ID: 1119055105

View in Genome Browser
Species Human (GRCh38)
Location 14:71411474-71411496
Sequence AGAGAGAAGACAACTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 1, 2: 5, 3: 50, 4: 663}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119055105_1119055113 16 Left 1119055105 14:71411474-71411496 CCTTCCCCAGTTGTCTTCTCTCT 0: 1
1: 1
2: 5
3: 50
4: 663
Right 1119055113 14:71411513-71411535 AGTCTCTACACTGATTTCACGGG 0: 1
1: 0
2: 1
3: 10
4: 160
1119055105_1119055112 15 Left 1119055105 14:71411474-71411496 CCTTCCCCAGTTGTCTTCTCTCT 0: 1
1: 1
2: 5
3: 50
4: 663
Right 1119055112 14:71411512-71411534 TAGTCTCTACACTGATTTCACGG 0: 1
1: 0
2: 0
3: 13
4: 155
1119055105_1119055111 -8 Left 1119055105 14:71411474-71411496 CCTTCCCCAGTTGTCTTCTCTCT 0: 1
1: 1
2: 5
3: 50
4: 663
Right 1119055111 14:71411489-71411511 TTCTCTCTGTAGTGGAGGTGTGG 0: 1
1: 0
2: 1
3: 34
4: 665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119055105 Original CRISPR AGAGAGAAGACAACTGGGGA AGG (reversed) Intronic
900312884 1:2042978-2043000 AAGGCAAAGACAACTGGGGAGGG + Intergenic
900636492 1:3668718-3668740 AGAGTGATGAGAGCTGGGGACGG + Intronic
901188340 1:7389176-7389198 AGAGAAGAGACAGCTGGGGGTGG - Intronic
901582481 1:10256375-10256397 AGAGAAAAGACAAATCGGCAAGG - Intronic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902039726 1:13483915-13483937 AGAGAGGAGAGGAGTGGGGAGGG + Intronic
902157178 1:14498121-14498143 TGAAAGAAGAAAACTGGAGAAGG - Intergenic
903671532 1:25038735-25038757 GGAGAGAAGGCATTTGGGGAAGG + Intergenic
903704270 1:25273515-25273537 AGTGAGAAGAAAGCTGGGGTCGG - Intronic
903722969 1:25419802-25419824 AGTGAGAAGAAAGCTGGGGTCGG + Intronic
904221494 1:28973689-28973711 AGAAAGAAAACAAATGGGGTTGG - Intronic
905331385 1:37202038-37202060 AGAGAGAAGACACCTATGAATGG + Intergenic
905460610 1:38120507-38120529 AGAGAATAGACCACTGGGCATGG - Intergenic
905509617 1:38508510-38508532 AGAGAGAATTCATCAGGGGAGGG + Intergenic
905693286 1:39957835-39957857 ACAGAGAAGACAGCTGGTGCAGG - Intronic
905867499 1:41383979-41384001 AGAGAGAAAATGACTTGGGAAGG + Intergenic
905867958 1:41386541-41386563 AGAGAGAAGACGGGAGGGGAAGG - Intergenic
906289606 1:44611095-44611117 ATAGAGAACACAGCGGGGGAGGG + Intronic
906458369 1:46018098-46018120 AGTGAATTGACAACTGGGGAAGG - Intronic
906489900 1:46260212-46260234 AGAGAGTAGATGATTGGGGAAGG + Intronic
907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG + Intergenic
907382459 1:54102559-54102581 AGAAATAATACAACTGGGGTTGG + Intronic
907770267 1:57455014-57455036 AGGGAGAGGACAACTAGGGAAGG + Intronic
907814844 1:57908417-57908439 AGAGAGAAGAGAGCCAGGGAGGG + Intronic
908049736 1:60216145-60216167 AGAGTGAAGGCAGCTGGGGTTGG - Intergenic
908605401 1:65792670-65792692 AGAGGCCAGACGACTGGGGACGG + Intronic
909754315 1:79204499-79204521 AGAGAGAAGAGCGGTGGGGAGGG + Intergenic
909849517 1:80442707-80442729 AGAGAGAAGAAAAGTAGGGGTGG + Intergenic
910001187 1:82344281-82344303 AGAGGGAAGAGAACTGGTAAGGG + Intergenic
910554666 1:88518095-88518117 AGAGTTAGAACAACTGGGGAAGG + Intergenic
911205733 1:95090180-95090202 AGAGAGAAGAGAAAAGGAGAAGG - Intergenic
911268120 1:95767535-95767557 AGAGAGAAAAAAACTGGGAATGG + Intergenic
911329445 1:96510335-96510357 AGAGTGAAGACAACAGGGTGGGG - Intergenic
912771577 1:112468960-112468982 ATACAGAAGACAACTGAAGATGG - Intronic
912973931 1:114310822-114310844 AGTGAGAAGACAAGAGGGGAAGG + Intergenic
913091262 1:115478314-115478336 AGAGAGTGGACAACTGAGGCTGG + Intergenic
913173112 1:116249984-116250006 AGTGAGAAGACAGCTGGCTATGG + Intergenic
913572057 1:120130587-120130609 TGAGTGTAGACAATTGGGGATGG - Intergenic
913645313 1:120849311-120849333 AAAGAGAAAACTACTGAGGAAGG - Intergenic
914081416 1:144414228-144414250 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914176325 1:145282767-145282789 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914531052 1:148524253-148524275 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914987073 1:152470057-152470079 AGAAAGAAGACCAAGGGGGAAGG - Intergenic
915323200 1:155067278-155067300 GGAGAGAAGAAAACCTGGGAGGG + Intronic
915608777 1:156973426-156973448 AGAGAGGAGAGAGCTGAGGATGG - Intronic
915947863 1:160167182-160167204 GGAGAGGGGACAAATGGGGAGGG - Intronic
916338096 1:163695719-163695741 GAAGAGAAGATAACTGGGGCTGG - Intergenic
916584247 1:166136452-166136474 AGAGATAAGGCATCTGGAGATGG - Intronic
916611139 1:166392861-166392883 ATAGGGAAGACAAGTGGGCAGGG + Intergenic
916658984 1:166903599-166903621 AAAGAGAAGAGATTTGGGGAGGG + Intergenic
916995466 1:170293038-170293060 AGACTGAAAACAAGTGGGGAAGG + Intergenic
917005530 1:170412293-170412315 AAAGAGGACACAACTGGAGAAGG + Intergenic
917343266 1:174002856-174002878 CTAGGGAAGAGAACTGGGGAAGG - Intronic
917626919 1:176855588-176855610 GAAGAGAAAGCAACTGGGGAAGG + Intergenic
918283582 1:183029615-183029637 AGAGAGAGAGAAACTGGGGAAGG - Intronic
918482181 1:184990787-184990809 AGAGAGAAGAGAATTGCAGAAGG + Intergenic
918541106 1:185634004-185634026 AGAAAGATGACAAGTGGGGGAGG + Intergenic
918633770 1:186750466-186750488 AGAGAGATGACAACAGGGCTGGG - Intergenic
918726288 1:187928600-187928622 AGAGAGAAGAAACAAGGGGAGGG - Intergenic
918847004 1:189628923-189628945 AGAGGAAAGACAAAGGGGGATGG + Intergenic
919011092 1:191964280-191964302 AGAGAAAACACAGCTGGAGATGG - Intergenic
919161803 1:193840171-193840193 AGAGAGAGGAGAGATGGGGAAGG + Intergenic
919688410 1:200506428-200506450 AGAGAGAAGACATTTGGCGATGG + Intergenic
920706444 1:208254299-208254321 AGAGAGAAGAAAAGTTGGGATGG - Intergenic
920777010 1:208948711-208948733 AGAGAGAAGAGGAGAGGGGATGG + Intergenic
921689427 1:218130868-218130890 AGAGAGAAGACAGTTGTGTAGGG + Intergenic
921851668 1:219938510-219938532 TGAGAGAAGCTAACTGGGGCAGG + Intronic
922507338 1:226134170-226134192 TGGGAGAAGACACATGGGGAAGG - Intergenic
922650052 1:227330063-227330085 AGAGAAAGGACAAATGGAGAAGG - Intergenic
923296867 1:232602721-232602743 GCAGAGTAGACAACTGGAGACGG + Intergenic
923663540 1:235979368-235979390 ACTGAGAAGACAACTGGCCAGGG - Intronic
923681295 1:236120926-236120948 AAAGGGAAGAGAAGTGGGGAGGG + Intergenic
923784136 1:237051335-237051357 GGAGAGAAGACGAGAGGGGAGGG - Intronic
924256118 1:242184662-242184684 AGTCAGAAGACAACTGAGGCTGG - Intronic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
924609565 1:245562595-245562617 AGAGAGAAGAGCATGGGGGAAGG - Intronic
924791420 1:247253402-247253424 AGAGAGAAAACAAGTGAGGGAGG - Intergenic
