ID: 1119057583

View in Genome Browser
Species Human (GRCh38)
Location 14:71438837-71438859
Sequence GAGGGAGGCAAGTAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 326}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119057583_1119057591 0 Left 1119057583 14:71438837-71438859 CCTGCAGCTTACTTGCCTCCCTC 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1119057591 14:71438860-71438882 TTGGGCTGGTTGGAAAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
1119057583_1119057595 15 Left 1119057583 14:71438837-71438859 CCTGCAGCTTACTTGCCTCCCTC 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1119057595 14:71438875-71438897 AGCCGTGGGCTGGTTACTATGGG 0: 1
1: 0
2: 0
3: 11
4: 63
1119057583_1119057597 24 Left 1119057583 14:71438837-71438859 CCTGCAGCTTACTTGCCTCCCTC 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1119057597 14:71438884-71438906 CTGGTTACTATGGGAATTGATGG 0: 1
1: 0
2: 0
3: 12
4: 163
1119057583_1119057593 5 Left 1119057583 14:71438837-71438859 CCTGCAGCTTACTTGCCTCCCTC 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1119057593 14:71438865-71438887 CTGGTTGGAAAGCCGTGGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 141
1119057583_1119057594 14 Left 1119057583 14:71438837-71438859 CCTGCAGCTTACTTGCCTCCCTC 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1119057594 14:71438874-71438896 AAGCCGTGGGCTGGTTACTATGG 0: 1
1: 0
2: 1
3: 7
4: 74
1119057583_1119057592 1 Left 1119057583 14:71438837-71438859 CCTGCAGCTTACTTGCCTCCCTC 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1119057592 14:71438861-71438883 TGGGCTGGTTGGAAAGCCGTGGG 0: 1
1: 0
2: 1
3: 5
4: 102
1119057583_1119057587 -10 Left 1119057583 14:71438837-71438859 CCTGCAGCTTACTTGCCTCCCTC 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1119057587 14:71438850-71438872 TGCCTCCCTCTTGGGCTGGTTGG 0: 1
1: 0
2: 3
3: 64
4: 2525
1119057583_1119057598 25 Left 1119057583 14:71438837-71438859 CCTGCAGCTTACTTGCCTCCCTC 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1119057598 14:71438885-71438907 TGGTTACTATGGGAATTGATGGG 0: 1
1: 0
2: 1
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119057583 Original CRISPR GAGGGAGGCAAGTAAGCTGC AGG (reversed) Intronic
900742199 1:4337445-4337467 GAGGGAGGCCAGTGAGGTGGAGG - Intergenic
901297483 1:8171448-8171470 GAAGAGGGCAAGAAAGCTGCAGG + Intergenic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
904565983 1:31428749-31428771 GAGGAGGGCAAGTAATCTGAGGG + Intronic
905893939 1:41533335-41533357 GAGGGAGGCAATGACACTGCTGG - Intronic
905954060 1:41977414-41977436 CAGGCAGGCAAGCAAGCAGCTGG - Intronic
906680091 1:47720415-47720437 GAGGGAGGCAAGAACACTCCGGG - Intergenic
908097181 1:60751136-60751158 GAGTGAGGCAAGAAAGATTCTGG - Intergenic
909265891 1:73558025-73558047 GAGGGAGGTAAGGAACCTGTTGG + Intergenic
909480073 1:76121304-76121326 GAGGGTGGCAGGTAAGGTGGTGG - Intronic
911129966 1:94377558-94377580 GAGGGAGGGAAGGAATCTCCAGG + Intergenic
912560732 1:110549575-110549597 GAAGGAGGCATGAAAGATGCAGG + Intergenic
913207252 1:116551446-116551468 GAGAGAGGTGAGAAAGCTGCAGG - Intronic
913247029 1:116879080-116879102 GAGGGAGGGCAGGCAGCTGCTGG - Intergenic
913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG + Intergenic
916519694 1:165552489-165552511 TTGGGAGGCAAGTGAGCTGGAGG + Intronic
916939328 1:169663261-169663283 GAGGGAGGGAAGTGATCTCCAGG - Intronic
918876729 1:190056118-190056140 TAGGGAGGAAAGGAAGCAGCGGG - Intergenic
920919142 1:210283802-210283824 GAGGAAGTCATATAAGCTGCAGG - Intergenic
920989525 1:210923405-210923427 GAGGGAGGTAAGAAAGATGATGG - Intronic
921097778 1:211901814-211901836 GTGGGAGGCAAATAGGCTCCTGG + Intergenic
921374024 1:214454854-214454876 GGGGGAGGCAGGTAATCTGGAGG + Intronic
923055431 1:230423280-230423302 TAGGGAGGAAAGTAAGCAGGTGG - Intronic
923412672 1:233725513-233725535 GAGGGAGGAATGATAGCTGCAGG - Intergenic
923936372 1:238764802-238764824 GAGAGAGGTAACAAAGCTGCAGG - Intergenic
924094485 1:240537109-240537131 AAGGGAGGCAAGGAGGCTACAGG - Intronic
1062923518 10:1297612-1297634 GAGGAGGGCAAGGGAGCTGCTGG - Intronic
