ID: 1119052810

View in Genome Browser
Species Human (GRCh38)
Location 14:71386693-71386715
Sequence TCTTCTAGTCAGGAGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119052810 Original CRISPR TCTTCTAGTCAGGAGCTGCC AGG (reversed) Intronic
900145642 1:1157758-1157780 TCCTCTAGTCAGCACCAGCCTGG - Intergenic
902386772 1:16080407-16080429 TCTGCGTGTCAGGAGCTGTCTGG + Intergenic
903290735 1:22312633-22312655 TTTTCTATCCAGGAGCTGCCTGG + Intergenic
909818830 1:80032450-80032472 TCTACTAGACAGCAGCTGCTAGG - Intergenic
912717553 1:111992478-111992500 ACTGAAAGTCAGGAGCTGCCAGG + Intergenic
914977435 1:152379210-152379232 TCCTGATGTCAGGAGCTGCCTGG + Intergenic
915347988 1:155207797-155207819 TCTGCCAGTCAGGATCTGCAGGG - Exonic
915771706 1:158432486-158432508 TCTCCTAGTCAGGAGCTATGGGG + Intergenic
917211747 1:172638800-172638822 TCTTCAAGGAAGGAGCTGCTTGG + Intergenic
917212035 1:172641214-172641236 TCCTCTTCTCAGGAGCTGGCAGG + Intergenic
919539277 1:198828570-198828592 TCTTGATGTCAGGAGCTGCCTGG + Intergenic
921302366 1:213763442-213763464 TCCTCTAGTCTGCTGCTGCCAGG + Intergenic
922759201 1:228115391-228115413 TCTTTGAGTGGGGAGCTGCCCGG - Intergenic
1063186735 10:3658737-3658759 CCTTCCAGTGAAGAGCTGCCTGG + Intergenic
1064652978 10:17527987-17528009 TCTGGGAGTCAGGAGCTGCTGGG - Intergenic
1066048240 10:31612953-31612975 CCATCTAGAAAGGAGCTGCCAGG - Intergenic
1071899066 10:90099132-90099154 TCTTCTACTCAAAAGCTGACTGG + Intergenic
1072284043 10:93895508-93895530 TCATCTTGCCATGAGCTGCCTGG - Intronic
1076029675 10:127146879-127146901 TCCATTAGTCAGGAGGTGCCCGG + Intronic
1077154179 11:1084124-1084146 CTATCTAGCCAGGAGCTGCCTGG + Intergenic
1077532426 11:3103496-3103518 TCTTCTAATCAGAAAGTGCCAGG + Intronic
1082197783 11:49325105-49325127 TTTTTAAGTCAGGAGCTGACTGG + Intergenic
1083115454 11:60455164-60455186 TAGTCTAGTCTGGAGCTGCAGGG - Intronic
1083149235 11:60781473-60781495 TCATCTAGTCAAGAGATGCATGG - Intergenic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1087342581 11:96926773-96926795 TCTGCTAATCAGATGCTGCCAGG - Intergenic
1092054964 12:5501232-5501254 TATTCTAGACAGGAACAGCCTGG + Intronic
1092202523 12:6594914-6594936 TCTACTAGTCAGGATCCACCAGG + Intronic
1092715406 12:11384208-11384230 TCTTCTTGTCTGTAGCTGACAGG + Intronic
1095330629 12:40957562-40957584 ATTTCTAGTCTGGAGCTCCCTGG + Intronic
1101909068 12:108849215-108849237 TCTTCTAGTTGGGAGCTGCAGGG - Intronic
1102574247 12:113845865-113845887 TCTTCAAGTTAGGACCTGCGGGG - Intronic
1103503949 12:121427728-121427750 TCTGCTAGGGAGGGGCTGCCAGG - Intronic
1104889012 12:132130874-132130896 TCTCCTCGTCAGCTGCTGCCTGG + Intronic
1105268337 13:18844209-18844231 TCCTCTATTCAGGTGCTGCTTGG + Intergenic
1110648903 13:77919837-77919859 TGTTCTAGTCTGGAGCTGCCGGG - Intergenic
1114406601 14:22462713-22462735 ACTTCCAGTTAGGAGCTGCTAGG - Intergenic
1119052810 14:71386693-71386715 TCTTCTAGTCAGGAGCTGCCAGG - Intronic
1121526540 14:94623223-94623245 GCTTGTGGTCAAGAGCTGCCGGG + Intronic
1202830977 14_GL000009v2_random:29785-29807 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1123838429 15:24221586-24221608 TCTCCAAGTAAGGAGCTGGCTGG - Intergenic
1123847970 15:24323870-24323892 TCTCCAAGTAAGGAGCTGGCTGG - Intergenic