1063647458 10:7899272-7899294 GGGCAGAAGACATCTGGGGAAGG - Intronic
1063850533 10:10184422-10184444 AAATAGAAGACAACTGGGAAAGG - Intergenic
1064315823 10:14255217-14255239 AGAAAGAAGACAATAGGAGAGGG - Intronic
1064485665 10:15786241-15786263 TGAGAGAAGAAAAGTGGGGGTGG + Intronic
1064628527 10:17285729-17285751 AGAGAGAAGGGAAAGGGGGAGGG + Intergenic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1065796139 10:29310080-29310102 AGAGAGAAGACATCAGGGTTAGG - Intronic
1066281020 10:33918500-33918522 AGAGAGAGTTCAGCTGGGGACGG - Intergenic
1066304716 10:34129480-34129502 AGAGATAAGAAAACTGAGGCCGG + Intronic
1066334543 10:34462944-34462966 AGAGGGAAGAGAAGGGGGGAAGG + Intronic
1066594645 10:37036853-37036875 AGAGAGAAGACAAAGAGTGAAGG - Intergenic
1069210290 10:65749578-65749600 ATTGAGAAGACAGCTGGGGGAGG + Intergenic
1069592186 10:69648986-69649008 AAAAAGAAAACAACTGGAGAAGG - Intergenic
1069641783 10:69961130-69961152 AGAGAGGAGACAGCTGTGGCTGG + Intronic
1069683208 10:70299900-70299922 AGAGACAAGAGACCTGGGCAGGG + Exonic
1070371486 10:75786462-75786484 AAAGAGAAGAAAACTAGAGAGGG - Intronic
1070674555 10:78403518-78403540 AGAGAGGAGAAAAGTGGGCATGG - Intergenic
1070838171 10:79464437-79464459 AGAAAACAGAGAACTGGGGAAGG - Intergenic
1070878353 10:79838005-79838027 AGAGACAAGAGGACTGGAGAAGG - Intergenic
1071185523 10:83039687-83039709 AGAGAGAAGAAAAAGAGGGAAGG - Intergenic
1071506026 10:86232112-86232134 AGAGAGGAGAAAACAGGGAAAGG - Intronic
1071644904 10:87354316-87354338 AGAGACAAGAGGACTGGAGAAGG - Intergenic
1071975115 10:90947842-90947864 AGAGAGAAGAAAAGTAGTGAGGG + Intergenic
1074194396 10:111168606-111168628 AGAGAGAACACAAATGGTGTTGG - Intergenic
1074243377 10:111662267-111662289 ATAAAGAATACAACTGGGCACGG + Intergenic
1074348645 10:112713163-112713185 AGAGAGAAGGAAACTAAGGAGGG - Intronic
1074798313 10:116972233-116972255 TGATAGAACACAGCTGGGGATGG - Intronic
1074950409 10:118328891-118328913 ACAGAGTAGATTACTGGGGAGGG - Intronic
1075003059 10:118811957-118811979 AGAGAGCAAAGAACTGGGGTGGG + Intergenic
1075247062 10:120832088-120832110 AGATAAAAGTCAACTGGGGGGGG + Intergenic
1075587659 10:123669150-123669172 AGAGAAAAGACTTCTGGGGCCGG + Intronic
1076566861 10:131404767-131404789 ACAGAGCAGACAAATGGAGATGG + Intergenic
1077396567 11:2326636-2326658 AGAGAGAAGGCACCTGGAGCAGG - Intergenic
1077520153 11:3028338-3028360 AAAGAGAAGACAGCTGGGCCCGG - Intronic
1077578420 11:3401877-3401899 GGAGAGAAGGCAGCTGAGGATGG - Intergenic
1077701237 11:4444080-4444102 AGGGACAAGACGACTAGGGAGGG + Intergenic
1077915451 11:6608827-6608849 AGGGAGAAGACAGGTGGGAAGGG - Intronic
1078327157 11:10389948-10389970 GGAGAGAAGACTCCTGGGCATGG - Intronic
1079019926 11:16901487-16901509 AGAGAAAAGACATATTGGGAAGG - Intronic
1079703174 11:23575023-23575045 AGAGAGAATACGACTGTAGAAGG - Intergenic
1079773736 11:24497200-24497222 AGAGAGAAGGCAGCGAGGGAAGG + Exonic
1079968071 11:27003282-27003304 GGAGAGAAGGGAACTGGGGCAGG - Intergenic
1079995743 11:27293533-27293555 AGAGAAAAGAAAAGAGGGGAGGG + Intergenic
1080032231 11:27673911-27673933 AGAGAGATGAAAACAGGTGATGG + Intronic
1080116058 11:28622707-28622729 GGAGAGAAGACTACAGGTGAGGG + Intergenic
1080183824 11:29455573-29455595 ATAGATAAGACATCTGGAGAAGG - Intergenic
1080603210 11:33841290-33841312 GGAGTGCAGACTACTGGGGAAGG - Intergenic
1080795654 11:35560532-35560554 CGAGAGGAGATAACTGTGGATGG + Intergenic
1081007665 11:37767137-37767159 AGAGAGACAATAACTGGGGGAGG + Intergenic
1081502617 11:43681082-43681104 AGAAAGAGGAGAGCTGGGGAGGG - Intronic
1081528269 11:43941970-43941992 ATAAAGAAGACATCTAGGGAAGG + Intronic
1081977819 11:47246928-47246950 AGGGAGGAGGAAACTGGGGAAGG + Intronic
1082239531 11:49855897-49855919 AGAGATGAGGCAACAGGGGAGGG - Intergenic
1082796512 11:57381685-57381707 AGAGAGAAGGCAACTTGCCAAGG + Intergenic
1082954202 11:58851208-58851230 AAAGAAAAGACAACTGGGCCCGG - Intronic
1084235458 11:67785393-67785415 GGAGAGAAGGCAGCTGAGGATGG - Intergenic
1084393904 11:68896514-68896536 AGAGAGAATTCGACTGGAGAAGG - Exonic
1084873557 11:72114207-72114229 AGAGAGAATACAAGTGCAGAGGG + Intergenic
1084882923 11:72184819-72184841 AGAGAAAAGAAAGCTGGGCATGG + Intergenic
1084935689 11:72585422-72585444 ACAGAGACGTCATCTGGGGAAGG + Exonic
1084948821 11:72653606-72653628 AGAGAGGAGAGGACTGGAGAGGG + Intronic
1085179059 11:74517994-74518016 AGAGGGGAGGGAACTGGGGATGG + Intronic
1085486145 11:76864887-76864909 AGAAAAAAGACAACTGGGCATGG - Intronic
1085780468 11:79403665-79403687 TGAGGGAAGACAACTGGGGGTGG - Intronic
1086197692 11:84160702-84160724 AGAGAGGAGATAACTGCAGAAGG + Intronic
1086375709 11:86198751-86198773 TGAAAGAAGACAACTGGAAATGG + Intergenic
1087998418 11:104841565-104841587 AGAGAGAATAAAGCTGGGGAGGG - Intergenic
1089055791 11:115583702-115583724 AGAGCCAAGTCAACTGGAGAAGG + Intergenic
1089135038 11:116242212-116242234 AGAGACAAGGCTACTGAGGATGG + Intergenic
1089588513 11:119524994-119525016 GGAGGGAAGGCAGCTGGGGAAGG - Intergenic
1089857776 11:121561784-121561806 AGAGAGGCGACAACTGGCCATGG - Intronic
1090476541 11:127027001-127027023 AGAGGGAAGAGAACTTGGGAGGG + Intergenic
1090743989 11:129692269-129692291 AGAGAGAAGAAAAGTGGAGCTGG - Intergenic
1091218778 11:133918815-133918837 AGAGAGAAGAGGGCGGGGGACGG + Intronic
1091764332 12:3108636-3108658 AGAAAGGAGAAAACGGGGGAAGG - Intronic
1091791884 12:3276618-3276640 AGCCAGAAAATAACTGGGGAGGG - Intronic
1092046570 12:5435031-5435053 AGAGAGAAGAGAATTGGAGGAGG + Intronic
1092612672 12:10188574-10188596 AGAAAAAAGATAACTGGGCATGG + Intronic
1093771535 12:23023417-23023439 AGAGAGCAGATTACTGGGGTTGG + Intergenic
1093885003 12:24449315-24449337 AGAGAGAAGACTAATGTGGTTGG - Intergenic
1094639294 12:32258505-32258527 AAAGAGAAGACAGCTGGGCCCGG + Intronic
1095969824 12:47894069-47894091 AGGGAGATGACAAATGGGTAGGG - Intronic
1096517282 12:52164008-52164030 GGAGAGAAGACAGCTGGGGCAGG - Intergenic
1096568181 12:52498608-52498630 AGGGAGATGGGAACTGGGGAAGG - Intergenic
1096976452 12:55701834-55701856 AGAGAGAAGACTTCTGCAGAGGG - Intronic
1097103225 12:56604166-56604188 AGAGAGGAGAGAAGTGGGGCGGG - Intronic
1097226138 12:57477763-57477785 GGTGAGAAGACAATGGGGGAGGG - Intronic
1097732468 12:63144851-63144873 GGAGAAAATACAACTGGGTAGGG + Exonic
1097757649 12:63425128-63425150 AGAGAGAAGACCCTTGTGGATGG + Intergenic
1097832866 12:64244031-64244053 AGAGAGAAGACCAATGTGGTGGG + Intergenic
