ID: 1119046377

View in Genome Browser
Species Human (GRCh38)
Location 14:71321276-71321298
Sequence GCCCGGAGCAGGACCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 243}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119046372_1119046377 -5 Left 1119046372 14:71321258-71321280 CCGGGGTTGGGGTCCAGGGCCCG 0: 1
1: 0
2: 7
3: 28
4: 325
Right 1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 243
1119046360_1119046377 13 Left 1119046360 14:71321240-71321262 CCCCTGCCCTGTTTCTGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 223
Right 1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 243
1119046362_1119046377 12 Left 1119046362 14:71321241-71321263 CCCTGCCCTGTTTCTGGCCGGGG 0: 1
1: 0
2: 0
3: 13
4: 267
Right 1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 243
1119046364_1119046377 11 Left 1119046364 14:71321242-71321264 CCTGCCCTGTTTCTGGCCGGGGT 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 243
1119046366_1119046377 7 Left 1119046366 14:71321246-71321268 CCCTGTTTCTGGCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 17
4: 155
Right 1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 243
1119046368_1119046377 6 Left 1119046368 14:71321247-71321269 CCTGTTTCTGGCCGGGGTTGGGG 0: 1
1: 0
2: 1
3: 37
4: 435
Right 1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 243
1119046358_1119046377 14 Left 1119046358 14:71321239-71321261 CCCCCTGCCCTGTTTCTGGCCGG 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119046377 Original CRISPR GCCCGGAGCAGGACCCCAGG AGG Intronic
900166700 1:1246863-1246885 GGCTGGAGCGGGACCCCGGGGGG - Intergenic
900329341 1:2126331-2126353 GCCCCGACCACGACCCCAGCCGG - Intronic
900605830 1:3523148-3523170 GCCCGGAGCAGGGCCCAAGCCGG - Intronic
900796739 1:4712594-4712616 CCCCGGAGAAGGATCCCAGGTGG + Exonic
901018676 1:6245314-6245336 GGCCGGAGCAGGAGCCCAGACGG - Exonic
901055403 1:6446777-6446799 GGCTCCAGCAGGACCCCAGGGGG - Intronic
901478212 1:9505367-9505389 GCCAAGAGCAAGAGCCCAGGAGG + Intergenic
901628308 1:10635862-10635884 TCCCTGAGCTGGACTCCAGGTGG - Intergenic
901681363 1:10914676-10914698 GCCCGTGGTAGGACCCCCGGAGG - Intergenic
902479540 1:16704417-16704439 GCCTTGAGCTGCACCCCAGGGGG + Intergenic
902810159 1:18883514-18883536 GCACTGAGCCGGGCCCCAGGAGG + Intronic
902840395 1:19070529-19070551 GCCCGGAGCAGGAGCCGGGCAGG + Intergenic
903101527 1:21035006-21035028 GCCTGGAGCCCCACCCCAGGTGG + Intronic
903174635 1:21573645-21573667 GACCTGAGGAGGACGCCAGGAGG - Exonic
903846321 1:26281549-26281571 GCCCAGGGCAGGGACCCAGGAGG - Intronic
904436653 1:30503005-30503027 GCAGGAAGCAGGAGCCCAGGTGG - Intergenic
906156155 1:43615237-43615259 GTGTGGAGCAGGGCCCCAGGGGG - Intronic
906745010 1:48215419-48215441 GGTGGGGGCAGGACCCCAGGTGG + Intergenic
907233694 1:53025194-53025216 GCCGGGAGCAAGATTCCAGGAGG - Intronic
908125207 1:61023703-61023725 ACTCGGAGCAGGACTCCAGCAGG + Intronic
912729870 1:112092738-112092760 TCCCGGATCAGGACCCCACATGG - Intergenic
