ID: 1119053939

View in Genome Browser
Species Human (GRCh38)
Location 14:71399409-71399431
Sequence CTGCTGTTGTTTTTGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2138
Summary {0: 1, 1: 3, 2: 41, 3: 305, 4: 1788}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119053939 Original CRISPR CTGCTGTTGTTTTTGAAACA GGG Intronic
Too many off-targets to display for this crispr