ID: 1119046462

View in Genome Browser
Species Human (GRCh38)
Location 14:71321629-71321651
Sequence TGTCCCCAAGACCCCCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119046462_1119046469 12 Left 1119046462 14:71321629-71321651 CCCCTTTGGGGGTCTTGGGGACA 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1119046469 14:71321664-71321686 ATGCTCTAACCTGCTTTCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 83
1119046462_1119046467 10 Left 1119046462 14:71321629-71321651 CCCCTTTGGGGGTCTTGGGGACA 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1119046467 14:71321662-71321684 GGATGCTCTAACCTGCTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 108
1119046462_1119046468 11 Left 1119046462 14:71321629-71321651 CCCCTTTGGGGGTCTTGGGGACA 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1119046468 14:71321663-71321685 GATGCTCTAACCTGCTTTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119046462 Original CRISPR TGTCCCCAAGACCCCCAAAG GGG (reversed) Intronic
900124498 1:1063424-1063446 TGTCCCCAGGGCCCTCACAGGGG - Intergenic
900519214 1:3097650-3097672 TGAGGCCAAGACCCCCAGAGGGG - Intronic
900647325 1:3714845-3714867 TGTCCCCAAGGCCCCAGATGGGG + Intronic
900652519 1:3736927-3736949 TGTCCCCACGTCCACCAAGGAGG + Intergenic
900862305 1:5242364-5242386 TTTGCCCAAGGCCTCCAAAGTGG - Intergenic
902731240 1:18370321-18370343 TTTGCCAAAGACCCCCAAGGCGG + Intronic
906260352 1:44383014-44383036 TGTTCCCAAGAGCCTCAGAGAGG - Intergenic
906556557 1:46718846-46718868 TGTCCCCAAGGCCCAGACAGCGG - Exonic
910763514 1:90758377-90758399 TGTGCCCAACACACCCTAAGAGG + Intergenic
914337739 1:146731009-146731031 TTTCCTAAGGACCCCCAAAGTGG + Intergenic
914383421 1:147142178-147142200 TGTCCCCAAGAACACAAAATGGG - Intergenic
915055968 1:153130922-153130944 TGTGGCCAAGCCCCCCAAACAGG + Intergenic
916003721 1:160640193-160640215 TGACCCCAAGACCTACAAACAGG + Intronic
920374850 1:205502736-205502758 GGTCCTGAAGACCCCCAACGTGG - Intergenic
921435873 1:215121245-215121267 GGTCCTCAAGACCCCCTCAGAGG + Intronic
921769872 1:219023016-219023038 TATATCTAAGACCCCCAAAGTGG + Intergenic
922993624 1:229938758-229938780 TTTCCCCAAGACCAGGAAAGGGG + Intergenic
924035251 1:239929888-239929910 GGTCAACAAGACCTCCAAAGAGG + Intergenic
924659825 1:246006179-246006201 GGTCCCCCAAAGCCCCAAAGTGG + Intronic
1066150025 10:32606417-32606439 TGTCCTCCAGACCCCCAAAATGG + Intronic
1067454857 10:46412160-46412182 TGTCCCCAAGCCCACCAGAGTGG + Intergenic
1067632346 10:47972474-47972496 TGTCCCCAAGCCCACCAGAGTGG - Intergenic
1067682187 10:48448215-48448237 TGACCCCAAGACCCCTGTAGTGG - Intronic
1067780889 10:49206468-49206490 TTTCCCAAAGACCACCCAAGTGG + Intergenic
1071149873 10:82621318-82621340 TGTCTCCAAGACCCCCATACTGG - Intronic
1071238563 10:83678400-83678422 TGTCCCCAAAGCCCCCACTGTGG + Intergenic
1075337290 10:121617609-121617631 TGCCCCCAACACCCCAAAAGAGG + Intergenic
1077362151 11:2145503-2145525 TGTCCCCAGCACCCCCAAAGAGG - Intronic
1077895567 11:6450910-6450932 TGGCCCCACGGCCCCCAAAACGG + Exonic