916802895 1:168231106-168231128 GCCTGGTGGAGGATCCCAGGTGG + Intronic
919939510 1:202276546-202276568 GCCCCCAGCAGGACCCCACTGGG - Intronic
921163217 1:212487477-212487499 CCCCAGGGCATGACCCCAGGGGG - Intergenic
922440617 1:225652925-225652947 GCGCGGAGCTGGTCCCCAGGCGG + Exonic
1062834570 10:627229-627251 GCCCGGGGCATGACGCCTGGAGG - Intronic
1063666312 10:8062731-8062753 GCCCAGAGGAGGACCCCGGAGGG - Intronic
1063759696 10:9058813-9058835 AGCCTCAGCAGGACCCCAGGAGG - Intergenic
1066653209 10:37678986-37679008 GCTCTGAGAAGTACCCCAGGAGG - Intergenic
1067094884 10:43293914-43293936 GCCCAGAGCAAGACCCTGGGGGG - Intergenic
1068541038 10:58295188-58295210 TCCCGAAACAGGACCCAAGGAGG + Intergenic
1069978924 10:72238659-72238681 GCCCAGGGCAGGAGCCCATGAGG - Intergenic
1070409010 10:76122207-76122229 ACCAGGAGCAGCATCCCAGGAGG + Intronic
1072654339 10:97319772-97319794 GCGCAGCGCAGGACCCCAGGGGG - Exonic
1072656589 10:97334355-97334377 GCCCGCAGCGGCACCCCCGGGGG + Exonic
1075266237 10:121001504-121001526 TCCCAGAGCAGGAGCCCAGGAGG - Intergenic
1075725361 10:124608142-124608164 GCTCCAAGCAGGACCCTAGGGGG - Intronic
1077066287 11:642357-642379 GCCTGGCGCAGGAAGCCAGGTGG + Intergenic
1077323231 11:1951815-1951837 GCCCGGAGCAGGGAGCCATGTGG + Intronic
1081538638 11:44014269-44014291 GCCCGCAGCTGGACCTCAAGGGG - Intergenic
1081662098 11:44894535-44894557 GCACGGAGCAGGGGCCCAGGAGG - Intronic
1083744875 11:64729901-64729923 GCCCCGGGCAGAACCACAGGAGG + Intronic
1083899726 11:65637878-65637900 GCCGGGAGCTGGACGCTAGGTGG + Intronic
1084178633 11:67435916-67435938 GCCCAGAGCAGGTCCCCGTGCGG - Exonic
1084189566 11:67492894-67492916 GCCAGGAACAGGACCCCACCAGG - Intronic
1084518074 11:69647065-69647087 GCCGGGAGCCGGGCCCCAGGAGG - Intronic
1084578993 11:70010727-70010749 GCAGGGACCAGGACCCCTGGTGG - Intergenic
1088114971 11:106303332-106303354 TCGCTGAGCAGGACCCCTGGTGG - Intergenic
1090799034 11:130159540-130159562 TCCCGGGGCAGGGCCCCTGGAGG + Exonic
1202806217 11_KI270721v1_random:7010-7032 GCCCGGAGCAGGGAGCCATGTGG + Intergenic
1092261016 12:6953383-6953405 GAGAGGAGCAGGGCCCCAGGAGG + Intronic
1092672330 12:10877947-10877969 GCCAGGAGCAGGACTGCAGCAGG + Intronic
1096499208 12:52055091-52055113 GCCCGGAGCGGGGCCCCAGGTGG + Exonic
1102472166 12:113165498-113165520 ACCCCCAGCAGGACCCCAGCAGG - Intronic
1103621427 12:122189604-122189626 GACTGGGGCGGGACCCCAGGAGG - Intronic
1104709381 12:130974795-130974817 GTCCGGAGCAGGGCCACAGCAGG - Intronic
1104870826 12:131994292-131994314 GCCCCCTGCAGGCCCCCAGGTGG + Intronic
1104883068 12:132085163-132085185 GTCAGGAGCAGGACCCGCGGAGG - Intronic
1104982116 12:132577744-132577766 GCCTGGCACAGGCCCCCAGGAGG + Intronic
1105837513 13:24224032-24224054 GCACTGAGCAGGACAGCAGGCGG + Exonic
1106762503 13:32880897-32880919 GCCCAGAGCTGGTCCCCATGGGG - Intergenic
1108204660 13:48075413-48075435 GCCTGGAGCAGGACCAAGGGCGG + Intronic