1123867017 15:24531235-24531257 TCTCCAAGTAAGGAGCTGGCTGG - Intergenic
1124841021 15:33242310-33242332 CCTTCAAGTCAGGAGTTGCTAGG - Intergenic
1126215602 15:46150790-46150812 TATTCTAATCAGAAGCTTCCAGG - Intergenic
1126831253 15:52608189-52608211 TCTTCTAGTCAGAAGCACCCAGG - Intronic
1128444409 15:67744485-67744507 TCTTCCAGACAAGAGCTGCAGGG + Intronic
1129851683 15:78797267-78797289 TCTTCTGATCTGGAGCAGCCTGG - Intronic
1129917653 15:79288542-79288564 TCTTCTAGTCAGCAGAAACCAGG + Intergenic
1130080002 15:80724630-80724652 TCCTGTAGTCAGCTGCTGCCTGG + Intronic
1130251309 15:82301823-82301845 TCTTCTGATCTGGAGCAGCCTGG + Intergenic
1130690894 15:86080521-86080543 CCTTCTAGTCAGATCCTGCCTGG - Intergenic
1130694345 15:86115295-86115317 TATTCTAGTCTAGACCTGCCTGG + Intergenic
1130894374 15:88158942-88158964 GCTTTTAGTCAGTAGCTGCAAGG - Intronic
1131033516 15:89206076-89206098 TCTTCTAGTAAGGCTTTGCCAGG + Intergenic
1134192738 16:12135107-12135129 TCTTCTACTCAGGCCCTGCTTGG + Intronic
1134776128 16:16855202-16855224 CCTTCTAGACAGGATCTGGCTGG + Intergenic
1136571813 16:31102497-31102519 TGTGCTAGTCCTGAGCTGCCAGG - Intergenic
1144995884 17:19268184-19268206 TTGTCTTCTCAGGAGCTGCCTGG + Intronic
1145891187 17:28416959-28416981 TTTTGTAGTCAGTAGCTCCCTGG - Intergenic
1151321703 17:73356463-73356485 TCTATAAGCCAGGAGCTGCCAGG - Intronic
1152522373 17:80864613-80864635 TCTTGTAGTGTGGATCTGCCGGG - Intronic
1152817868 17:82418778-82418800 GCTTCCAGCCAGGAGCCGCCCGG - Intronic
1153034757 18:750476-750498 TCTTCTAGTGAGTAGTGGCCAGG - Intronic
1154419683 18:14215825-14215847 TCCTCTGTTCAGGTGCTGCCTGG - Intergenic
1156947890 18:42857162-42857184 GCATCTAGTCAGGAGAGGCCAGG + Intronic
1157428343 18:47602744-47602766 TTTCCAAGTCAGGAGCTGCAGGG - Intergenic
1159190401 18:65034531-65034553 TCCTCTAGTCACAAGCTCCCAGG + Intergenic
1160222673 18:76988733-76988755 TGTTCTACTTGGGAGCTGCCTGG + Intronic
1161515185 19:4692530-4692552 TCTCCTAGACAGCAGCTGCATGG - Intronic
1202641719 1_KI270706v1_random:97988-98010 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
925612018 2:5709465-5709487 ACTTCTTGCCAGTAGCTGCCTGG - Intergenic
929675786 2:43927176-43927198 TCCTCTAGACTGGAGCAGCCAGG - Intronic
929800231 2:45093520-45093542 TCTACTATTAAGCAGCTGCCCGG - Intergenic
932463669 2:71899200-71899222 TCATCAAGTCAGGTTCTGCCAGG - Intergenic
932973094 2:76569922-76569944 CCTACTAGTGTGGAGCTGCCAGG + Intergenic
934497546 2:94821439-94821461 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
934581819 2:95448133-95448155 TGTTCTATTCAGGAGCTACTGGG - Intergenic
934597631 2:95628581-95628603 TGTTCTATTCAGGAGCTACTGGG + Intergenic
934842263 2:97634411-97634433 TGTTCTATTCAGGAGCTACTGGG - Intergenic
938221225 2:129569519-129569541 TCTTCCAGTCAGGAGGTACCGGG - Intergenic
939000426 2:136728083-136728105 TCTGCTATTCAGGAGCTTCCTGG + Intergenic
940231580 2:151459415-151459437 TTTTCTATTCAGGAGCAGCTAGG + Intronic
941447848 2:165624605-165624627 TCTTCTACACAAAAGCTGCCTGG + Intronic
944889601 2:204103632-204103654 TCTTCTAATCTGGACCTTCCAGG + Intergenic
945995301 2:216431252-216431274 TCTTCTAATCAGCAGCTAGCAGG - Intronic
947218239 2:227768394-227768416 TCTCCTTTTCAGGAGCTGCAGGG + Intergenic