1098385687 12:69916297-69916319 GGAGAGAAGAAAGCTGGAGACGG + Intronic
1098935304 12:76472459-76472481 AGAGAAAAGACAGCTGGGCCCGG + Intronic
1099470528 12:83042567-83042589 AGAGAGAAGGAATCGGGGGAGGG - Intronic
1100324926 12:93531649-93531671 AGGGAGAAGACACATGGAGAAGG - Intergenic
1100564442 12:95781790-95781812 AGAGAAAACAAAACAGGGGAGGG - Intronic
1100816824 12:98394975-98394997 AGAGAGAAGATTACTTGGGCCGG + Intergenic
1101503229 12:105323811-105323833 AGAAAGAAGACAACAGGAAAAGG + Intronic
1101716007 12:107313117-107313139 ACAGAGCATACATCTGGGGAGGG - Intergenic
1103507072 12:121448950-121448972 GGAGAGAAGCCAAGTGGGCAAGG + Intronic
1104578713 12:129992968-129992990 AGAGTGAAGAACACTGAGGAAGG - Intergenic
1104748464 12:131224063-131224085 AGACACAGGACAGCTGGGGAAGG + Intergenic
1105564685 13:21532955-21532977 AGAGAGAAACAAACTGGTGATGG + Intronic
1105674897 13:22660572-22660594 ACAGAGAAGACCACTGGAGACGG + Intergenic
1106219866 13:27736777-27736799 TGGGAGAAAACAACTGGTGAGGG - Intergenic
1106720518 13:32430330-32430352 AGAGAGAAGACAGCTGAGGAAGG + Intergenic
1107052169 13:36062728-36062750 AGAGAGAAGAGAACTGACCACGG + Intronic
1107200982 13:37716922-37716944 AGAGAGAAGTCTGGTGGGGACGG + Intronic
1107553090 13:41494941-41494963 AGAGACAAGAAAACTGAGGCTGG + Intergenic
1107794444 13:44035559-44035581 AGAGAGAAGAAAAGGAGGGAAGG + Intergenic
1107822370 13:44297285-44297307 AGAGAGGAGGGAAATGGGGAAGG + Intergenic
1108107695 13:47029757-47029779 AGACAAAAGACAACTGGGGATGG - Intergenic
1108112683 13:47093086-47093108 AGAGAGAAGACTCCTGAAGAAGG - Intergenic
1110744372 13:79035997-79036019 AGAGGAAAGACAGCTGGCGAGGG + Intergenic
1111117309 13:83796447-83796469 GGAGAGGAGCCAACTGGAGATGG - Intergenic
1111541926 13:89679875-89679897 AGAGAAAAGAGAAATGGCGAAGG + Intergenic
1111861641 13:93714760-93714782 AGAGAGAAGACATGCTGGGAGGG + Intronic
1112014182 13:95317692-95317714 AAAGAGAAAACAGCTGGGGCTGG - Intergenic
1112129253 13:96503461-96503483 ATACAGAAGACATCAGGGGAAGG + Intronic
1112332099 13:98484606-98484628 AGAGAGCAGCGAACTGAGGAGGG - Intronic
1113288046 13:108875243-108875265 AGAGAAAAGACAGGTGGGGAAGG + Intronic
1113853166 13:113429349-113429371 ACAGAAAAGTCAACTGGGGGCGG - Intronic
1113905165 13:113815965-113815987 AGACAGAAGCCGACTGGGAAAGG + Exonic
1113920840 13:113908436-113908458 AGAGAGAAGAAAGGTGGGGGAGG - Intergenic
1114390514 14:22303115-22303137 TGAGAGAACACAACTGTGGTAGG + Intergenic
1114618193 14:24079623-24079645 AGAGAAGAGACAGCTGGGGAGGG + Intergenic
1114696126 14:24629499-24629521 AGGAAGAAGACAACTAGGGCAGG - Intergenic
1115268206 14:31523522-31523544 AGAGAGAAGACAATGAGGGCTGG + Intronic
1115475482 14:33809245-33809267 AGAATGAAGACAACTGTGCATGG - Intergenic
1115864471 14:37728902-37728924 AGGGAGAAGAGAACTGGAGAAGG - Intronic
1116154038 14:41180691-41180713 AGAGAGAAAACAATTGAGGCAGG + Intergenic
1116800659 14:49440031-49440053 TGAGAGAAGATACATGGGGAGGG + Intergenic
1117765462 14:59077537-59077559 AGATGGAGTACAACTGGGGAGGG - Intergenic
1118011719 14:61616460-61616482 GGAGAGAAGGTAACTGGAGATGG + Intronic
1118487093 14:66224549-66224571 AGAGAGAAGGGCACTGGAGAAGG + Intergenic
1118691782 14:68346932-68346954 AGAGGGAAGGCAAGAGGGGAAGG - Intronic
1119055105 14:71411474-71411496 AGAGAGAAGACAACTGGGGAAGG - Intronic
1119084867 14:71730431-71730453 AGAGAGAGGGCAAATGAGGAAGG - Intronic
1119273328 14:73329452-73329474 AGAGAGAAGAGGACTGAGAAGGG - Intronic
1119707332 14:76791270-76791292 AAACAGAAGAGAACTGGAGAAGG + Intronic
1119756837 14:77125516-77125538 AGAGGGAGGAGACCTGGGGAAGG - Intronic
1119923602 14:78470681-78470703 AAAGAGAAGAGAAATGGAGATGG + Intronic
1120504030 14:85332064-85332086 AGAGAGGAGACAAGTGAGAAGGG - Intergenic
1120769630 14:88364887-88364909 TGAGTGAAGGTAACTGGGGAGGG + Intergenic
1121037041 14:90714882-90714904 ATAGAGATGAAAATTGGGGAGGG - Intronic
1121702809 14:95968674-95968696 AGAGAGAAAATAGCTGGGCATGG - Intergenic
1121960946 14:98258857-98258879 AGAGACAAGAGCATTGGGGAGGG - Intergenic
1122417795 14:101558546-101558568 AGGGAAAAGACAACTGGAGTGGG + Intergenic
1123799676 15:23806777-23806799 GGAAAGAAAACAAGTGGGGACGG + Intergenic
1123814827 15:23966390-23966412 TGAGAGAAGCCAACATGGGAAGG - Intergenic
1124088340 15:26573382-26573404 AGAGAGAAGAAAAATGGGATTGG + Intronic
1124810968 15:32937614-32937636 AGAGAGAAGACAAAAGTGGCTGG + Intronic
1125115796 15:36090057-36090079 AGAGAAAACAAAGCTGGGGAAGG - Intergenic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125493249 15:40164834-40164856 TGATAGAAGACAACTTGGCAAGG - Intronic
1125563398 15:40656593-40656615 GGAGAGAATACATCTGGGCATGG + Intronic
1125718659 15:41834712-41834734 AGAAAGAAGAAGACAGGGGATGG - Intronic
1125743099 15:41981051-41981073 AGAGAGCAGGGAACTGGGAAGGG + Intergenic
1125892374 15:43276180-43276202 AGAGAGAGGACAGGAGGGGAAGG + Intergenic
1126396954 15:48228328-48228350 AGTGGGAAGAAAAGTGGGGAGGG - Intronic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1128998059 15:72311329-72311351 AGAGAGACCAGAATTGGGGAGGG - Intronic
1129661012 15:77552913-77552935 AAAGAGAAGCCAGCAGGGGAGGG + Intergenic
1129953774 15:79614824-79614846 AGAGAGAAGGCGGCTGAGGATGG + Intergenic
1132091203 15:98949210-98949232 ACAGAGAAGACATGTGGGGCAGG - Intronic
1132380700 15:101363976-101363998 AGAAAGAATACAACTGGGGGAGG + Intronic
1132538705 16:497135-497157 ATAGAGCAGACATCTGGGGATGG - Intronic
1132569722 16:638761-638783 GCAGAGAAGGCAGCTGGGGATGG + Intronic
1133347023 16:5078027-5078049 GGAGAGAAGGCAGCTGAGGATGG - Intronic
1133922416 16:10165664-10165686 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1134105047 16:11479211-11479233 AGAGAAAACACATCTGGGGTTGG - Intronic
1134275988 16:12776587-12776609 AGAGAGAAGAGAACTTGTGCAGG - Intronic
1134380539 16:13720327-13720349 AGAGGTAAGTCAACTGAGGAAGG + Intergenic
1134470645 16:14522383-14522405 AGAGAGAAAAGAGCTGGGCATGG + Intronic
1134480521 16:14614968-14614990 AGAGGGAAAACCACCGGGGATGG + Intronic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135374757 16:21935663-21935685 AGAGAAGAGTCAACTGTGGAGGG - Intergenic
1135975140 16:27103763-27103785 AAAGAAAAGAAAACTGGGTATGG + Intergenic
1136264711 16:29108088-29108110 AGAGAAGAGTCAACTGTGGAGGG - Intergenic
1136319256 16:29471888-29471910 AGAGAAAAGGCAACTGGGCCCGG - Intergenic
1136379846 16:29888161-29888183 AGAGTGAAGACACCACGGGATGG + Intronic
1136433827 16:30211232-30211254 AGAGAAAAGGCAACTGGGCCCGG - Intergenic
1137342735 16:47625964-47625986 AGAGAGAAGACAACTACGTAAGG - Intronic
1137760048 16:50933302-50933324 AGACAGGAGGCAACTGGGGCTGG - Intergenic
1137946244 16:52735572-52735594 ATAGAGAAGCCAAGAGGGGATGG - Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1138192972 16:55031695-55031717 CGAGAGAAGACATCTGGACACGG + Intergenic
1138591920 16:58004837-58004859 AGAGAAAAGACAGCTGGGCCCGG + Intronic
1138732582 16:59211269-59211291 AGAAAGATGACAAACGGGGAGGG - Intergenic
1139144361 16:64306849-64306871 AGAGAGAAGACAAGTGGGAGAGG + Intergenic
1139485897 16:67256432-67256454 AGAGACATGGCAAGTGGGGAAGG - Intronic
1139658549 16:68404478-68404500 ACAGAGAAAACAGCTGGGCATGG - Intronic
1140075989 16:71699269-71699291 AGAGAGCAGACAAACAGGGATGG - Intronic
1140387214 16:74551792-74551814 AAAGAGAAGGGAAGTGGGGAAGG + Intronic
1140729800 16:77845640-77845662 GGAGAGAAAGCGACTGGGGAAGG - Intronic
1140985908 16:80157772-80157794 AGAGAGAAGCCACGTGAGGAGGG - Intergenic
1141618412 16:85223096-85223118 TGAGATAAGACAAATGGGTATGG - Intergenic
1142053500 16:87976070-87976092 AGAGAAGAGTCAACTGTGGAGGG - Intronic
1142608892 17:1096984-1097006 CGGGAGGAGACAGCTGGGGAAGG + Intronic
1142811003 17:2395461-2395483 AGAGAGAACACAAGGGGGGGAGG + Intronic
1143266651 17:5642990-5643012 AAAGAGAAGAGAAGAGGGGAAGG - Intergenic
1143287828 17:5804098-5804120 GGGGAGAAGAGAATTGGGGAGGG - Intronic
1143672315 17:8405238-8405260 GGAGAGAAGAGAGGTGGGGAAGG + Intergenic
1145416345 17:22716682-22716704 AAAGGTAAGGCAACTGGGGAGGG + Intergenic
1146103874 17:30012670-30012692 AAAGAAAAGACAACTGGGCCCGG - Intronic
1146308993 17:31752652-31752674 AGAGAGAGGACATGTTGGGAAGG + Intergenic
1146472986 17:33139346-33139368 AGAAAGAATAGATCTGGGGAAGG - Intronic
1146742521 17:35299061-35299083 AGAAAGGAGAGACCTGGGGAAGG - Intergenic
1147000374 17:37358588-37358610 AGGGAGAAGACCACGTGGGAAGG - Intronic
1147049969 17:37786873-37786895 AGTGAGAAGACAAAAGGGGTAGG + Intergenic
1147389343 17:40099661-40099683 AGGGGGAAGACAAGAGGGGAGGG + Intronic
1147495047 17:40907502-40907524 AAAGAAAAGAAAACTAGGGATGG - Intergenic
1147836782 17:43338507-43338529 AAAGAAAAGACAGCTGGGGCTGG + Intergenic
1148579724 17:48735159-48735181 AGAGGGAAGAAAACTGTAGAAGG + Intergenic
1148737456 17:49872921-49872943 AGAGAGGAGACAAGTGTGGCAGG - Intergenic
1148895708 17:50837916-50837938 GGAGAGAAGGCACCTGTGGAAGG + Intronic
1149077310 17:52611379-52611401 TGAGAGAAGAGAATTGGGGGAGG - Intergenic
1149412866 17:56427063-56427085 AGAGGGAAGAAGACTGGGGCTGG + Intronic
1150309413 17:64115566-64115588 AGTGAGAAGACAGCTGAGCAGGG - Intronic
1150631742 17:66884956-66884978 AGGGAGAAGACAGCAGAGGATGG - Intronic
1151389722 17:73777814-73777836 ACAGAGAAGAAAACTGAGGTAGG - Intergenic
1152612249 17:81321618-81321640 AGAGTGAAGAAAGCTGGGGTGGG - Intronic
1152967152 18:127486-127508 AAAGAGAATAGAACTGGGAACGG - Intergenic
1153521910 18:5961874-5961896 AGAGACAGGGCAACTGGGGCAGG + Intronic
1153929701 18:9867280-9867302 AAAGACAAGACAACTGAGAATGG + Intergenic
1153943021 18:9993534-9993556 AGTGAGAAGGAAACGGGGGAAGG - Intergenic
1154926836 18:20944571-20944593 AAAGAGAATAGAACTGGGAACGG + Intergenic
1154949095 18:21190865-21190887 AGGGGGAAGGGAACTGGGGAAGG - Intergenic
1155436177 18:25815433-25815455 AGAGGGAAGGCTACTGGGGTAGG + Intergenic
1155706070 18:28814504-28814526 GAAGAGATGACAAATGGGGATGG + Intergenic
1156214106 18:34978170-34978192 ATAGAGAAGACAATCAGGGAGGG - Intronic
1157331883 18:46710219-46710241 AGTGAGAAGACAAATGCAGAAGG + Intronic
1157890474 18:51411255-51411277 AGAGAGAAGGCCAATGGGGCTGG + Intergenic
1158117289 18:54009900-54009922 AGAGGGAAGGGAAGTGGGGATGG + Intergenic
1158998521 18:62948467-62948489 AGAGAGAAGACAACAGGGGAAGG - Intronic
1159555753 18:69942877-69942899 AGAGAGAAGACAGAGAGGGAAGG - Intronic
1160079081 18:75705261-75705283 AGACAGAAGAATAGTGGGGATGG + Intergenic
1160340201 18:78083021-78083043 AGAGAGACCCCAGCTGGGGAAGG - Intergenic
1161829088 19:6589918-6589940 AGAGAGAAGACAGAGAGGGAGGG - Intronic
1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG + Intronic
1162142049 19:8591037-8591059 AGTGAGAAGTTTACTGGGGAGGG - Intronic
1162204563 19:9046105-9046127 GGAGAGAAGGAATCTGGGGAGGG - Intergenic
1162301106 19:9845773-9845795 TGAGAGAGGACAACTTGGGCGGG + Intronic
1163083136 19:14957930-14957952 AGAGAGAAGACCAATGTGGCTGG + Intronic
1163300583 19:16443202-16443224 AAAGAGAATAGAACTGGGCAGGG + Intronic
1163519350 19:17782778-17782800 GGAGAAAAGAGAACTAGGGATGG + Intronic
1163672288 19:18636435-18636457 AGAGAGGAGGAATCTGGGGATGG - Intergenic
1164442214 19:28287870-28287892 AGAGAGAAGGGGACTGGGAAGGG + Intergenic
1165314194 19:35044907-35044929 AGAAAGAAGGAAACGGGGGAAGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166090438 19:40505092-40505114 AGATAGAAGCCAGCTGGGCATGG + Intronic
1166240052 19:41484898-41484920 AGAGAGAAATCAGCTGGGCATGG + Intergenic
1166453702 19:42922713-42922735 AAAGAAAAGACAACTGGGCCTGG + Intronic
1166465964 19:43031268-43031290 AAAGAAAAGACAACTGGGCCCGG + Intronic
1166472101 19:43087337-43087359 AAAGAAAAGACAACTGGGCCTGG + Intronic
1166489693 19:43248098-43248120 AAAAAAAAAACAACTGGGGAAGG - Intronic
1166492875 19:43274321-43274343 AAAGAAAAGACAACTGGGTTGGG + Intergenic
1166913229 19:46176195-46176217 AAAGAAAAGAAAACTGGAGAAGG + Intergenic
1167138770 19:47634722-47634744 AGAGAGAAGAGAGTTGAGGATGG - Intronic
1167298028 19:48663292-48663314 GGGCAGAAGACAAATGGGGAGGG - Intronic
1167959828 19:53096808-53096830 ATAGAGAGGACAACGGGGAAAGG + Intronic
1168509289 19:56961595-56961617 GGAGAGAAGAGAAGAGGGGAGGG - Intergenic
1168651877 19:58097245-58097267 AGAGAGAAGACAGGAGAGGAAGG + Intronic
925068517 2:949545-949567 AGAGAATAGAGAAATGGGGAAGG + Intergenic
925182818 2:1827832-1827854 CTAGAGAGGACAGCTGGGGAGGG + Intronic
925907417 2:8547699-8547721 AGACAGAAGACAAAAAGGGAAGG - Intergenic
927003049 2:18818966-18818988 GGAGAGAATACAATTGGAGAAGG - Intergenic
927345455 2:22033588-22033610 AGAGATAAGAAAACTTAGGAAGG - Intergenic
927541057 2:23911580-23911602 AGAAAGAAGAGAACAGAGGAAGG + Intronic
927571330 2:24163347-24163369 AAACAGATGACAGCTGGGGAGGG + Intronic
927638297 2:24831757-24831779 AGAGAGAAGACAATTGGGAGAGG + Intronic
927827066 2:26316454-26316476 AGAGAGAAGAGAAGAGGGGGTGG + Intronic
928245609 2:29624424-29624446 TGAGAGGACACAGCTGGGGAAGG + Intronic
928592796 2:32834631-32834653 GGAGAAAAGACAGATGGGGAGGG - Intergenic
929589799 2:43137538-43137560 AGAGATAAGGGAACTAGGGAGGG - Intergenic
929995202 2:46821651-46821673 AGTGAGATCACACCTGGGGAGGG + Intronic
931648142 2:64444127-64444149 ATAAACAAGACAACTGGAGATGG + Intergenic
931670501 2:64643013-64643035 AGAGAGGAAATAATTGGGGAAGG + Intronic
931928841 2:67106155-67106177 TGAGAGAAGGCATATGGGGAAGG - Intergenic
932289955 2:70568488-70568510 AGAGAGAGGACAAGAGGGAAGGG - Intergenic
933599769 2:84317524-84317546 AGAGAAAAGACAGCTGAGGAGGG - Intergenic
933885744 2:86718661-86718683 AGAGGGAAGAAAAATGGGGTGGG + Intronic
933924434 2:87078044-87078066 AGAGGGAAGAAAAATGGGGTGGG - Intergenic
934118037 2:88814098-88814120 AGAGAGAGGAAAACTGGGGTGGG + Intergenic
936037731 2:109126270-109126292 AGAGAGAAGAAAGCTGGGAAAGG + Intergenic
936534208 2:113299032-113299054 AGAGAGAGAAGAACAGGGGAGGG - Intergenic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937238181 2:120443038-120443060 GGAGAGCAGGAAACTGGGGAGGG + Intergenic
937578914 2:123459400-123459422 AGAAAGAAGCCAAGTGGGGAAGG - Intergenic
937806152 2:126147979-126148001 ACAGAGAAGATAACTGAGCAGGG - Intergenic
939155178 2:138516590-138516612 ATAGTGAAGAAAACTGTGGAGGG + Intronic
939737327 2:145864581-145864603 AGAGGGAAGAAAACTATGGAAGG - Intergenic
940416117 2:153421826-153421848 AGTGACAAGACCACTGGGTAAGG - Intergenic
940904722 2:159158764-159158786 AGAGAGAAAACACATGTGGAAGG + Intronic
941202095 2:162524719-162524741 AGAGAGAAGAAAAATGTGGTGGG + Intronic
941238684 2:163010089-163010111 AGAGAGATGACAAAGGGGGGTGG - Intergenic
942144319 2:173011384-173011406 AGAGAGAAGAGATCTGGCCAAGG - Intronic
942269726 2:174262151-174262173 AAAGAGAAGACAGCTGGGCATGG + Intergenic
942392567 2:175511052-175511074 ACAGAGATGACAGCTGGGTATGG + Intergenic
944407030 2:199396587-199396609 AGAGAGGAGCCAAGTGAGGATGG + Intronic
944471877 2:200062620-200062642 AGAGAGAAGAAAACTGACGTTGG - Intergenic
944941034 2:204627073-204627095 AGAGAGAAGACGACCAGTGAAGG - Intronic
945228583 2:207559090-207559112 AGAGAGAAAACAACAGAGGCAGG - Intronic
945402575 2:209404394-209404416 AGAAAGAAGAAAACTGTGGCCGG + Intergenic
945570835 2:211465495-211465517 AGAGAGAAGATAATAGGGGAAGG + Intronic
946135103 2:217639581-217639603 AGAGAGAAGAAAAGAAGGGAGGG + Intronic
947139728 2:227009745-227009767 AGAGAGAAGAGAAGAGGGGAGGG + Intronic
947549975 2:231038529-231038551 GGAGAGAAGAGGAGTGGGGAAGG + Intronic
947723626 2:232383300-232383322 GGAGAGGTGAGAACTGGGGAAGG + Intergenic
947916159 2:233833112-233833134 AGAGAGAACACAAAGAGGGAAGG - Intronic
948350687 2:237338222-237338244 TGAGAGAAGACAAGTGTGCAAGG - Intronic
948372440 2:237498053-237498075 AGAGAGGAGAGAACAGGGGTGGG + Intronic
948571752 2:238922137-238922159 AGGAAGAAGACAAGTGGAGACGG - Intergenic
1168810398 20:701078-701100 GGAGAGAAGACAAGAAGGGAAGG + Intergenic
1169024156 20:2353370-2353392 ACAGAGAAGAGAAAGGGGGAGGG - Intergenic
1169092615 20:2870910-2870932 GAAGAGAAGAGAACTGAGGAAGG - Intronic
1169321135 20:4634279-4634301 AGAGAGATGACAGCAGAGGAGGG - Intergenic
1169607137 20:7334398-7334420 ATACAGAAGGGAACTGGGGAAGG + Intergenic
1170907537 20:20529246-20529268 AAAGAGAAGAGGACTGAGGAAGG - Intronic
1171011977 20:21513832-21513854 AAAGAGAAAGAAACTGGGGATGG + Exonic
1171089975 20:22275788-22275810 AGAGAGGGGAAAACAGGGGAAGG + Intergenic
1171422419 20:25026087-25026109 AGAGGGAAGACAAATGAAGAGGG + Intronic
1171947216 20:31389374-31389396 AGAGAGAAGAGACCTTGAGAGGG + Intronic
1172175914 20:32971758-32971780 AGAGAGCAGAGAAGTGGAGACGG - Intergenic
1172320128 20:33989989-33990011 GGAGAAATGACAACTGGAGAGGG - Intergenic
1172740632 20:37163835-37163857 AGAGAAAGGACCACTGGGTAAGG - Intronic
1172835333 20:37869675-37869697 ACAGAGAAGACATCTCAGGAGGG + Intronic
1174777596 20:53359704-53359726 AGAGAGAAGGCCACTGTGGCTGG + Intronic
1175863362 20:62161779-62161801 AGAGAGTGGACAACTGGAGCAGG - Intronic
1175923245 20:62459611-62459633 AGAGAGGAGAGAGGTGGGGAGGG - Intergenic
1179092400 21:38278956-38278978 AGAGAGAGGACAACTTGAGATGG + Intronic
1179894549 21:44354003-44354025 TGGGAGAACAGAACTGGGGAGGG + Intronic
1180035612 21:45246706-45246728 GGAGAGAAGTCAGCTGGGGCCGG - Intergenic
1181003598 22:19999250-19999272 AGAGTGAGGTCAACTCGGGAGGG - Intronic
1181365891 22:22376914-22376936 TGAGAACAGACTACTGGGGATGG - Intergenic
1181372327 22:22428436-22428458 TGAGAACAGACTACTGGGGATGG - Intergenic
1182006859 22:26967948-26967970 AGAGAGAAGAGACCTGGCTAAGG + Intergenic
1182366254 22:29781372-29781394 AGAGAGTAGAAAGCTGGGCAGGG - Intergenic
1182961130 22:34476284-34476306 AGAAAGAAGACAACGAGGAAAGG + Intergenic
1183579418 22:38714813-38714835 AGAGACAGGACAGCTGGGAAAGG + Intronic
1183689731 22:39381939-39381961 AGAGAGGGGACAGATGGGGAGGG - Exonic
1183754206 22:39744131-39744153 AGGTAGAAGACAACTGTTGATGG + Exonic
1184191447 22:42897903-42897925 TGAGAGAAGTCAGCTGGGAATGG + Intronic
1184328970 22:43813565-43813587 ATAAAGAAGGCAAATGGGGAGGG - Intergenic
1184344371 22:43904010-43904032 AGAGAAAAGACAGCTGGGCCAGG + Intergenic
950267262 3:11583631-11583653 AAAAAGAAGACAACCCGGGAAGG + Intronic
950572136 3:13807821-13807843 TGACAGCAGACATCTGGGGAAGG + Intergenic
950676880 3:14559522-14559544 CAAGAGAAGACAACTGTGGGAGG + Intergenic
950692735 3:14673204-14673226 AGAAAGAAAACAGCTGGGCACGG + Intergenic
950962825 3:17123416-17123438 AGAGAGAGGACAGCTGGGGAGGG + Intergenic
951186667 3:19721735-19721757 ATTGGGTAGACAACTGGGGAAGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951581770 3:24172255-24172277 AGAGAGAAGAAATCTGCTGAAGG + Intronic
951689958 3:25385083-25385105 AAAGAGAGGACAAGTGTGGAGGG - Intronic
951931378 3:27970875-27970897 TTAGAGAAGACAACTGGGTTTGG + Intergenic
952508807 3:34034030-34034052 AGAGATAAGACAACTGCGTGTGG + Intergenic
952822325 3:37495999-37496021 GGAGAGCAGAGAGCTGGGGAAGG + Intronic
953147273 3:40290442-40290464 AGAGAGAATTCAACTGAGGTGGG - Intergenic
953521495 3:43647446-43647468 AGAGAGAATAAAACTGTGGGAGG - Intronic
954391175 3:50268917-50268939 AGAGAGGAGATTACTGGGAAGGG + Intronic
954505459 3:51067525-51067547 AGGGAGAAGGGAAGTGGGGAGGG - Intronic
954672651 3:52299030-52299052 AGAGAGAAGAGGAGAGGGGAGGG + Intergenic
955159190 3:56447431-56447453 AGGGAGACGAGAAGTGGGGAAGG + Intronic
955255881 3:57330917-57330939 AGAAATAAAACAACAGGGGAGGG - Intronic
956514291 3:70029368-70029390 AGAGAGAAGAGAACTTTGAAGGG - Intergenic
957051427 3:75415190-75415212 GGAGAGAAGGCAGCTGAGGATGG - Intergenic
957896536 3:86427074-86427096 AGAGAGAATAAAACAGGGAAGGG - Intergenic
