ID: 1119032009

View in Genome Browser
Species Human (GRCh38)
Location 14:71200142-71200164
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119032007_1119032009 -4 Left 1119032007 14:71200123-71200145 CCATGTGCCAGGTGGAGTGCAAG No data
Right 1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119032009 Original CRISPR CAAGATGCACAGATGCAGTA AGG Intergenic
No off target data available for this crispr