ID: 1119021992

View in Genome Browser
Species Human (GRCh38)
Location 14:71124015-71124037
Sequence CAGGATCACCAGGAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119021992_1119022002 0 Left 1119021992 14:71124015-71124037 CCCGCCTCCTCCTGGTGATCCTG No data
Right 1119022002 14:71124038-71124060 GTGGGTTACCCCTGCCATGGTGG No data
1119021992_1119022001 -3 Left 1119021992 14:71124015-71124037 CCCGCCTCCTCCTGGTGATCCTG No data
Right 1119022001 14:71124035-71124057 CTGGTGGGTTACCCCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119021992 Original CRISPR CAGGATCACCAGGAGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr