ID: 1119028644

View in Genome Browser
Species Human (GRCh38)
Location 14:71174303-71174325
Sequence GTGTAGGCAGTTTTGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119028634_1119028644 0 Left 1119028634 14:71174280-71174302 CCCAGCCTGGCTCTGCCCTTGCC No data
Right 1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG No data
1119028633_1119028644 1 Left 1119028633 14:71174279-71174301 CCCCAGCCTGGCTCTGCCCTTGC No data
Right 1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG No data
1119028630_1119028644 20 Left 1119028630 14:71174260-71174282 CCGGAGTAGCATTCCATCTCCCC No data
Right 1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG No data
1119028636_1119028644 -5 Left 1119028636 14:71174285-71174307 CCTGGCTCTGCCCTTGCCGTGTA No data
Right 1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG No data
1119028635_1119028644 -1 Left 1119028635 14:71174281-71174303 CCAGCCTGGCTCTGCCCTTGCCG No data
Right 1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG No data
1119028632_1119028644 7 Left 1119028632 14:71174273-71174295 CCATCTCCCCAGCCTGGCTCTGC No data
Right 1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG No data
1119028629_1119028644 21 Left 1119028629 14:71174259-71174281 CCCGGAGTAGCATTCCATCTCCC No data
Right 1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119028644 Original CRISPR GTGTAGGCAGTTTTGGGGTT TGG Intergenic
No off target data available for this crispr