1078643337 11:13115915-13115937 ATTCCCTAAGACCCCCACAGAGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1080796527 11:35568471-35568493 CTTCCCCAAGACCACCAAGGTGG + Intergenic
1081375811 11:42356999-42357021 TGTCCCCAGGACCCAGAAGGTGG + Intergenic
1084606387 11:70174775-70174797 TATACCGAAGACCCCAAAAGGGG + Intronic
1086220226 11:84433919-84433941 TTTCCCCATGTTCCCCAAAGTGG - Intronic
1087334368 11:96824729-96824751 ACTCCCCAAGGCCCCCAGAGAGG - Intergenic
1088252048 11:107869514-107869536 ATTCCCCAAAACCCCCAAAAAGG + Intronic
1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG + Intronic
1089336384 11:117726716-117726738 GGACCCCATGATCCCCAAAGAGG + Intronic
1089671068 11:120057427-120057449 TTTACCCAAGACCACAAAAGCGG + Intergenic
1089848853 11:121479982-121480004 GGTCCCCAGGACTCCCAGAGAGG + Intronic
1090065126 11:123497179-123497201 GTTCTCCAAGACCACCAAAGTGG - Intergenic
1095379121 12:41568093-41568115 TGTCCCCAAGCTTCCCAAACTGG - Intronic
1096180099 12:49546012-49546034 TGTCTCCACCACCCCCAAAGTGG + Intronic
1096589988 12:52651758-52651780 GGCCCCCAAAACCTCCAAAGCGG + Exonic
1098341859 12:69459868-69459890 TGTTTTCAAGACCCCCAAAATGG + Intergenic
1098856901 12:75663281-75663303 TGGCATCAAGACCCACAAAGTGG + Intergenic
1099402455 12:82216458-82216480 TGACCCCAAAACCCCAGAAGGGG - Intergenic
1105666977 13:22570713-22570735 TTTCCCTAATACCCTCAAAGTGG - Intergenic
1113232114 13:108223738-108223760 GGTCCCCAAGACCCTCTAATGGG - Intronic
1113698723 13:112366866-112366888 TGTTCCCATGCCACCCAAAGAGG - Intergenic
1114639508 14:24209924-24209946 TGTCCTCAAAGCTCCCAAAGTGG - Exonic
1115621477 14:35144758-35144780 TATCCCCAAGACCCTCTCAGGGG - Intronic
1118543662 14:66859393-66859415 TTTAACCAAGACCACCAAAGTGG + Intronic
1118752480 14:68816896-68816918 CGTCACCCAGACCCCCAAAAGGG - Intergenic
1119046462 14:71321629-71321651 TGTCCCCAAGACCCCCAAAGGGG - Intronic
1119220355 14:72901398-72901420 TGCCTCAAAGGCCCCCAAAGAGG + Intergenic
1121631162 14:95422847-95422869 TGTCCCCAAGACTCCCAGGAAGG + Intronic
1121925639 14:97924840-97924862 TTTCCCCCAGACCCCAAAGGTGG - Intergenic
1122255448 14:100472677-100472699 TGCCCCCAAGACCCACGCAGGGG - Intronic
1122400773 14:101466088-101466110 GGACACAAAGACCCCCAAAGTGG + Intergenic
1122797247 14:104212240-104212262 TCTCCCAGAGGCCCCCAAAGGGG - Intergenic
1125348076 15:38740072-38740094 AGTCCCTAAGACCCACAAAAGGG + Intergenic
1128244049 15:66120832-66120854 TATCCCCAAGCCCCGCAATGGGG + Intronic
1129078840 15:73021839-73021861 TGACCCTTAGACCCCCAAAGAGG + Intergenic
1129250279 15:74304898-74304920 GGTACCCAAGACCCCCGAATGGG + Intronic
1129608090 15:77034565-77034587 TGTCCCCCACACACCCAAATTGG + Intronic
1130145891 15:81273437-81273459 TGGCCCCAAGACCAGCTAAGGGG - Intronic
1130575013 15:85084264-85084286 TGTGCCCAAGACAGTCAAAGGGG + Intronic
1130990967 15:88875401-88875423 TGACCCGGAGTCCCCCAAAGGGG + Intergenic
1131741857 15:95401415-95401437 TGGACCCCAGACCCCAAAAGTGG + Intergenic
1135689512 16:24524923-24524945 TGTCCCAAACAACCCCTAAGTGG + Intergenic
1135840752 16:25873883-25873905 TGTCCACATGACCCTTAAAGAGG - Intronic
1137612526 16:49828581-49828603 TCTCCCCAAGTCCCTCAAAGTGG - Intronic
1138047023 16:53735828-53735850 TGACCCCAAGATTTCCAAAGAGG - Intronic
1139996541 16:70986324-70986346 TTTCCTAAGGACCCCCAAAGTGG - Intronic
1140934718 16:79659761-79659783 TGTCCCCAACCCCTCCTAAGAGG + Intergenic
1142286135 16:89172242-89172264 TGGCCCCCAGCCCCCCAGAGAGG - Intronic
1142709914 17:1717349-1717371 TCCCCGCAAGTCCCCCAAAGAGG + Intronic
1143579647 17:7818106-7818128 AGTCCCCAAGACCAGCCAAGTGG + Intronic
1144844553 17:18209687-18209709 TGTACACAAAGCCCCCAAAGTGG - Exonic
1146609476 17:34291504-34291526 TGTGCACAAATCCCCCAAAGTGG + Intergenic
1146615276 17:34351370-34351392 TTTATCCAAGACCACCAAAGTGG + Intergenic
1146652896 17:34617328-34617350 TGTCCCAAAGGCCTCCAAAGAGG - Intronic
1150652309 17:67018078-67018100 TGTCCCCAGGACCTGCACAGAGG + Intronic
1152044959 17:77929698-77929720 ATTCCCCAAGACCCCCACACAGG + Intergenic
1152420211 17:80188709-80188731 TGTTCCCCAGACCCCAAAATTGG + Intronic
1152784168 17:82239401-82239423 TGTCCCCAAGACACTCAAGAGGG - Exonic
1154018061 18:10637797-10637819 TTTTCACAAGACCCACAAAGAGG - Intergenic
1154186808 18:12191785-12191807 TTTTCACAAGACCCACAAAGAGG + Intergenic
1155167149 18:23240510-23240532 TGTGCCCCAGGCCCTCAAAGAGG - Intronic
1157858506 18:51121639-51121661 TGTCCCCTAGGCCCCTGAAGGGG - Intergenic
1158896858 18:61922220-61922242 TGTCTCCATCACCCCCAAATGGG + Intergenic
1160913038 19:1483599-1483621 TGTCCCCCACACCCCCAGCGGGG + Intronic
1161031226 19:2058634-2058656 TGTCCCCAAAGCCCCAGAAGAGG + Intergenic
1162281341 19:9700353-9700375 TGTCTCCAGGACCCCCAAGCAGG + Intronic
1163003324 19:14382332-14382354 TGCCCCCAAGAAACCCAAGGTGG - Intronic
1164695043 19:30237111-30237133 TGTCCCCCAGATCCACACAGGGG - Intronic
1165342635 19:35223834-35223856 TGTCCCCACGATCACCCAAGAGG - Intergenic
1166342482 19:42147037-42147059 TCTCCCCTTGGCCCCCAAAGGGG + Intronic
924999981 2:397142-397164 TGACCCCAAGACCAGCAAAGCGG - Intergenic
929857639 2:45650372-45650394 AGTGCCGAAGTCCCCCAAAGGGG + Intergenic
931567328 2:63628134-63628156 TGTCGCCGAGGCCCGCAAAGGGG + Intronic
932889615 2:75580521-75580543 CTTACCCAAGACCACCAAAGTGG + Intergenic
933201030 2:79449102-79449124 TGTCCCCACTCCCCCCAAAAAGG + Intronic
934066260 2:88344906-88344928 TGTCCCAAAGAGCTCCAGAGAGG + Intergenic
936261853 2:110966563-110966585 TGCCCCCTAAACCCCTAAAGGGG + Intronic
938063269 2:128268116-128268138 TATCCCCCACACCCCCCAAGAGG + Exonic
943538699 2:189184488-189184510 TTTCCCCAAGCACCCCAAAAAGG - Intergenic
947533958 2:230929303-230929325 TGCCCCCAAGCCCCCCAACTCGG + Intronic
948797267 2:240411479-240411501 TGTCCCCCAGACCCCCTCAGGGG - Intergenic
1169486968 20:6042008-6042030 TGTCTCCAAGGCCCCTAACGTGG - Exonic
1169724442 20:8713909-8713931 TGTCCCAAATATCCCCAAACAGG - Intronic
1174387527 20:50196191-50196213 TGTCCCCAACACCCAGTAAGGGG - Intergenic
1174415303 20:50362295-50362317 GGTCCCCAAGACCCATTAAGGGG - Intergenic
1175430244 20:58896567-58896589 TCTCCCCAAGACCCCAGATGGGG + Intronic
1178719712 21:34997847-34997869 TCTCCCCAACACCCCCAATCTGG + Intronic
1179147057 21:38777226-38777248 GGTCCCCAAGAACCCCAGCGTGG + Intergenic
1179259504 21:39745688-39745710 TGTCCCCAACAACCCCAGAAGGG + Intronic
1179345002 21:40547918-40547940 TGTCCCGCAGCCCCCCAAATTGG + Intronic
1180132289 21:45834508-45834530 TGTCCCCGTGCCCGCCAAAGAGG + Intronic
1180219756 21:46351024-46351046 AGTACCCAAGACTCCCAAATAGG - Intronic
1181853806 22:25768564-25768586 GGTCCCCAAGACCCCCAGTCCGG - Exonic
1183617454 22:38954324-38954346 TGTCCCCCATACCCCCACTGGGG - Intronic
1184430870 22:44440984-44441006 GGGCCCCAAGTCCCCCACAGAGG - Intergenic
1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG + Intronic
952966558 3:38624574-38624596 TGCCCCCACCACCCCCAAGGTGG + Intronic
953266463 3:41393917-41393939 TGTTCCCAAGACCACCAACTAGG - Intronic
953685460 3:45074727-45074749 TGTCCCAATGGCTCCCAAAGTGG - Intergenic
953883667 3:46704154-46704176 TGTCCCCTAGACACCCAGGGTGG + Intronic
953883722 3:46704342-46704364 TGTCCCCTAGACACCCAAGGTGG + Intronic
953883803 3:46704615-46704637 TGTCCCCTAGACACCCAGGGTGG + Intronic
953883860 3:46704807-46704829 TGTCCCCTAGACACCCAGGGTGG + Intronic
953883869 3:46704834-46704856 TGTCCCCTAGACACCCAGGGTGG + Intronic
954329376 3:49881357-49881379 TATCCTCAAGACCTCCTAAGTGG - Intergenic
954874420 3:53792339-53792361 TGAGCCCAAGACACCCAAAGTGG + Intronic
955687706 3:61562629-61562651 GCTCCCCAGGACCCCCAAAAGGG - Intronic
956215145 3:66841003-66841025 TGTCAGCATGTCCCCCAAAGAGG - Intergenic
957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG + Intronic
958147235 3:89640925-89640947 CTTACCCAAGACCACCAAAGTGG + Intergenic
959527932 3:107398502-107398524 GGTCCCCAACACCCCACAAGGGG - Intergenic
959609541 3:108278220-108278242 TGTCCTCCAGACCCCAGAAGGGG - Intergenic
960661913 3:120069513-120069535 TGTCCCCCACACCCCCAACTGGG - Intronic
963869747 3:150402648-150402670 TTTCCCCAAGTCCAACAAAGAGG + Intergenic
965226371 3:165997790-165997812 CTTCCCAAAGTCCCCCAAAGAGG + Intergenic
965844648 3:172947077-172947099 TTTACCCAAGACCACCAAGGTGG + Intronic
969246099 4:5933856-5933878 TGTCACCAGGACCCCCACATTGG - Intronic
976608526 4:87005985-87006007 AGTCCCCAAGACCCTCTCAGAGG - Intronic
978062228 4:104352155-104352177 CTGCCCCTAGACCCCCAAAGAGG + Intergenic
985344214 4:188985748-188985770 TTTCCCCCACACCCCAAAAGAGG - Intergenic
992071240 5:73151235-73151257 GGTCCCCAGGGCCCACAAAGCGG - Intergenic
992734241 5:79703020-79703042 TCTCCCCAGGCCCCCCAAGGTGG + Intronic
994384076 5:99107629-99107651 TTTCCCCAAGGCCACCAAACTGG + Intergenic
995488148 5:112659922-112659944 TGTCCCCAAGTGCACCAGAGAGG + Intergenic
998168818 5:139860103-139860125 AGTCCCCAAGAGCCCCAAGGAGG + Intronic
999283984 5:150383099-150383121 TGGCCCCAGCACCCCCAGAGAGG + Intronic
999314484 5:150575204-150575226 TGTCCCCCTGACCCCCACATGGG + Intergenic
1001034399 5:168287198-168287220 TGTCCACAAGACCCCCCAAGGGG - Intergenic
1001894468 5:175366598-175366620 TGTCTCCATCACCCCCAGAGGGG + Intergenic
1005730004 6:28687766-28687788 CGTCCCCAAGACACCCATAAAGG + Intergenic
1009796807 6:68479755-68479777 TGTCCAAAAGACCACCAAAATGG - Intergenic
1014266781 6:119287069-119287091 ATTCTCCAAGATCCCCAAAGAGG + Intronic
1018834411 6:167472206-167472228 TGTCCCCATCACCCCCAGACAGG - Intergenic
1019340166 7:505193-505215 TGTCCTCAGGACCCCCACGGGGG + Intronic
