ID: 1119035944

View in Genome Browser
Species Human (GRCh38)
Location 14:71230920-71230942
Sequence CAGGGTGGGCACGATGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119035944_1119035956 27 Left 1119035944 14:71230920-71230942 CCAACTGCATCGTGCCCACCCTG No data
Right 1119035956 14:71230970-71230992 GCCCAGAGCCTCTACCGCCCTGG No data
1119035944_1119035952 5 Left 1119035944 14:71230920-71230942 CCAACTGCATCGTGCCCACCCTG No data
Right 1119035952 14:71230948-71230970 GCTAGGTGAGACCCACTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119035944 Original CRISPR CAGGGTGGGCACGATGCAGT TGG (reversed) Intergenic
No off target data available for this crispr