ID: 1119041197

View in Genome Browser
Species Human (GRCh38)
Location 14:71276282-71276304
Sequence GTTCTCAGTGGATAACACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119041197_1119041201 -7 Left 1119041197 14:71276282-71276304 CCTAAGTGTTATCCACTGAGAAC No data
Right 1119041201 14:71276298-71276320 TGAGAACATGGTGATCCAGAGGG No data
1119041197_1119041200 -8 Left 1119041197 14:71276282-71276304 CCTAAGTGTTATCCACTGAGAAC No data
Right 1119041200 14:71276297-71276319 CTGAGAACATGGTGATCCAGAGG No data
1119041197_1119041202 -6 Left 1119041197 14:71276282-71276304 CCTAAGTGTTATCCACTGAGAAC No data
Right 1119041202 14:71276299-71276321 GAGAACATGGTGATCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119041197 Original CRISPR GTTCTCAGTGGATAACACTT AGG (reversed) Intergenic
No off target data available for this crispr