ID: 1119023888

View in Genome Browser
Species Human (GRCh38)
Location 14:71137439-71137461
Sequence ATGTACTGGCAGAAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119023888_1119023895 30 Left 1119023888 14:71137439-71137461 CCTCTCTGCTTCTGCCAGTACAT No data
Right 1119023895 14:71137492-71137514 ATAGTCTCCTTCTCCCTCAAGGG No data
1119023888_1119023894 29 Left 1119023888 14:71137439-71137461 CCTCTCTGCTTCTGCCAGTACAT No data
Right 1119023894 14:71137491-71137513 TATAGTCTCCTTCTCCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119023888 Original CRISPR ATGTACTGGCAGAAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr