ID: 1119046171

View in Genome Browser
Species Human (GRCh38)
Location 14:71320668-71320690
Sequence TACCGCATGGGGGAGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119046171_1119046192 29 Left 1119046171 14:71320668-71320690 CCTGTCCCCTCCCCCATGCGGTA 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1119046192 14:71320720-71320742 TCGCGCCCACCTTGGACCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34
1119046171_1119046190 21 Left 1119046171 14:71320668-71320690 CCTGTCCCCTCCCCCATGCGGTA 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1119046190 14:71320712-71320734 CGGCAACCTCGCGCCCACCTTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1119046171_1119046179 1 Left 1119046171 14:71320668-71320690 CCTGTCCCCTCCCCCATGCGGTA 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1119046179 14:71320692-71320714 GCACCTCCTCATCCCCCCCCCGG 0: 1
1: 0
2: 3
3: 33
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119046171 Original CRISPR TACCGCATGGGGGAGGGGAC AGG (reversed) Intronic
900702859 1:4058865-4058887 AACCACATGTGGGAGGGGCCTGG - Intergenic
901226343 1:7614893-7614915 TACTGCTGGGGGGAGGGTACAGG + Intronic
902141798 1:14362983-14363005 TACAGCATGGGCTAGGAGACAGG - Intergenic
906116295 1:43359327-43359349 GCCCGCATGGGTGAGGGGGCCGG - Exonic
907498751 1:54862757-54862779 TGAAACATGGGGGAGGGGACTGG - Intronic
907776627 1:57522255-57522277 GACTGCATGGGGAAGGGGAGGGG - Intronic
908512179 1:64858150-64858172 AACCTCATGGGGGTGGGAACTGG + Intronic
911601280 1:99850336-99850358 TACGGTCGGGGGGAGGGGACGGG - Intronic
912372488 1:109184777-109184799 TGCCCCATGGGGCGGGGGACGGG + Intronic
912381700 1:109251055-109251077 TACCGCCTGCTGGAGGGGTCTGG + Exonic
913665431 1:121043957-121043979 AACCTCATGGGGGTGGGGAGTGG - Intergenic
914016828 1:143827228-143827250 AACCTCATGGGGGTGGGGAGTGG - Intergenic
914160958 1:145133783-145133805 AACCTCATGGGGGTGGGGAGTGG + Intergenic
914655438 1:149735769-149735791 AACCTCATGGGGGTGGGGAGTGG - Intergenic
915518143 1:156425374-156425396 TAAGGGATGGGGGTGGGGACGGG - Intronic
915586999 1:156849308-156849330 TACCGACTGGAGGAGGTGACAGG - Exonic
919892137 1:201983090-201983112 TACCGCGTCGGGGAGGGACCCGG + Exonic
1063429442 10:5976787-5976809 GACCGGATGGGGGTGGGGAGTGG - Intronic
1065214791 10:23439237-23439259 CAGCGCAGGGGGGCGGGGACGGG - Intergenic
1067431543 10:46249081-46249103 TTCCCCCTGGGGGAGGGGCCTGG + Intergenic
1067800764 10:49357596-49357618 TTCCTCATGGGGTAGGGGAGGGG - Intergenic
1070587808 10:77779888-77779910 TGCCACATGGCTGAGGGGACAGG + Intergenic
1071486778 10:86107497-86107519 TACAGAATGGGGGAAGGGAAGGG + Intronic
1071997979 10:91164799-91164821 TGGCTCCTGGGGGAGGGGACAGG - Intronic
1072518521 10:96210175-96210197 TGCCCCATGGGGCAGGGGGCGGG - Intronic
1074527507 10:114275045-114275067 TGGAGCATGGAGGAGGGGACAGG + Intronic
1074785287 10:116834097-116834119 TGCTGAATGGGGGAGGGGCCTGG - Intergenic
1074971555 10:118543578-118543600 TGCAGAATGGGGAAGGGGACTGG + Intergenic
1076542416 10:131222752-131222774 AACCACATGTGAGAGGGGACAGG - Intronic
1084001952 11:66300678-66300700 CACCTCATGAGGGAGGGCACTGG + Intergenic
1084288403 11:68146494-68146516 TTCCGCAGGTGGGAGGGGTCTGG + Intergenic
1085043926 11:73342798-73342820 TGCCGCGTGGGGGAAGGGGCGGG + Intronic
1085274388 11:75289003-75289025 TACCGGCGGGGAGAGGGGACGGG + Intronic
1088354731 11:108931029-108931051 TACTGAATGGGGTAGGGGTCTGG - Intronic
1089365039 11:117916268-117916290 GACAGCATGGGGGAGAGGAAGGG - Intronic
1089432798 11:118436995-118437017 TCCCGGATGGGGGAGGGGAGGGG - Intronic
1090663954 11:128902503-128902525 GTCTGCATGGGGGAGGGGGCTGG + Exonic
1090733519 11:129591623-129591645 AACTGCATGGTGGAGGGGAGAGG + Intergenic
1092744329 12:11659512-11659534 TAACCCAAGGGAGAGGGGACAGG - Intronic
1094064013 12:26344012-26344034 CACCTCATGGGGGTGGGGATTGG + Intronic
1094653693 12:32400716-32400738 TACCGCATAAAGGAGGGGAGGGG - Intronic
1096498920 12:52053972-52053994 TTCCCCATGGGGGAGGGGCAGGG + Intronic
1097243239 12:57590849-57590871 TACCGAATGGGGGTTGGGAAGGG - Intergenic
1098768487 12:74520874-74520896 TACCTGTTGTGGGAGGGGACTGG - Intergenic
1101593589 12:106143179-106143201 TAGAGGTTGGGGGAGGGGACAGG + Intergenic
1107482331 13:40795127-40795149 TGTGGCATGGGGGAGGGGAGGGG - Intronic
1111877643 13:93916796-93916818 TGTGGCATGGGGGAGGGGAGGGG + Intronic
1114543649 14:23482653-23482675 TATCTAATGGGGGAGGGGAGGGG + Intronic
1114656334 14:24317944-24317966 TACAGAATGGGCGAGAGGACTGG - Exonic
1117487317 14:56211411-56211433 TACATGATGGGGGAGGGGAGTGG - Intronic
1117690348 14:58299200-58299222 ACCCGCGTGGGGGAGGGGGCGGG - Intronic
1119046171 14:71320668-71320690 TACCGCATGGGGGAGGGGACAGG - Intronic
1122414527 14:101542631-101542653 CACTGCAAGGGGGAGGGGAGGGG - Intergenic
1122630944 14:103107545-103107567 TACCACAAGGGGGAGGGCCCTGG + Intronic
1128914476 15:71547173-71547195 TCCCGGCTGGGGGAGGGGACAGG - Intronic
1129262970 15:74379117-74379139 TGCGACATGGGGGAGGGGAGAGG + Intergenic
1130135119 15:81176084-81176106 GACCGCATGGGAGATGGGGCTGG - Intronic
1131849505 15:96523952-96523974 TCCTGGATGGGGGAGGGGAGGGG + Intergenic
1132086007 15:98908815-98908837 TACCGCATGGAGGAAGTGACGGG + Exonic
1132550861 16:553322-553344 ACCTGCCTGGGGGAGGGGACCGG - Exonic
1132598345 16:763194-763216 GACAGCTTGGGGGAGGGGGCGGG - Intronic
1135712618 16:24730132-24730154 GGCCGGATGGGGGAGGGGAGAGG - Intronic
1135825430 16:25723126-25723148 TCCCTCATGGGGGAGGGACCCGG - Intronic
1136064030 16:27746803-27746825 GAGCGCAGAGGGGAGGGGACAGG + Intronic
1136381635 16:29898830-29898852 GAGCACATGGGGGAGGGGAGAGG - Intronic
1137366064 16:47860703-47860725 TTCAGCAAGGGGGAGGGGAAGGG + Intergenic
1141875575 16:86822031-86822053 TACTGCATGTAGGAGGGGCCAGG - Intergenic
1142198027 16:88747815-88747837 TACCGCAGGGGAGAGGGAGCAGG + Intronic
1142575216 17:902508-902530 CACCTTTTGGGGGAGGGGACAGG - Intronic
1142652200 17:1361668-1361690 TGCCGTTTGGGGGAGGGGAATGG + Intronic
1143400383 17:6639206-6639228 TGGCGTATGGGGGAGGGGACAGG - Intronic
1144705046 17:17362699-17362721 CAGGGCCTGGGGGAGGGGACAGG - Intergenic
1147446902 17:40480066-40480088 TCCAGCATGGGGCAGGGGAGGGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149650221 17:58271891-58271913 TCCTGCATGGGGGAGGGGACAGG + Exonic
1151366067 17:73617226-73617248 TCCCGCAGAGGGGAGGGGAGAGG + Intronic
1152404362 17:80087990-80088012 GCCTGCATGGGGGAGGGGGCGGG - Exonic
1152425829 17:80218170-80218192 AACCGCATGGGGCAGAGGGCAGG + Intronic
1152802914 17:82340099-82340121 GAGGGCATGGGGGAGGGTACTGG - Intergenic
1153931777 18:9885558-9885580 GTCTGCATGGGGGAGGGCACAGG + Intergenic
1160734481 19:656026-656048 CAGGGCCTGGGGGAGGGGACGGG + Intronic
1161558823 19:4959392-4959414 GACCACATGGGGGAGAGGCCTGG - Intronic
1161619643 19:5291329-5291351 TCCTGCATGGAGGAGGGGGCTGG + Intronic
1162030510 19:7915311-7915333 GTCCTCATGGGGGTGGGGACAGG + Intergenic
1163714814 19:18867536-18867558 TACCTCCTGGGGACGGGGACAGG - Exonic
1164601707 19:29567174-29567196 GATGGCATGGGGAAGGGGACAGG + Intergenic
1164636200 19:29793118-29793140 GACCGCAGAGGTGAGGGGACAGG + Intergenic
1165444199 19:35848045-35848067 TACCACATGAGGGAGGGCTCTGG + Exonic
1165795515 19:38517056-38517078 TACAGCAGGGGTGAGGGGAATGG + Intronic
1166039260 19:40192017-40192039 TCCTCCATGGGGGAGGGGCCGGG - Exonic
1166361092 19:42253409-42253431 TTCCGGCTGGGGGAGGGGAGGGG - Intronic
1167668000 19:50833790-50833812 TTCCTCAAGGGGGAGGGGACAGG + Intronic
1167710574 19:51108079-51108101 TGTGGCATGGGGGCGGGGACAGG + Intronic
930087753 2:47509963-47509985 GACAGCAAGGGGGAGGGGATTGG - Intronic
931640681 2:64378602-64378624 TACCTCCTGGGGGAGATGACTGG + Intergenic
932211635 2:69936326-69936348 CACCCCACGAGGGAGGGGACTGG + Intronic
940650414 2:156435872-156435894 GCCCGCATGGGCGAGGGCACAGG + Intronic
942268195 2:174248549-174248571 TGCCGCTCGGCGGAGGGGACGGG - Exonic
943374585 2:187060073-187060095 TATTGTATGGGGGATGGGACTGG + Intergenic
943474814 2:188341007-188341029 TACAGGATAGGGGATGGGACAGG + Intronic
945682472 2:212930732-212930754 CACCGCATGGGGGTGGGGGTGGG + Intergenic