1113246408 13:108401754-108401776 ACAGGGAGCAGGACCCCAGAGGG + Intergenic
1114516293 14:23302116-23302138 GACTGGAGGAGGTCCCCAGGAGG + Intronic
1117392017 14:55271519-55271541 GGCCGGGGCAGGAGCGCAGGTGG + Exonic
1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG + Intronic
1121272763 14:92649128-92649150 GCCCAGCCGAGGACCCCAGGAGG + Intronic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1122157080 14:99756171-99756193 CCCCAGAGAAGGACCCCAGGAGG + Intronic
1122319557 14:100845594-100845616 GCCCGGAGCACACCGCCAGGCGG + Intergenic
1123067504 14:105626018-105626040 TCCTGGAGCAGGGCGCCAGGGGG + Intergenic
1123071520 14:105644742-105644764 TCCTGGAGCAGGGCGCCAGGGGG + Intergenic
1123096954 14:105771358-105771380 TCCTGGAGCAGGGCGCCAGGGGG + Intergenic
1123399896 15:19973858-19973880 CCCCAGAGCAGGAGCGCAGGAGG - Intergenic
1124962403 15:34408811-34408833 GCCCAGAGCAGCAGCCCACGGGG + Intronic
1124979027 15:34555033-34555055 GCCCAGAGCAGCAGCCCACGGGG + Intronic
1125535897 15:40441122-40441144 GCCCGGCCCCGGCCCCCAGGAGG + Intronic
1125594167 15:40873802-40873824 GACTGGAGCAGGCCCCGAGGTGG - Intronic
1126100353 15:45114948-45114970 TCCTGGAGAAGGACCCCAGCTGG + Intronic
1127117499 15:55742873-55742895 GCGCGGAGCAGCATCCCCGGCGG + Exonic
1128061720 15:64739575-64739597 ACCAAGAGCAGGCCCCCAGGTGG - Intergenic
1128247510 15:66143310-66143332 GCCCTGAGCAGCACCTCCGGTGG + Intronic
1128661115 15:69501719-69501741 GCACAGAGCAGGACCCTCGGAGG - Intergenic
1130680946 15:85996226-85996248 GCCAGGGGGAGGACCCCAGGAGG - Intergenic
1131282764 15:91034279-91034301 GCCCCCAGCAGGACCCTTGGAGG - Intergenic
1132342916 15:101089202-101089224 CCCCGCAGCCGGCCCCCAGGCGG - Intergenic
1132694862 16:1197471-1197493 GACAGGAGCAGATCCCCAGGAGG - Intronic
1132858674 16:2058943-2058965 CCCCGCAGCAGGACCCCCAGTGG - Intronic
1133765100 16:8832457-8832479 GCCCCCAGCAGGACCACGGGAGG + Intronic
1137617605 16:49856656-49856678 GCCCGGCGCCGGCCCCCCGGAGG + Intronic
1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG + Intronic
1138584940 16:57963441-57963463 GCTCAGAGCAGGACAGCAGGAGG - Intronic
1139295343 16:65895632-65895654 GACAGGTGCAGGAGCCCAGGTGG - Intergenic
1139954165 16:70685477-70685499 GCTCGGGTCAGGACCCCACGGGG + Intronic
1143358202 17:6346721-6346743 GCCTGGGGCAGGACACCAGGAGG + Intergenic
1144207391 17:12988736-12988758 GCTGGGAGCAGCACTCCAGGAGG - Intronic
1147238076 17:39072197-39072219 GCCAGGAGAAGAACCACAGGAGG + Intronic
1148357176 17:46983214-46983236 GTCAGGAGCAGGACCCCATCTGG + Intronic
1148867295 17:50635153-50635175 GCCCGGAGCCGGGTCCCACGCGG + Intronic
1152123419 17:78432646-78432668 GTCCTGAGAAGGCCCCCAGGAGG - Intronic
1152587993 17:81197598-81197620 GCCCGCACCTGGCCCCCAGGGGG - Intronic
1152751694 17:82065381-82065403 GCCCTGAGCAGGCCGCCCGGCGG + Exonic
1153137307 18:1930597-1930619 CACAGGAGCAGGACACCAGGAGG + Intergenic
1154001396 18:10485312-10485334 GCCCGGAGCATGATTCCAGTTGG + Intronic
1155081839 18:22418223-22418245 GCCTTGTGCATGACCCCAGGTGG + Intergenic
1157722015 18:49932352-49932374 GCCTGGAGCTGGTCCCCAGAAGG + Intronic
1158696817 18:59710808-59710830 ACCCGGAGCTGGAAGCCAGGAGG - Intergenic
1158945507 18:62443976-62443998 ACACTGAGCAGGAGCCCAGGGGG + Intergenic
1159946734 18:74449545-74449567 CCCCGCAGCAGGAAGCCAGGGGG - Intronic
1160588594 18:79927241-79927263 GGGCTCAGCAGGACCCCAGGCGG + Intronic
1160748592 19:723056-723078 ACCCGGAGCAGCCTCCCAGGCGG + Intronic
1161625229 19:5322578-5322600 GCCCGCAGAAAGACCTCAGGCGG + Intronic
1161982300 19:7636495-7636517 GCCAGGAGCCTGTCCCCAGGGGG - Intronic
1162717711 19:12644341-12644363 GCCAGCAGAAGGACCACAGGTGG - Intronic
1164649145 19:29879569-29879591 GCCCGGAGCAGGACTCCGCAGGG - Intergenic
1164850243 19:31477249-31477271 CCCAGAAGCAGGACCACAGGGGG - Intergenic
1165324136 19:35104424-35104446 GGCAGGAGCAGGGGCCCAGGAGG + Intergenic
1165858690 19:38895190-38895212 GGCTGGGGCAGGACCCCCGGAGG - Intronic
1166126331 19:40717264-40717286 GCCCGGCGCAGGGGCCCCGGCGG + Exonic
1167643812 19:50695369-50695391 GCCCGGCGCAGGACGCCAAGGGG - Intronic
1202713577 1_KI270714v1_random:30323-30345 GCCTTGAGCTGCACCCCAGGGGG + Intergenic
926095800 2:10080130-10080152 GCCCGGAGCGGCAGCCCTGGAGG - Exonic
927394022 2:22628687-22628709 GCCCGCACCAAGACCCCAGGAGG + Intergenic
927567094 2:24123165-24123187 TCCCCGAGCAGGACCCAAGGCGG + Exonic
927789679 2:26000587-26000609 GCTGGGAGCAGGTCCCCAGTTGG + Intergenic
927808987 2:26171751-26171773 GCCCCGAGCTGGAGTCCAGGGGG + Intergenic
927883386 2:26704410-26704432 GCCCGGAGCAGAAATCAAGGAGG - Intronic
927917237 2:26945044-26945066 ACCCCGAGCAGAGCCCCAGGTGG - Intronic
929509780 2:42557497-42557519 GCACTGAGCAGGACACCTGGAGG - Intronic
931256543 2:60579115-60579137 GCCAGGAGCAGCACCCCTGAAGG + Intergenic
934714936 2:96537807-96537829 GCGCGGTGCAGGACCCCCGAGGG + Intronic
935655829 2:105421987-105422009 GCACGCAACAGGACCCCAGGAGG - Intronic
936021547 2:108998834-108998856 GCCTGGCTCAGGCCCCCAGGTGG + Intergenic
936512221 2:113157507-113157529 GGCCGGAGCAGGAGCCCGGCGGG + Intronic
937368372 2:121281294-121281316 GTCAGGAGCAGAGCCCCAGGGGG + Intronic
938400557 2:130987448-130987470 GCATGGAACAGGACCCAAGGGGG + Intronic
942190053 2:173460467-173460489 GGCCGAGGCAGGAGCCCAGGAGG + Intergenic
942611160 2:177743980-177744002 GCCCCCAGGTGGACCCCAGGTGG - Intronic
944596268 2:201264446-201264468 ACCCTGGGCAAGACCCCAGGTGG - Intronic
946405187 2:219488670-219488692 GCCTGGGGCAGGGCCCCAGGGGG + Intronic
946470922 2:219960334-219960356 TCCCAGAGCAGGAACCCAGGCGG + Intergenic
947834051 2:233162802-233162824 GCCCGGGCCAGTGCCCCAGGGGG + Intronic
947962121 2:234248089-234248111 TCCCGCACCAGGACCGCAGGCGG - Intergenic
948036869 2:234864767-234864789 GCCCGGGACAGGAAGCCAGGTGG + Intergenic
948453512 2:238093226-238093248 GGCAGCAGCAGGCCCCCAGGAGG - Intronic
948612997 2:239181342-239181364 GCCAGGAGCAGCACCCCTGCTGG - Intronic
948696643 2:239736270-239736292 GCCCGGAGCTGGCTCCAAGGAGG + Intergenic