957944218 3:87041800-87041822 AGAGAGAAGACAAGGAGGGAGGG - Intergenic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959262767 3:104102719-104102741 AGCTTGAAGACAACAGGGGAAGG + Intergenic
960301285 3:116005815-116005837 ATAGAGAAGACAACCAGGGTTGG + Intronic
960769806 3:121181141-121181163 AGAGAGGAGAAAAGAGGGGAGGG + Intronic
961303054 3:125934404-125934426 GGAGAGAAGGCAGCTGAGGAGGG + Intronic
962724254 3:138206691-138206713 AGAGAGAAGAGGACTGGGAGGGG + Intronic
963536135 3:146530715-146530737 AGAAAGAAGACGACTAGGAAAGG + Intronic
964413696 3:156425908-156425930 AGAGAGAAGTCAAGTGGAGAGGG + Intronic
964580760 3:158234665-158234687 AGGGAGAAGAGGATTGGGGAGGG - Intronic
964656513 3:159073011-159073033 AGAGTAAAGACAAATGGGGAAGG + Intronic
964740510 3:159960409-159960431 AGAGAGGAGACAACTTGCTAAGG - Intergenic
964769194 3:160206739-160206761 AGAGAGAAAACAACAAAGGATGG + Intergenic
966646614 3:182252664-182252686 TGAGACAATACAACTGGGAAGGG - Intergenic
966650959 3:182300525-182300547 AGTGAGAAGACAGCTAGGGCAGG + Intergenic
966949261 3:184801402-184801424 AGAGAAAAGACAACAGCTGATGG - Intergenic
967850131 3:194076142-194076164 AAACTGAAGATAACTGGGGATGG - Intergenic
968413788 4:410717-410739 TGAAAGAAGACAACTAGTGATGG - Intergenic
968717890 4:2175358-2175380 AGAGTGAAGAAAATTGAGGATGG - Intronic
968994207 4:3935569-3935591 GGAGAGAAGGCAGCTGAGGATGG - Intergenic
969163381 4:5281099-5281121 AGAGAGAGGGCAAAGGGGGAAGG + Intronic
969367674 4:6708156-6708178 AAAGAGAAGACAGTTGGAGATGG - Exonic
969819723 4:9710667-9710689 GGAGAGAAGGCAGCTGAGGATGG + Intergenic
970295224 4:14622580-14622602 GGAGAGAAGCCAACTGTGAATGG + Intergenic
970656901 4:18241354-18241376 AGAGAGAAGAAAGCTGGCAAGGG - Intergenic
970676938 4:18461932-18461954 AGAGAGAAGAAAAATGGAGGAGG + Intergenic
970836795 4:20418838-20418860 AGAGAGAAAACAAATGTGAAAGG + Intronic
971090549 4:23338713-23338735 AGAGAGAAGAAAACTGATGTAGG + Intergenic
971420384 4:26468818-26468840 AGAGAGAACACAAATGGCTAAGG - Intergenic
973783115 4:54308918-54308940 ATAGAGAAGAAAACTGTGGTAGG + Intergenic
974651737 4:64762860-64762882 TGAGAGAGGCCATCTGGGGAAGG - Intergenic
974875069 4:67693922-67693944 AGAGAAAATACAGCTGGGCACGG + Intronic
975462671 4:74672604-74672626 AGAGAGGAGAGAACTGGATAAGG - Intergenic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
978431630 4:108639308-108639330 AGAGAGAAGAAAGCTGAAGATGG - Intergenic
978867939 4:113537675-113537697 AGAGAGAATACACTTGGGGAGGG + Intronic
979864211 4:125733341-125733363 AGAAAGAAGACAACAGTGGCTGG + Intergenic
980125581 4:128770844-128770866 AAAGAGAAGACAGCCAGGGAAGG - Intergenic
980606943 4:135104736-135104758 AGAAAGAAGACAACTGTTGCTGG - Intergenic
981658588 4:147140520-147140542 TGAGAGAACACAAGTGGGGAGGG + Intergenic
981965200 4:150591753-150591775 AAAGAGAACACATCTAGGGAGGG + Intronic
982350585 4:154410503-154410525 AGAGTGAAGACAGCTGGGCACGG + Intronic
983100420 4:163619029-163619051 AGAGAGAAGACGTCTTGGTATGG + Intronic
983719936 4:170838434-170838456 TGAGAGAATACACCAGGGGATGG + Intergenic
984115097 4:175670346-175670368 AGAAATAAGAAAATTGGGGATGG + Intronic
984342894 4:178481666-178481688 AGAGAGGAAACTACTGGGGGTGG - Intergenic
984654667 4:182304982-182305004 AGAGAGAAGAAAAGAGGAGAGGG - Intronic
984759432 4:183350993-183351015 AGAGAGAAGACAAAGGGAGCTGG + Intergenic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985614244 5:910111-910133 AGAGACAAGCCAGGTGGGGAAGG - Intronic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
989311915 5:40029001-40029023 AGAGAGATGAGAGCTGGAGAGGG - Intergenic
989416407 5:41182507-41182529 GAAGAGAAGGCAACTGGGCAGGG - Intronic
989467883 5:41778438-41778460 AGAGAGAAGAGGTCTGGAGATGG + Intronic
990457830 5:56005169-56005191 GGAGAGGAGAGAACAGGGGAGGG - Intergenic
990577265 5:57135464-57135486 AGAGAGAAGACAAACTGGGAGGG - Intergenic
991500110 5:67268454-67268476 AGAGAGAACAGGACTGGGGAAGG - Intergenic
991544636 5:67767810-67767832 ATAGAGATGATAAATGGGGATGG + Intergenic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
994403569 5:99315011-99315033 AGAGAGAAGAACACAGGGAAGGG + Intergenic
994622999 5:102185676-102185698 AGAGAGAATACAACTAAGAAAGG + Intergenic
994865302 5:105261122-105261144 AGAGAGAAGAAAATTGCAGAAGG + Intergenic
995624002 5:114056772-114056794 AGAAAGAGGACAAGGGGGGAAGG - Intergenic
995794620 5:115928556-115928578 AGGGAGGACACAGCTGGGGAAGG + Intergenic
995843661 5:116469348-116469370 ACAGATAAGAGAACAGGGGAAGG + Intronic
995875712 5:116786984-116787006 AGAGACAGGAGAACAGGGGAAGG + Intergenic
996437050 5:123445978-123446000 AGAGAAAAGAAAAAAGGGGAGGG + Intergenic
997247042 5:132358494-132358516 ACAGAGAAGACAACTGCAGGAGG - Intergenic
997259157 5:132452501-132452523 GGAGAGAGGAAAAGTGGGGATGG - Intronic
998003218 5:138640605-138640627 GGGCAGAAGACAGCTGGGGACGG - Intronic
998811977 5:145975532-145975554 AGAGTGCAGACAGCTGGGGTGGG - Intronic
1000063059 5:157672995-157673017 ACAAAAAAGACAACTGTGGAAGG - Intronic
1000126958 5:158254845-158254867 AGAGAGAAGAAAGATGGAGAAGG + Intergenic
1000438387 5:161240980-161241002 AGAGAGAAGAGGACGGGGCATGG - Intergenic
1000479361 5:161752459-161752481 AGAGAGAATACAACTAAAGAAGG - Intergenic
1000759809 5:165208126-165208148 AGGGAAGAGACAGCTGGGGAGGG + Intergenic
1001155406 5:169268587-169268609 TGAGAGAAGGCAACAGGGCACGG + Intronic
1001469541 5:172001099-172001121 ATAGAGAAGAAAGATGGGGAGGG - Intronic
1001826018 5:174745664-174745686 AAAGAGAAGAGAGCAGGGGAGGG - Intergenic
1001851616 5:174972516-174972538 AGTGGGAAGACAAGTGGAGAAGG - Intergenic
1001989055 5:176100878-176100900 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1001989674 5:176105890-176105912 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1001989984 5:176108436-176108458 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1002226886 5:177729702-177729724 AGAGGGAAGGCAAATGGTGAAGG + Intronic
1002227196 5:177732247-177732269 AGAGGGAAGGCAAATGGTGAAGG + Intronic
1002266948 5:178041524-178041546 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1002671737 5:180873082-180873104 AAACAGAAGAGAAGTGGGGATGG - Intergenic
1003025833 6:2555216-2555238 AGACAGAAGATAACTTTGGAAGG - Intergenic
1003768239 6:9265879-9265901 AGAGAGAAAATCACTGGAGAAGG + Intergenic
1004568052 6:16817900-16817922 AGAGGGAAAACAACTGGAAATGG + Intergenic
1004648841 6:17588973-17588995 ACAGAGGTGACAACTGGGAAAGG - Intergenic