1021158898 7:17247166-17247188 TCTCCATAAGACGCCCAAAGAGG + Intergenic
1021811504 7:24406215-24406237 TCTCCCCAAACCCCCCTAAGTGG - Intergenic
1022259418 7:28690128-28690150 TGTCACCAAGACTCCCCAACTGG - Intronic
1023356438 7:39371649-39371671 TTTCCCCAATACCACCCAAGAGG + Intronic
1026671978 7:72398712-72398734 TGTCCCCCAGGACCCCTAAGAGG - Intronic
1026864069 7:73811741-73811763 TGCCCCAAACACCCCCAAATTGG - Intronic
1027212954 7:76165388-76165410 TGTCCCCAGGACCCTGTAAGAGG + Intergenic
1027269254 7:76511149-76511171 TCTCCCAAAGGCCCCCACAGGGG - Intronic
1027319968 7:77005044-77005066 TCTCCCAAAGGCCCCCACAGGGG - Intergenic
1028554737 7:92109944-92109966 TCTCCCCACTACCCCCAAGGTGG - Intronic
1029170422 7:98626172-98626194 GGTCCCCAGGAGGCCCAAAGTGG - Intronic
1030559068 7:111062968-111062990 TGTCCCCCAGACCTCCAGAATGG - Intronic
1031546048 7:123052774-123052796 TTTGCCCAAGACCACCAAGGTGG - Intergenic
1032077682 7:128843834-128843856 TGTCCCCAAGAGCCCCTTTGTGG + Exonic
1032082745 7:128868276-128868298 TTTCCCCCAGGCCCCTAAAGGGG + Intronic
1033214010 7:139481191-139481213 TCTCCCCTAGACCCCCAGAAAGG + Intronic
1034374544 7:150630628-150630650 TGGCCCCAAGGCCCACCAAGTGG - Intronic
1034876584 7:154729956-154729978 TGTCCCCAGCTCCACCAAAGAGG + Intronic
1038202773 8:25430526-25430548 TGTCTCCAACACCCCCAGATGGG + Intronic
1042876778 8:73447800-73447822 TGTCCCCTAGCCACCCAGAGGGG - Intronic
1048692958 8:136988948-136988970 GGAACCCTAGACCCCCAAAGAGG + Intergenic
1049337806 8:142095850-142095872 TGCCCCCTAGACACCCCAAGGGG - Intergenic
1049686072 8:143939796-143939818 TGTCCCCAGGTCCCCCTAGGGGG - Intronic
1049758813 8:144322674-144322696 AGTCCCCAAGACCCCCAGGCAGG + Intronic
1052340077 9:27356355-27356377 TTTCTCCCAGGCCCCCAAAGAGG + Intronic
1056568480 9:87795892-87795914 TGTCCCCAAGACTGCGAGAGGGG + Intergenic
1060740146 9:126092470-126092492 TGACCCCCAGACCTCCACAGTGG - Intergenic
1061165356 9:128919196-128919218 CCTCCCAAAGGCCCCCAAAGGGG - Intergenic
1061620161 9:131806727-131806749 TCTTCCCAAGAGCCCCACAGTGG - Intergenic
1061625698 9:131839405-131839427 GGTCCCCATGACCTCCAGAGAGG - Intergenic
1061752138 9:132786464-132786486 TCTCCCCTGGACCCCCAGAGAGG + Intronic
1061791527 9:133061648-133061670 TGTCCCCTAGGTCCCCAAAGGGG - Intergenic
1061795205 9:133082214-133082236 TGTCCCCTAGGTCCCCAGAGGGG - Intronic
1062023197 9:134328800-134328822 TCTACCCCAGACCCCAAAAGCGG - Intronic
1185522016 X:747508-747530 TGTTTCCAAGCCCACCAAAGAGG + Intergenic
1185650091 X:1641515-1641537 TGTCCCCAACACACACACAGAGG - Intronic
1185650169 X:1641928-1641950 TGTCCCCATCACACACAAAGAGG - Intronic
1188978890 X:36708401-36708423 ATACCCCAAGATCCCCAAAGTGG + Intergenic
1192927213 X:75767594-75767616 TGTACCCAAGACCACCAAGGCGG + Intergenic
1195349358 X:103982222-103982244 TGTCCCCATCACCCCCATATGGG + Intergenic
1195358085 X:104056617-104056639 TGTCCCCATCACCCCCATATGGG - Intergenic
1196637116 X:118014789-118014811 TTCCCCCAATACCCCCAAAATGG + Intronic
1197413332 X:126145120-126145142 TGCCCCCACCACCCCCAAACAGG + Intergenic
1200962862 Y:9011150-9011172 TTTCCCCAAGAGCCCCTATGAGG + Intergenic