1168997677 20:2145166-2145188 GCTCAGAGCAGCAGCCCAGGGGG - Exonic
1172550616 20:35796524-35796546 GCCATGGTCAGGACCCCAGGAGG + Intronic
1172796512 20:37543136-37543158 GGCAGAAGCAGGAGCCCAGGCGG + Intergenic
1173540682 20:43848562-43848584 GCTGGGAGCAGGGTCCCAGGAGG + Intergenic
1174340558 20:49892533-49892555 GCCCCGAGCAGGAGGTCAGGCGG - Intergenic
1175829491 20:61954348-61954370 GCCTGGAGCTGGAGCCCAGGAGG + Intronic
1176044141 20:63083733-63083755 GCCCGGACCAGGGCTTCAGGGGG + Intergenic
1179504020 21:41828137-41828159 GCCCGCAGCAGGTGCGCAGGCGG + Intronic
1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG + Intronic
1179988375 21:44933117-44933139 GGGCGGGGCAGGAGCCCAGGTGG + Intronic
1179992562 21:44955930-44955952 GCCGGGAGCAGCACCCAAGTCGG + Intronic
1180149204 21:45939129-45939151 GCCCGGCACAGGGCACCAGGAGG - Intronic
1182096761 22:27630864-27630886 GGCCTGAGCAGGCCTCCAGGTGG - Intergenic
1182283969 22:29233235-29233257 CCCTGGAGCAGGTGCCCAGGTGG + Intronic
1182549052 22:31091255-31091277 CCCAGGAGGAGGGCCCCAGGGGG + Exonic
1183512359 22:38243637-38243659 GCCCTGAGCAGGTCCCCATCTGG + Intronic
1183596538 22:38815940-38815962 GCCTGGAGCAGCTCCCCAGCAGG + Intergenic
1183655007 22:39179546-39179568 GACCGGAGCAGGAGCCGGGGAGG + Intergenic
1183918658 22:41145711-41145733 ACCCGGGGCATGACCCCGGGAGG - Intronic
1184616375 22:45641008-45641030 GCCCAGAGCAGGAGCCCCTGAGG + Intergenic
1185032653 22:48452859-48452881 ACCAGGGGCTGGACCCCAGGTGG - Intergenic
1185148218 22:49150583-49150605 GCCCTGAGGAGGGCCCCAGGTGG + Intergenic
1185230463 22:49677546-49677568 CCCCTGAGCAGGACCCTGGGAGG + Intergenic
950168812 3:10822223-10822245 GCACGGAGCAGGAGCCCGGCTGG - Intronic
952878754 3:37969856-37969878 GCCAGAAGCAGGAGCTCAGGAGG - Intronic
954435008 3:50491307-50491329 GCTCGGAGGAGGACGGCAGGAGG + Intronic
961356392 3:126342486-126342508 GACCGGGGCTGGACCCCAAGGGG + Intergenic
962827655 3:139111719-139111741 GGCTGTAGCAGGACCCCAGGGGG + Intronic
963746554 3:149129965-149129987 GCCTCAAGCTGGACCCCAGGCGG - Intronic
964674154 3:159258838-159258860 GCCCCCAGCCTGACCCCAGGTGG + Intronic
966182131 3:177197310-177197332 GCGCGGCGCGGGTCCCCAGGTGG + Intronic
967980030 3:195060172-195060194 GCACGCAGCAGGAATCCAGGAGG + Intergenic
968467710 4:760844-760866 GCCTTGAGCAGGGCCACAGGCGG - Intronic
968519982 4:1030829-1030851 GCCTTGGGCAGGAGCCCAGGTGG + Intergenic
968607903 4:1544151-1544173 TCCCGGAGTAGGACCTCAGTGGG + Intergenic
968642455 4:1721433-1721455 GCCGGGGGCAGGACCGCAGGAGG - Intergenic
968658435 4:1788539-1788561 GGCTGGGGCAGGAGCCCAGGGGG + Intergenic
969306673 4:6329795-6329817 GCCAGGATCTGGACCCCAGGTGG - Intronic
969478712 4:7435434-7435456 GCCAGGGGCAGAACCCCAGCTGG - Intronic
970319620 4:14862653-14862675 TCCCGGAGGAGGAGCCCAGGAGG + Intergenic
971920477 4:32933060-32933082 GCCCTCAGCAGGACCCGAGTTGG - Intergenic
978105901 4:104901577-104901599 GCCTGGAGGAAGCCCCCAGGTGG - Intergenic
978617328 4:110610857-110610879 GCCCGGGGTGGGATCCCAGGAGG - Intergenic
