864906-24864928 CTGAGAGGCTACGGAGGCCCAGG - Intergenic
1038840934 8:31184062-31184084 GTGGCTGACTGCTGAGGTCCAGG - Intergenic
1039374041 8:37015306-37015328 CTGGGAGGCTACTGAGGGCTTGG + Intergenic
1039413377 8:37374241-37374263 CTGGCTGGGTGCTGAGAGCCTGG - Intergenic
1041030134 8:53728295-53728317 ATGGGTGGCTACTGAGCCCCAGG + Intronic
1041280027 8:56199635-56199657 CCGGCTGGCTCCAGAAGCCCCGG + Intronic
1041476869 8:58277058-58277080 CTGGAGGCCTACTGGGGCCCAGG + Intergenic
1042377106 8:68064403-68064425 CTGGCTGGGTACTCTAGCCCGGG - Intronic
1043215530 8:77582435-77582457 CTGGCAGGCTACTTAGGCTTAGG + Intergenic
1043558331 8:81460279-81460301 CTGGCTGGGTACAGTGGCTCAGG - Intronic
1045315591 8:101041039-101041061 CTTGCTGGCTCCTAAGACCCAGG + Intergenic
1046108213 8:109691557-109691579 CCGGCTGGCTGCAGAGGCCGAGG - Exonic
1047531327 8:125679488-125679510 CAAGCAGGCTACTGAGCCCCAGG - Intergenic
1049392849 8:142381064-142381086 CTGATTGGCTGCTGAGGCCTGGG - Intronic
1051637091 9:19190568-19190590 TTGGCTGGGTACTGTGGCTCAGG + Intergenic
1053351566 9:37416838-37416860 CTGGCTGTCAGCTGAGCCCCTGG - Intergenic
1053759903 9:41344465-41344487 CTAGGTGGATACTGAGCCCCAGG - Intergenic
1056687430 9:88778142-88778164 GTGGCTCGCTAGTGAGGCCCTGG + Intergenic
1057155752 9:92837466-92837488 CTGGCCGGAAACTCAGGCCCCGG - Intergenic
1057277677 9:93684636-93684658 CTGGCTGGACAGTGGGGCCCAGG - Intergenic
1057438688 9:95065521-95065543 CTGGCTTAGTAATGAGGCCCTGG - Intronic
1059418941 9:114179134-114179156 CTGGGTGCCTGGTGAGGCCCTGG + Intronic
1060062088 9:120469901-120469923 CTGGCTGGGTTCTCAGGCCTGGG + Intronic
1060675459 9:125510433-125510455 CTGGCTGCCTTCTGAGTCCATGG + Intronic
1060828958 9:126702013-126702035 GTGGCTGGCCACTGAGGCACGGG + Intergenic
1061517683 9:131098904-131098926 CTGTAGGGCTGCTGAGGCCCAGG + Intronic
1061617850 9:131792030-131792052 CTGGCTGGGCACTGAGGACACGG - Intergenic
1062100393 9:134724973-134724995 CCCGCTGGCTACTGTGGCTCTGG + Intronic
1062151371 9:135020904-135020926 CTGCTTGTCTACTGAGCCCCAGG + Intergenic
1062309827 9:135929712-135929734 CTGGCTGGGGACTGACTCCCAGG - Intergenic
1062565863 9:137163722-137163744 CTGGCCAGCAACTGAGGCTCTGG + Intronic
1062676197 9:137745923-137745945 GTGGCTGGCTGCTCAGCCCCAGG - Intronic
1062698169 9:137885930-137885952 ATGGCTGGGAACTGAGGGCCTGG - Intronic
1187226025 X:17375911-17375933 CGGGCTGGCTCCTCTGGCCCTGG - Exonic
1192170191 X:68849635-68849657 TTGGCTCTTTACTGAGGCCCAGG - Intergenic
1192368661 X:70495942-70495964 GTGGCTGTTTGCTGAGGCCCGGG - Intronic
1193177258 X:78409291-78409313 ATAAATGGCTACTGAGGCCCAGG - Intergenic
1194379902 X:93178923-93178945 CTGGATGGCTTCTGATGACCTGG + Intergenic
1195018773 X:100804930-100804952 ATGGCTGGATACTCAGGCTCAGG + Intergenic
1196680363 X:118463792-118463814 CAGGCTGGCTTCTTAGGCTCAGG + Intergenic
1198256120 X:134925742-134925764 CAGGCTGGCTCCGCAGGCCCGGG + Intergenic
1198504816 X:137290918-137290940 CTGGCTGGCCACTGGGGCCCAGG + Intergenic
1199863178 X:151820297-151820319 CAGGCTGGCCACTGTGGCCCAGG + Intergenic
1200232079 X:154449087-154449109 CTGTCTGGGGAGTGAGGCCCAGG + Intronic
1200250383 X:154550621-154550643 CTTGCTGGCTACTCCTGCCCAGG - Intronic