948782203 2:240328805-240328827 CCTTCCATTCAGGGGCTGCCGGG - Intergenic
948866508 2:240777728-240777750 CCGGCTTGTCAGGAGCTGCCTGG - Intronic
1169074648 20:2753100-2753122 TGTCCAAATCAGGAGCTGCCGGG + Intronic
1170695302 20:18652437-18652459 GCTCCTATTCAGGAGCTGGCAGG + Intronic
1171888837 20:30688182-30688204 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
1176610165 21:8874624-8874646 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1176853609 21:13943472-13943494 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
1180360224 22:11883877-11883899 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1181588843 22:23870348-23870370 TCTTCCATTCAGCAGCTGACTGG + Intronic
1181891100 22:26064535-26064557 TCTACTAGTCAAGATATGCCTGG + Intergenic
1184916239 22:47570937-47570959 CCTTCTAGCCTGGAGCTGACAGG - Intergenic
1185302503 22:50089903-50089925 TCGCCTTGTCAGGAGCTGCCAGG + Intronic
949920041 3:8993317-8993339 TGTCCTAGCCTGGAGCTGCCTGG - Intronic
953905212 3:46865187-46865209 TGTTCCAGTCAGGAGCGGGCTGG - Intronic
954161792 3:48728038-48728060 TTTTCATGTCAGGAGCTGACTGG + Intronic
955056901 3:55462893-55462915 TCTTGAGGTCAAGAGCTGCCTGG - Intergenic
955930036 3:64047198-64047220 TCTTTTAGGGAGGGGCTGCCAGG - Intergenic
958109002 3:89114892-89114914 TCCTCAGGTCAGGACCTGCCAGG - Intronic
959790185 3:110350978-110351000 TCTTCCAGTCAATAGCTGCATGG - Intergenic
961310653 3:125997261-125997283 TCTCCTAGTCAGGATATGCGGGG - Intergenic
962924268 3:139977202-139977224 TCTTCTACCAAGGAGCTGGCTGG + Intronic
963912721 3:150828526-150828548 TCTTATAGACAGGAGCTGATGGG + Intergenic
1202736844 3_GL000221v1_random:9411-9433 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
969189738 4:5507570-5507592 TCTACCAATCAGGAGTTGCCAGG + Intergenic
969343530 4:6557346-6557368 TCTTATAGTCAGGAGATGCTGGG + Intronic
973385225 4:49508504-49508526 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
975675010 4:76818663-76818685 TCTTATAGGCAGGAGATGGCTGG + Intergenic
977451705 4:97207130-97207152 GCTTTGAATCAGGAGCTGCCTGG + Intronic
979113874 4:116796185-116796207 TCCTCTAATGAGGAGCTTCCTGG + Intergenic
1202769092 4_GL000008v2_random:183855-183877 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
985922369 5:2987565-2987587 TCTTCTATTCAGGACCTGAATGG - Intergenic
991017292 5:61945773-61945795 TGTTCTATTCAAGAGCTGCCTGG + Intergenic
991772887 5:70056410-70056432 TCTTCTAACAAGGAGCAGCCTGG + Intronic
991852180 5:70931834-70931856 TCTTCTAACAAGGAGCAGCCTGG + Intronic
992367218 5:76105157-76105179 TCTTCAAGTCAAGAAATGCCAGG + Intronic
992750112 5:79853822-79853844 CCTTCTTGACATGAGCTGCCTGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995666227 5:114545075-114545097 CCTACTTGTCTGGAGCTGCCAGG - Intergenic
996417707 5:123227990-123228012 TCTTCTATCCAGAAGCTGACTGG - Intergenic
998357230 5:141550031-141550053 TCTTCTAGTTAGAATTTGCCTGG - Intronic
1000295372 5:159908922-159908944 ACTTTTAGACAGGAGCAGCCTGG - Intergenic
1000358454 5:160423731-160423753 TCTTCTAGTCTGGAGTTGACAGG - Intronic
1001146820 5:169192184-169192206 TCTTCCAGTCTGGGTCTGCCTGG - Intronic
1003217752 6:4130481-4130503 TCCTCTAGTCAGGTGGAGCCTGG - Exonic
1006171078 6:32093246-32093268 TGTTTTAGTGAGGAGCAGCCAGG + Intronic