982441356 4:155440073-155440095 GCGCGGAACAGGACCCCAGCGGG - Intergenic
984758588 4:183345097-183345119 TCCCAGAGCAGGAGGCCAGGAGG - Intergenic
985656059 5:1131845-1131867 GCCAGGAGCAGCTTCCCAGGTGG + Intergenic
985771521 5:1814860-1814882 CCCCGGAGCGAGGCCCCAGGAGG - Intronic
986253280 5:6080691-6080713 GCCAGGAGCAGGCTCCCAAGGGG + Intergenic
996585143 5:125079239-125079261 GACAGGAGGAGGAGCCCAGGTGG - Intergenic
997424862 5:133796264-133796286 ACCAGGTGCAGGAGCCCAGGTGG + Intergenic
997518275 5:134506138-134506160 GCCCGGGGCAGAAGCCCTGGGGG - Intergenic
998131242 5:139652055-139652077 GCCCCAATCAGGGCCCCAGGGGG - Intronic
998139100 5:139689970-139689992 GCCCAGACCTGGCCCCCAGGAGG - Intergenic
999318677 5:150600313-150600335 GCCCAGAGCAGCACTCCAGTGGG + Intergenic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002044466 5:176534143-176534165 GCCCTGAGCTGGACACAAGGTGG - Intronic
1002196240 5:177503155-177503177 GCCAGGAGCAGGAGCAGAGGAGG + Intronic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1003218251 6:4135202-4135224 GCCCGGAGTCCGGCCCCAGGAGG + Intronic
1003393836 6:5736194-5736216 GCCCTGTGGAGGAGCCCAGGTGG - Intronic
1003409523 6:5850608-5850630 CCACGGAGCTGGATCCCAGGTGG - Intergenic
1004216645 6:13710789-13710811 ACCCGGAGCAGCACAACAGGCGG + Intronic
1004503585 6:16229785-16229807 TCCCAGACCAAGACCCCAGGGGG - Intergenic
1004586509 6:17006681-17006703 GCCAGCAGCAGGAACCCAGTCGG - Intergenic
1006300113 6:33189442-33189464 GCCCGGAGCACATCCACAGGGGG + Exonic
1006515221 6:34541837-34541859 CCCCAGAGCAGCACCCCAGGGGG - Intronic
1007363729 6:41375678-41375700 GCCCGGAGCGGGAGCCGGGGCGG + Intergenic
1007746839 6:44048218-44048240 TCCTGGGGCAGGAACCCAGGGGG + Intergenic
1008686174 6:53928480-53928502 GCCAGGAGGAGGAGCTCAGGCGG - Intergenic
1012466357 6:99520990-99521012 GCCTGGAGCAGGGCGCCAGGAGG + Intronic
1015162085 6:130164664-130164686 GATAGGAGCAGGACCCAAGGTGG - Intronic
1015997856 6:139013481-139013503 GCCCTGAGCAAGTCCACAGGTGG + Intergenic
1016354597 6:143204414-143204436 TCCCAGAGCAGTACTCCAGGAGG + Intronic
1017957402 6:159190036-159190058 GCCCCTATCAGGACCCCAGAAGG - Intronic
1018010132 6:159662267-159662289 GCATGGAAAAGGACCCCAGGGGG - Intergenic
1018253007 6:161891182-161891204 TTCCGGAGGCGGACCCCAGGGGG + Intronic
1018635677 6:165857273-165857295 ACCCGGACCTGAACCCCAGGAGG + Intronic
1019341817 7:512092-512114 GCCCAGACCAGGACTCCAGGAGG + Intronic
1019360681 7:602761-602783 GCCAAGAGCAGAACCCCAGGAGG + Intronic
1019516381 7:1442018-1442040 GAGCGCACCAGGACCCCAGGAGG + Intronic
1019643398 7:2116497-2116519 GTCCCCAGCAAGACCCCAGGTGG + Intronic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1024225179 7:47321070-47321092 GCCTGAGGCAGGACTCCAGGAGG + Intronic
1024253180 7:47521497-47521519 GCCCTCAGCTGGAGCCCAGGAGG - Intronic
1025246106 7:57318675-57318697 GGCCGAGGCAGGAGCCCAGGAGG + Intergenic
1025738458 7:64175161-64175183 GCAGGGAGCAGGTCCCCAGAGGG + Intronic