1005010159 6:21328411-21328433 GGAAAGAAGACAGCTGGGCACGG - Intergenic
1005054976 6:21720790-21720812 AGGGAGAAGAAAAGTGGGTAGGG - Intergenic
1005898215 6:30196060-30196082 AGAGATAGGGTAACTGGGGAAGG - Intronic
1006192358 6:32217367-32217389 CCAGAGAAGACACCTGGGGCAGG + Intronic
1006295907 6:33170033-33170055 GGAGAGAAGGTAACTGGGAAGGG - Exonic
1006547664 6:34792686-34792708 AGAGAGAAGACAGCTGGTTCGGG - Intronic
1006578419 6:35062373-35062395 AAAAAGAAGGCAACTTGGGAAGG + Intronic
1006824751 6:36926564-36926586 AGAGAGAAAAGAAGAGGGGAGGG + Intronic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1006949322 6:37808582-37808604 ACAGAGAACACAGCTGGGGATGG - Intergenic
1007217573 6:40252250-40252272 TGAGAGGAGAGAAGTGGGGAGGG - Intergenic
1007394533 6:41570017-41570039 AGAGGGATGACAGCAGGGGAAGG + Intronic
1007920700 6:45607069-45607091 AGAGGGAAGAGCAGTGGGGAGGG + Intronic
1009310288 6:62142115-62142137 AGAGAGAAGAGTACTGATGAGGG + Intronic
1009505350 6:64470167-64470189 AGAGAAAAGACAACTGGGCCCGG - Intronic
1009832243 6:68953107-68953129 AGAGAGAAGATAATTTGGCAGGG - Intronic
1009869561 6:69436393-69436415 ATAGAGTAGACAAATGGAGAGGG - Intergenic
1011173238 6:84530151-84530173 GGAGAAAAAAGAACTGGGGAGGG - Intergenic
1012739165 6:102992507-102992529 GGAGGGAAGACAAAGGGGGAGGG + Intergenic
1012914935 6:105159860-105159882 AGAGAGCACATAATTGGGGAGGG + Intronic
1014061995 6:117082394-117082416 AGAAAGATGATACCTGGGGATGG + Intergenic
1014949306 6:127536721-127536743 AGAGAGAAGACAGACAGGGAGGG + Intronic
1015657675 6:135538146-135538168 AGAGGTAAGACAGCTGGGGGTGG - Intergenic
1015832965 6:137389373-137389395 AGAGAGCAGATAAATGGAGAGGG + Intergenic
1016386289 6:143533929-143533951 AGAGAGAAGGCAGCTTGTGAAGG + Intergenic
1016506078 6:144780956-144780978 AGAGGAAAGACAACTGGAAAAGG - Intronic
1016526238 6:145004652-145004674 ACAGGGAAGACAGCTGTGGAGGG + Intergenic
1016649148 6:146444141-146444163 AGAGGGAAGACAAAAGGGAAGGG + Intergenic
1016715867 6:147227523-147227545 AGGGACAAGACTACAGGGGAGGG - Intronic
1017882537 6:158571961-158571983 TGAGACAAGAGAGCTGGGGAAGG - Intronic
1018313587 6:162534970-162534992 GGAAGGAAGAGAACTGGGGAAGG - Intronic
1018376523 6:163218520-163218542 AGACAGAAGATAACTGGAGTGGG - Intronic
1018440584 6:163808672-163808694 AGAAAAAAGATGACTGGGGAGGG - Intergenic
1018849951 6:167579726-167579748 AGAGAAAAGATAAATTGGGAAGG + Intergenic
1018902446 6:168058386-168058408 AGAGAGAAGAGGGCTGGGCACGG - Intronic
1018902455 6:168058421-168058443 AGAGAGAAGAGGGCTGGGCACGG - Intronic
1019040826 6:169103128-169103150 AGAGAGGAGATATCTGGAGAAGG + Intergenic
1020020542 7:4864567-4864589 AGAGAGAAGCAAACTGTGGGAGG - Intronic
1020181767 7:5928150-5928172 AGAGAGAGAGCAGCTGGGGAAGG + Intronic
1020429302 7:8103399-8103421 AAACAGAAGACAACAGAGGAAGG - Intergenic
1020785306 7:12566213-12566235 AGAGAGTAGGCTACTAGGGATGG + Intergenic
1022095995 7:27142216-27142238 AGAGAGAAGGAAATTCGGGAGGG - Intronic
1022389608 7:29932150-29932172 AGAGAGGAGACAGCTGGTGTTGG + Intronic
1022674264 7:32483561-32483583 AGAGAAAAGATAGCTGGGCATGG + Intergenic
1022784414 7:33623899-33623921 AGAGAAAATACCACTGGGGAGGG + Intergenic
1023595914 7:41829318-41829340 ACAGAGAAGACAATTCAGGAGGG - Intergenic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024266062 7:47607397-47607419 AGAGGGACAACACCTGGGGAAGG + Intergenic
1024561684 7:50650031-50650053 AGAGAGAAGACCACTAGAGTGGG + Intronic
1024930409 7:54662858-54662880 GGGGAGGAGAGAACTGGGGAGGG + Intergenic
1024975170 7:55107226-55107248 AGGAAGAAAAAAACTGGGGAGGG - Intronic
1025247500 7:57328402-57328424 AGAGAGAAGAAAACAGAGGGAGG - Intergenic
1026250792 7:68668692-68668714 AGAGAGAAAAGAATTAGGGAGGG + Intergenic
1026517794 7:71087765-71087787 AGAGAGAACACAATCAGGGAGGG + Intergenic
1026863481 7:73809043-73809065 AGGGAAATGGCAACTGGGGAGGG - Intronic
1027684057 7:81259376-81259398 AGAGAGAAGAAACCAGGAGAGGG + Intergenic
1028118472 7:87028978-87029000 GAAGAGGAGACATCTGGGGAAGG - Intronic
1028219137 7:88174794-88174816 AGAGAGAAAAGAAATGGGGAAGG - Intronic
1028488761 7:91387889-91387911 AGATAGAAGACCACTGGGCCTGG - Intergenic
1028895926 7:96041494-96041516 AGACAGAAGACATATGGAGAAGG + Intronic
1029625795 7:101719363-101719385 AGAGGGAGGACAGATGGGGAGGG + Intergenic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1029702089 7:102253883-102253905 AGAGGGAGGACATCTGGGGAGGG - Exonic
1030197531 7:106867596-106867618 TGAGAGAGGACAACTGCCGAAGG + Exonic
1030539643 7:110814188-110814210 CCAGAGAGGAAAACTGGGGATGG - Intronic
1031432174 7:121685127-121685149 AGATAGAAGACAGCCGGGCATGG - Intergenic
1034862783 7:154614080-154614102 AAAGGGAAGACAGCTGTGGATGG - Intronic
1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG + Intronic
1035792185 8:2317203-2317225 AGACAGAGGACAACTGGGTGTGG - Intergenic
1035800620 8:2404502-2404524 AGACAGAGGACAACTGGGTGTGG + Intergenic
1036381929 8:8241258-8241280 GGAGAGAAGGCAGCTGAGGATGG + Intergenic
1036390100 8:8317943-8317965 AGAGAGGAGACGAGTGTGGACGG + Exonic
1036637619 8:10562812-10562834 GGAGGGAAGACAAAGGGGGAAGG - Intergenic
1036984948 8:13519139-13519161 AGTGAGACTACATCTGGGGAGGG - Intergenic
1037696494 8:21228540-21228562 CAAGAGAAGGGAACTGGGGAAGG + Intergenic
1038611400 8:29062883-29062905 AGAGTGCAGAGCACTGGGGAGGG + Intronic
1039367946 8:36951767-36951789 AGAAAGAAAACAACTGGACAGGG + Intergenic
1040722545 8:50343981-50344003 AGAGAAAAGCCAGCTGAGGATGG - Intronic
1040918545 8:52589811-52589833 AGAGAGAAGAGAGATGGAGAAGG - Intergenic
1041882599 8:62769395-62769417 TGAAACAAGACAATTGGGGAGGG - Intronic
1041909451 8:63072858-63072880 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1042181264 8:66089967-66089989 AAAGACAACAAAACTGGGGAAGG - Intronic
1042295529 8:67213451-67213473 AGAGGGAGGACAGCTGGGGTTGG + Intronic
1042791782 8:72615611-72615633 AGAGGCCAGACCACTGGGGATGG + Intronic
1042879615 8:73472337-73472359 AGAGAGAACAGAACTGGGGAAGG + Intronic
1043472126 8:80573455-80573477 AGAGAGACAGGAACTGGGGAGGG - Intergenic
1044010247 8:86985136-86985158 CAAGAGAAGACAGCTTGGGAAGG - Intronic
1045294938 8:100864301-100864323 AGAAATAGGACAACTGGGCACGG + Intergenic
1045442514 8:102228255-102228277 GGAGAGGAGTCAGCTGGGGACGG + Intronic
1045550019 8:103163266-103163288 TAAGAGAAGAGAACTGGGCAAGG - Intronic
1045951801 8:107860075-107860097 AGTGAAAGGATAACTGGGGAGGG + Intergenic
1047435314 8:124831083-124831105 AGACAGAAAAGAAGTGGGGAGGG + Intergenic