1168999340 20:2155777-2155799 TCCTGCATGGGGGAGGGGGGAGG + Intronic
1175218288 20:57402919-57402941 AACCACATGGGGAAGGGGAAGGG - Intronic
1175874052 20:62221082-62221104 TAGCGCCTGTGGGAGGGGACGGG + Intergenic
1176151212 20:63591983-63592005 TACCGCCCAGGGGACGGGACGGG + Intronic
1178600186 21:33987929-33987951 AAGGGCATAGGGGAGGGGACAGG + Intergenic
1180564158 22:16649019-16649041 TGTGGCATGGGGGAGGGGAGGGG + Intergenic
1182871333 22:33650449-33650471 TACTCCATGGAGGAGGGCACTGG - Exonic
1183308568 22:37097222-37097244 TACCTCATGGAGGAGGAAACGGG + Intronic
1183414804 22:37676067-37676089 AGCTGCAGGGGGGAGGGGACAGG - Intronic
1184336857 22:43858916-43858938 GACTGCATGGAGGAGGAGACAGG - Intronic
1184960546 22:47925344-47925366 TCCAGGATGGGGGAGGAGACTGG + Intergenic
1185035884 22:48476719-48476741 TCCTGCCTGGGGGAGGGGTCAGG - Intergenic
953606210 3:44414950-44414972 CCCCGCATGGGGGAGGGGCTAGG - Intergenic
953913584 3:46904772-46904794 TAGGGCATAGGGGAGGGGTCAGG + Intergenic
954389980 3:50263671-50263693 TACAGCCTGGGGGAGGGTAAAGG + Intergenic
956539943 3:70325352-70325374 GCCCGCATGGGTGAGGTGACTGG - Intergenic
960254882 3:115501380-115501402 TACCATGTGGGGCAGGGGACAGG + Intergenic
961014794 3:123459256-123459278 TACAGCCTGGGGGAGGGAAATGG + Intergenic
961486746 3:127222210-127222232 CACCACATTGGGGTGGGGACTGG - Intergenic
962481644 3:135803215-135803237 TAGCGGAGGGGGAAGGGGACAGG - Intergenic
964708784 3:159648857-159648879 TCCTGTATGGGGGAGGGGAGTGG + Intronic
968500984 4:950004-950026 ATCCGCATGTGGGAGGGGACAGG - Intronic
973700697 4:53534143-53534165 TACCCCATGGAGAAGGGGGCAGG + Intronic
975565123 4:75746120-75746142 TACAGCAAGAGGGAGGGGACAGG - Intronic
976720939 4:88168060-88168082 GACAGCATCGGGGAGGGGGCAGG + Intronic
977642063 4:99368221-99368243 TACCGGCTGTGGCAGGGGACAGG - Intergenic
979453355 4:120899217-120899239 TACAGCATGGGGATGGGCACAGG - Intronic
984292101 4:177808405-177808427 GACAGAATGGGGGATGGGACAGG + Intronic
985953059 5:3237876-3237898 CACAGCATGGGGCAGGGGAGGGG + Intergenic
986311143 5:6551937-6551959 TTCAGCATGGGGGCGGGGGCGGG - Intergenic
986597198 5:9436317-9436339 TTCTCCATGGGGGAGGGAACGGG + Intronic
993137551 5:83989311-83989333 TAGCTCATGGGGGTGGGGGCAGG - Intronic
997013024 5:129902465-129902487 TACTGCAGGGGAGAGGGTACTGG + Intergenic
997762227 5:136460785-136460807 TCCCACATGGGCCAGGGGACTGG + Intergenic
998143405 5:139712120-139712142 TGCCGCAGGGGGGTGGGGATGGG + Intergenic
1001257174 5:170192944-170192966 CACCGCCTGGTGGAAGGGACAGG + Intergenic
1001959731 5:175872651-175872673 AGACGCATGGGGGAGGGGAGGGG - Intronic
1002021379 5:176366127-176366149 GACCGCAGGCGGGAGGGGATGGG - Intronic
1002534758 5:179870046-179870068 GACTGCATGAGGGAGGGGAGCGG + Intronic
1005587288 6:27288951-27288973 CACCGGATGGGGGAGGGGAGTGG + Intronic
1005659231 6:27977587-27977609 TGCAGCCTGGGGGAGTGGACTGG + Intergenic
1005782455 6:29206937-29206959 TAGGGGATGGGGGAGGGGAATGG - Intergenic
1007056661 6:38892612-38892634 TACTGCATGGTCCAGGGGACAGG - Intronic
1007231838 6:40353707-40353729 TAAGGCATGGGGCAGGGAACTGG - Intergenic
1007363284 6:41373395-41373417 GACCGCTGGGGGGAGGGGGCAGG - Intergenic
1018581249 6:165310106-165310128 TATTGTATGGGGGATGGGACTGG - Intergenic
1020016883 7:4836413-4836435 TACCGCATGGCGTCGGGGCCGGG + Exonic
1022411151 7:30139649-30139671 TTCTGCATGGTGGAGAGGACAGG - Intronic
1024705904 7:51959428-51959450 CACCGCATGGGGTTGGGGAAAGG + Intergenic
1026844416 7:73689955-73689977 TACAGCAGGGCGGAGGGGAAGGG + Intronic
1026923791 7:74174749-74174771 TACCGTAGGGGGGATGGGGCTGG - Intronic
1027129547 7:75581353-75581375 TAGAGCGTGGGGGAGGGGACAGG - Intronic
1028985649 7:97006505-97006527 GGCCGCCTGGGGGAGGGGGCCGG - Intronic
1029496474 7:100897544-100897566 CTGTGCATGGGGGAGGGGACAGG + Intergenic
1029670790 7:102029328-102029350 GAACACATGGGGGAAGGGACAGG + Intronic
1032456611 7:132077809-132077831 TACGGCATGGGCTAGGTGACAGG - Intergenic
1034255646 7:149723281-149723303 GACAGCATGGTGGAGGGGCCGGG + Intronic
1034859702 7:154584525-154584547 AACCGCATGGGGGTGGGGGACGG - Intronic
1035167820 7:157002280-157002302 CACCGGATGAGGGAAGGGACAGG + Intronic
1035247823 7:157576478-157576500 CGCCGCAGGGGGGAGGGGAAGGG - Intronic
1037768117 8:21784128-21784150 TGCCTCAGGAGGGAGGGGACAGG + Intronic
1038311550 8:26449453-26449475 TACGGGGTGGGGGAGGGGAGAGG + Intronic
1040051914 8:43023481-43023503 TCCAGCCTGGGGGAGGGGAGGGG - Exonic
1041461771 8:58119366-58119388 CCTCGCATGGGGGAAGGGACAGG + Intronic
1047053147 8:121135917-121135939 TACCGCATAGAGGAGCAGACAGG + Intergenic
1050132773 9:2429681-2429703 TACCACATGAGGGAGGGAGCAGG + Intergenic
1054929358 9:70619850-70619872 TACCTCATGGGGAAGTTGACAGG + Intronic
1056481549 9:87011766-87011788 GCCCGCATGGGTGAGGGGGCCGG - Intergenic
1057605330 9:96494762-96494784 GACGGGAGGGGGGAGGGGACGGG - Intronic
1061564932 9:131432319-131432341 TACAACATGGGTGAGGAGACAGG - Intronic
1062044165 9:134417540-134417562 TAGCCCATGGGGCAGGGGCCAGG + Intronic
1062561931 9:137145590-137145612 GTCCCCATGGGGGTGGGGACAGG + Intronic
1185475535 X:413403-413425 TCCAGGATGGGGGAGCGGACAGG - Intergenic
1187199039 X:17117236-17117258 TCCCGCATGAGGCAGGGGACTGG - Intronic
1192584595 X:72309129-72309151 GTCCGGATGGGGGAGGGGGCTGG - Intergenic
1196358015 X:114817676-114817698 TACTGGATGGGGGAAGGGAAGGG + Intronic
1196409036 X:115396493-115396515 GGCCCCATGGGGGATGGGACAGG + Intergenic