1009443162 6:63706721-63706743 TTTTCTAGTCCAGAGATGCCTGG + Exonic
1011089779 6:83584341-83584363 TCTTCTAGCCATGAGATGACAGG - Intronic
1013393586 6:109712242-109712264 TCTTCTAGTGAGTATCTGACTGG + Intronic
1014212992 6:118726374-118726396 TGTACTAGTCAGGAACAGCCAGG - Intergenic
1017521277 6:155205483-155205505 CCTTACAATCAGGAGCTGCCTGG + Intronic
1018027875 6:159819785-159819807 CCTTCCAGTCAGGAGGTGCCCGG + Intronic
1018942880 6:168320914-168320936 TAATCTTGTGAGGAGCTGCCAGG + Intergenic
1019559851 7:1650627-1650649 TCTCCTTGGCAGGAGCTCCCTGG - Intergenic
1020100412 7:5391189-5391211 TCTCCCAGGCAGGAGCTGCCAGG + Intronic
1021911131 7:25386761-25386783 TCACCTGGTCAGGAGCTGCAAGG + Intergenic
1022636848 7:32144321-32144343 TATTCATGTCTGGAGCTGCCAGG - Intronic
1024287517 7:47772132-47772154 TCTTATAGCAAGGAGCTGCTAGG + Intronic
1024595859 7:50936813-50936835 TCAGCTGGTCAAGAGCTGCCTGG - Intergenic
1026054878 7:66975366-66975388 TCTTGTAGTCAGGTGATGCCAGG + Intergenic
1029251339 7:99238882-99238904 TCTCCTTTTCAGGAGGTGCCAGG - Intergenic
1033370636 7:140704299-140704321 TCCTTCAGTAAGGAGCTGCCTGG + Intronic
1034370706 7:150594186-150594208 TCTTCCAGTCAGGAGGCACCAGG + Intergenic
1035448219 7:158957467-158957489 TATTCTGTTCAGGAGCTACCTGG - Intergenic
1036802655 8:11803659-11803681 TCTTCTGGTCTGGACCAGCCTGG + Intronic
1038976569 8:32703583-32703605 TCTTCTGGTCAGCAGCTGACAGG + Intronic
1041029346 8:53719827-53719849 TATTCTATTCCAGAGCTGCCTGG + Intronic
1042493909 8:69434858-69434880 TTTGCTATTCAGGAGCTGTCTGG - Intergenic
1043870800 8:85429589-85429611 TCTTCTTTTCAGAAGGTGCCAGG - Intronic
1045342714 8:101268727-101268749 TCTTGCAGTCTGTAGCTGCCTGG + Intergenic
1045390648 8:101710951-101710973 TCTCCTAGTCAGGAGCCTCGGGG - Intronic
1046784534 8:118252019-118252041 TTTCCTAGTCAGGCTCTGCCTGG + Intronic
1047121377 8:121908616-121908638 TCTTCCAGTCAGGAGCCACAGGG - Intergenic
1048011962 8:130464937-130464959 TGTTTCAGTCAGGACCTGCCTGG + Intergenic
1048292757 8:133192958-133192980 TCTTCTAGGCAGCCCCTGCCTGG + Intronic
1048736737 8:137510373-137510395 TCTTCCAGTGATGGGCTGCCAGG + Intergenic
1051423157 9:16908920-16908942 ACTTGCAGTCAGGTGCTGCCAGG - Intergenic
1053659598 9:40259032-40259054 TCCTCTGTTCAGGCGCTGCCTGG - Intronic
1053909969 9:42888384-42888406 TCTTCTGTTCAGGCGCTGCCTGG - Intergenic
1054371726 9:64405331-64405353 TCCTCTGTTCAGGCGCTGCCTGG - Intronic
1054525000 9:66117184-66117206 TCCTCTGTTCAGGCGCTGCCTGG + Intronic
1054679345 9:67895048-67895070 TCCTCTGTTCAGGCGCTGCCTGG - Intronic
1062194604 9:135265949-135265971 TCTGCTGGTGAGGAGCTGACAGG - Intergenic
1203693974 Un_GL000214v1:77570-77592 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
1203705571 Un_KI270742v1:39855-39877 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1203558426 Un_KI270744v1:25950-25972 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
1203642299 Un_KI270751v1:26493-26515 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1187677313 X:21729420-21729442 TCCTCTAGTGAGGAGAGGCCAGG - Intronic
1195762661 X:108263599-108263621 TCTTCCAATCAGGACCTGCCAGG - Intronic
1196520842 X:116668833-116668855 TCTTGATGTCAGGAGCTGCCTGG - Intergenic