1047834126 8:128669633-128669655 AGAAAAACGACAACTGGGAACGG - Intergenic
1048181361 8:132197594-132197616 AAAGAGAAAACATCTGGAGATGG - Intronic
1048246085 8:132801925-132801947 AGGTAGAAAACAACTTGGGATGG + Intronic
1048575750 8:135688714-135688736 AGTGGGAAGAGAGCTGGGGAAGG - Intergenic
1049210593 8:141384800-141384822 AGGGAGATGGCAACTGTGGATGG + Intergenic
1049917528 9:333047-333069 AGAATGAAGACAACAGGGGGTGG - Intronic
1050301288 9:4261338-4261360 AAAGAGAAGAGAAATAGGGATGG + Intronic
1050334094 9:4574137-4574159 AGAGATAAGACAGCAGGGGGAGG + Intronic
1050729814 9:8696185-8696207 AGAGAGAAGAGGACACGGGATGG + Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051341165 9:16112149-16112171 AGTCAGAAGACAACTAGGTATGG - Intergenic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1051586627 9:18733672-18733694 AAAGAGAAGAGAAGTGGGGTGGG - Intronic
1051738145 9:20224651-20224673 AGGGAGAAGAGAAGAGGGGAGGG + Intergenic
1052325871 9:27216240-27216262 AGAGAACAGACAATTAGGGAGGG + Intronic
1052343959 9:27389591-27389613 AGACAGAATACAACTAGTGATGG - Intronic
1052518008 9:29508927-29508949 AGAAAGAAGACAACTGGGGGTGG + Intergenic
1053392299 9:37744670-37744692 AGAGAGGACACAGTTGGGGAGGG - Exonic
1053786392 9:41655547-41655569 GGAGAGAAAAAAATTGGGGAGGG + Intergenic
1054158671 9:61658673-61658695 GGAGAGAAAAAAATTGGGGAGGG - Intergenic
1054478445 9:65589678-65589700 GGAGAGAAAAAAATTGGGGAGGG - Intergenic
1054996004 9:71390245-71390267 AGAAAGAAGAGAAGTGGGTAAGG + Intronic
1055400282 9:75916483-75916505 AGATAGAAAGTAACTGGGGAAGG + Intronic
1055688796 9:78807949-78807971 AGGGAGAAAATAAATGGGGAGGG - Intergenic
1055762351 9:79622384-79622406 AAAGGGAAGAGAACTGGGTAGGG - Intronic
1055946550 9:81696392-81696414 AGACAGGAGAGAAGTGGGGAAGG + Intergenic
1056523180 9:87418861-87418883 AGGGAGAAGAGAACTGAGCAAGG - Intergenic
1056736426 9:89213952-89213974 AAAGAGAGGACAACAGTGGAAGG + Intergenic
1056953785 9:91066381-91066403 ATAGAGAAGACAGCTGGAGACGG + Intergenic
1057221757 9:93261304-93261326 AAAGGTAAGACAAGTGGGGAAGG - Intronic
1057705291 9:97391356-97391378 AGACAGATGCCATCTGGGGAGGG - Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1057893263 9:98885545-98885567 AGAGAGAGAACAAGTGGGGGAGG + Intergenic
1058991507 9:110258138-110258160 GGAGAGAAGTCAGCTGAGGATGG - Intergenic
1059646880 9:116276711-116276733 GGAGAGAAGAGGAGTGGGGAGGG - Intronic
1059900066 9:118914466-118914488 AGAAAGAAGGAAAGTGGGGATGG - Intergenic
1060540220 9:124424232-124424254 GGAGAGAAGAGAGCTAGGGATGG + Intergenic
1060588638 9:124802305-124802327 AGAGAGCAGCCATCTGGGGCGGG - Intronic
1060602313 9:124886518-124886540 AGAGAGAAGAGGAGTGGGAATGG + Intronic
1060764215 9:126281826-126281848 AGAGACAAGACAAAGGGAGATGG - Intergenic
1060899084 9:127241656-127241678 AGAGAGAAGACAAAGGGGACAGG + Intronic
1061188600 9:129069335-129069357 ACAGAGCAGGCCACTGGGGAGGG + Intronic
1061435991 9:130562423-130562445 GAAGAGAAGAGAACTGGAGAGGG - Intergenic
1061455113 9:130692030-130692052 AGAAAGAGGAGCACTGGGGATGG + Intergenic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1061954376 9:133953881-133953903 AGAGGGAGGACACCTAGGGATGG - Intronic
1062335111 9:136061504-136061526 AGAGAGAAGGCAGCTGGGGTAGG + Intronic
1062370316 9:136235402-136235424 GGAGAGAAGACAACTCAGGCTGG + Intronic
1062638555 9:137504763-137504785 AGACAGAAAATAACTGGGGGAGG + Intronic
1062693418 9:137857754-137857776 AGAGAGATGACAGCTGGGCGTGG + Intronic
1185545385 X:939572-939594 AAAGAGGAGACAAGAGGGGAAGG - Intergenic
1185554817 X:1012977-1012999 AGAGAGAGGGATACTGGGGAGGG - Intergenic
1187011304 X:15283063-15283085 AGAAAGAAAAAAAGTGGGGAAGG + Exonic
1187200319 X:17128219-17128241 AGAGGGAAGAAAAGTAGGGAAGG + Intronic
1187225757 X:17374769-17374791 CGCAAGGAGACAACTGGGGAGGG - Intergenic
1187397380 X:18930482-18930504 AGAGAGGAGAAAGCAGGGGAGGG + Intronic
1187552956 X:20324204-20324226 AGAGAGAAGAGAAGGAGGGAGGG - Intergenic
1187927376 X:24262532-24262554 AGAGAGGAGACAGCTGGGCATGG - Intergenic
1188380429 X:29484857-29484879 AGAGAGTAAACAATGGGGGAAGG + Intronic
1189214494 X:39311417-39311439 AGAGAGAAGAACACAGGGGACGG + Intergenic
1189221102 X:39372806-39372828 AGAGAGACTTCAACTTGGGATGG - Intergenic
1189326882 X:40118005-40118027 AGAGAGAAGACAGATAGGGAGGG - Intronic
1189355952 X:40310095-40310117 GGAGGGAAGACAGCTGTGGAAGG - Intergenic
1189423902 X:40881264-40881286 AGAAAGAAGGAAGCTGGGGAGGG + Intergenic
1189683443 X:43540011-43540033 AGAGAGAAGGGAAGAGGGGAGGG + Intergenic
1190152403 X:47959023-47959045 ACAGAAGAGACAACAGGGGAGGG - Intronic
1190160245 X:48026970-48026992 ACAGAAGAGACAACAGGGGAGGG + Intronic
1190213800 X:48467349-48467371 AGAGGTAAAACAGCTGGGGAGGG + Intronic
1190364351 X:49677264-49677286 AGAGAGAAGACTTCTGAAGAAGG - Intergenic
1190373107 X:49762148-49762170 AGAGAGAAGTGAACTGGAGATGG - Intergenic
1190450896 X:50579714-50579736 TGATGGAAGATAACTGGGGAAGG + Intergenic
1190687427 X:52887521-52887543 ACAGGGAGGATAACTGGGGAGGG + Intergenic
1190698555 X:52968271-52968293 ACAGGGAGGATAACTGGGGAGGG - Intronic
1190779762 X:53582745-53582767 AAAAAGAAGACAACAGTGGAGGG - Intronic
1192272869 X:69599839-69599861 AGAGAGAAGTTGACTGGGGTTGG + Intergenic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1192627563 X:72746092-72746114 AGAGAGAAAAGAAGAGGGGAGGG - Intergenic
1192654145 X:72974721-72974743 AGAGAGAAAAGAAGAGGGGAGGG + Intergenic
1192830830 X:74749448-74749470 AAAGAGGATACAACTGGAGAAGG - Intronic
1193622482 X:83772596-83772618 AGAGAAAATCCATCTGGGGAAGG - Intergenic
1195486462 X:105413428-105413450 AGAGAGATGACAGCAGGAGAGGG + Intronic
1195545898 X:106112308-106112330 AGAGGGAAGGCCATTGGGGAAGG + Intergenic
1197176578 X:123492759-123492781 AGAGTGAGGACAAAAGGGGAGGG - Intergenic
1197249542 X:124200636-124200658 AGCCAGAAGACTACTGGAGAAGG + Intronic
1197273058 X:124447160-124447182 AGAGAGAAGAAAGCTGAGCAGGG - Intronic
1197729124 X:129795205-129795227 ATAGAAAAGATAACTGGAGACGG - Intergenic
1198381566 X:136088742-136088764 AAAGAAAAGAAAAATGGGGAGGG - Intergenic
1198913957 X:141645791-141645813 AGTGAAAAGACAACCGGGGTTGG - Intronic
1200082592 X:153585879-153585901 AAAGAGAAAAGAAGTGGGGAGGG + Intergenic
1200226408 X:154420115-154420137 AGAGAGATGGCATCTGGGGTGGG + Intronic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1201343856 Y:12961199-12961221 AAAGAGAAGACAGCTGGGCCTGG + Intergenic
1201974311 Y:19831915-19831937 AAAGAGAAGACAGCTGGGCCTGG + Intergenic