1026545181 7:71316179-71316201 CCACAGATCAGGACCCCAGGCGG - Intronic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1032151589 7:129434297-129434319 GGCCGGAGCGGGACTCGAGGAGG - Intronic
1033683677 7:143620570-143620592 GCCCGCAGCACGGCCCGAGGTGG + Intergenic
1033684135 7:143623288-143623310 GGGAGGAGCAGGACCCCAGGAGG - Intronic
1033687311 7:143702507-143702529 GGGAGGAGCAGGACCCCAGGAGG - Intronic
1033700477 7:143834335-143834357 GGGAGGAGCAGGACCCCAGGAGG + Intergenic
1033700935 7:143837068-143837090 GCCCGCAGCACGGCCCGAGGTGG - Intergenic
1034400297 7:150857448-150857470 GCCCGGAGGAGGAGCGCAGCCGG - Exonic
1035025755 7:155824365-155824387 GCCTGGAGGAGGACTCCAGAGGG - Intergenic
1035611082 8:964863-964885 CCCCGGAGCATGGCCACAGGCGG - Intergenic
1037186001 8:16064522-16064544 GCAAGGAGCAAGGCCCCAGGTGG + Intergenic
1037930952 8:22880112-22880134 GCCCTGGGCAGAGCCCCAGGCGG - Intronic
1040059645 8:43093432-43093454 GGCCGGAGGAGGACGCCAGGGGG + Intergenic
1040474452 8:47764317-47764339 GCCGGGAGCTGGATCCCAAGCGG + Intergenic
1048291171 8:133182877-133182899 CCCCGGCCCAGGCCCCCAGGTGG + Intergenic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049225777 8:141449868-141449890 GCCCTGAGCTGGACCCTAGTGGG + Intergenic
1049251466 8:141591383-141591405 GCCCTGTGTGGGACCCCAGGCGG + Intergenic
1049522736 8:143102628-143102650 GCCTGGGGCTGGACCCAAGGTGG + Intergenic
1049545080 8:143226819-143226841 ACACTGGGCAGGACCCCAGGCGG - Intergenic
1053153155 9:35755691-35755713 GCCAGGAGGAGGAGCTCAGGCGG + Exonic
1053458900 9:38253246-38253268 GTCCGGATCCAGACCCCAGGAGG - Intergenic
1054787183 9:69221101-69221123 GCCGGGAGCGGGACCTCAGCCGG + Exonic
1056796564 9:89662711-89662733 GCCCGGTAGAGTACCCCAGGTGG - Intergenic
1057310478 9:93939965-93939987 GCACGGAGCAGGACCAGAGCAGG - Intergenic
1057942910 9:99300362-99300384 GCCAGGAGGAGGAAGCCAGGTGG - Intergenic
1058422801 9:104848865-104848887 GCCCTGAGTAGGACCCAAGATGG + Intronic
1058851024 9:109012820-109012842 GCCGGGAGGAATACCCCAGGCGG + Intronic
1060044490 9:120328893-120328915 CCCCCAACCAGGACCCCAGGTGG + Intergenic
1060236017 9:121863100-121863122 ATACGGAGCAGGAGCCCAGGAGG - Intronic
1060700563 9:125746830-125746852 GCCCGGAGGAGGGCCCCGGCGGG - Intergenic
1060871271 9:127042320-127042342 ACCCGGAGCATAACCCCAGTGGG - Intronic
1061235917 9:129342612-129342634 GCCAGGTTCCGGACCCCAGGAGG - Intergenic
1062448336 9:136605005-136605027 GGCCTGGGCAGGCCCCCAGGCGG - Intergenic
1186389555 X:9144908-9144930 GCGCTGAGCAGGACACCAAGCGG - Intronic
1187915579 X:24149913-24149935 GCGCCGAGCAGGCCCCGAGGAGG + Intronic
1188529291 X:31121052-31121074 TCCCGGAGCCGGAAGCCAGGAGG - Exonic
1192191774 X:68995500-68995522 GCAGGTAGCAGGACCCCAGTGGG - Intergenic
1195246570 X:103000726-103000748 GCCAGGAACAGCATCCCAGGTGG + Intergenic
1197958792 X:131981168-131981190 GCCCCCAGCAGGACGCCAGCAGG - Intergenic
1201354444 Y:13082646-13082668 CCCCGTAGCAGGACCTCAGTGGG + Intergenic