1063161334 10:3420970-3420992 GAGGGATGCAGGTAGGATGCAGG + Intergenic
1063665879 10:8060315-8060337 GAGGGAGGCAGGCTAGCTGGTGG + Intronic
1063803997 10:9616438-9616460 GAGAGAGGTGAGAAAGCTGCAGG - Intergenic
1066673014 10:37859424-37859446 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1067295486 10:44973136-44973158 GAGGGAGGGGAGCAAGCTGTGGG - Intronic
1067512364 10:46906575-46906597 TATGTAGGCAAGTAAGCTGCAGG + Intergenic
1067649880 10:48145247-48145269 TATGTAGGCAAGTAAGCTGCAGG - Intergenic
1069067238 10:63955375-63955397 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
1069853158 10:71423597-71423619 GAGGGAGGCAGAGAAGCTGGTGG + Intronic
1071331537 10:84565537-84565559 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1072550112 10:96470739-96470761 CAGAGAGGTAAGTAAGCTGTTGG - Intronic
1072757749 10:98031494-98031516 GAGGGAGGCTAGTAGGACGCAGG - Intergenic
1073137219 10:101226760-101226782 GAGGGAGGCGAGGAAGGAGCGGG + Exonic
1073944041 10:108730184-108730206 GAGGGAGGGAAGTAAGTAGAGGG + Intergenic
1074834357 10:117274825-117274847 CAGGGAGGTAACTAAGATGCTGG + Intronic
1075210381 10:120485913-120485935 GATGGAGCCTAGTAAGCAGCCGG + Intronic
1075674919 10:124289748-124289770 GAGGGAGGCAAGGAGGCACCGGG - Intergenic
1075714837 10:124550185-124550207 GAGGGAGCCTGGTAAGCTGCCGG + Intronic
1076050221 10:127327449-127327471 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1078353070 11:10611167-10611189 AAGGTAGCCAAGTAAGCTGGAGG + Intronic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1078855198 11:15201239-15201261 GAGGCAGGCAAGTCAGGTGTTGG + Intronic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1079692846 11:23441412-23441434 GAGGGATGGAAGTCAGCAGCGGG - Intergenic
1080453982 11:32401947-32401969 CAGGGAGGCAGGTAAGCTGGTGG + Intronic
1081069736 11:38595832-38595854 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
1081176680 11:39935704-39935726 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1082097766 11:48145190-48145212 GAGGGAGGCATGTACACAGCTGG - Intronic
1084738925 11:71125534-71125556 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1085174254 11:74472904-74472926 GAGAGAGGCAAGTGAGGGGCCGG + Intergenic
1085601989 11:77863309-77863331 GAGGGATGGAAGTCAGCAGCGGG + Intronic
1086194872 11:84125540-84125562 GATGGGGGCAAGTCAGCTGTAGG + Intronic
1088827365 11:113507219-113507241 GAGCGAGGCAGCTAAGCTGTAGG - Intergenic
1089278829 11:117358328-117358350 GAGGGAGACAAGCATGCTGAGGG - Intronic
1089299449 11:117489818-117489840 CAAGGAGGCAAGGACGCTGCCGG - Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092145792 12:6213826-6213848 GAGGGAGGGAGGGAAGATGCTGG - Intronic
1093402073 12:18758493-18758515 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1093417691 12:18939215-18939237 TAGAGAAGCAATTAAGCTGCAGG - Intergenic
1094320134 12:29174099-29174121 GAGGGAGGGAAGTGATCTCCAGG + Intronic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1095552475 12:43459199-43459221 GAGGGATGGAAGTCAGCAGCAGG - Intronic
1095678138 12:44943837-44943859 GAGTGAGGCAAAAAAGCTGAGGG + Intergenic
1095737931 12:45577855-45577877 GAGGGAGTAAAATAGGCTGCCGG + Intergenic
1095893109 12:47253029-47253051 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1096440373 12:51637629-51637651 GAGGGAGGTGAGGAAGCTGCAGG + Intronic
1096939396 12:55325689-55325711 GAGGGATGGAAGTCAGCAGCAGG - Intergenic
1097782519 12:63724480-63724502 AAAGGAGGCAAGTAACCTTCTGG + Intergenic
1100871472 12:98914621-98914643 AAGGGAGGCCAGTGAGCTGGAGG - Intronic
1101023990 12:100582876-100582898 GAGGGAGCCAAGGAATATGCAGG - Intronic
1101969221 12:109301113-109301135 GAGGGAGGAAAGAAACCGGCAGG + Intronic
1104187865 12:126449641-126449663 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1104866782 12:131960731-131960753 GAGGGAGCGAAGGGAGCTGCGGG - Exonic
1105839376 13:24240486-24240508 GAGGGAGGCAGGTGAGGTGAGGG + Intronic
1107156426 13:37172374-37172396 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
1108010310 13:46000496-46000518 GAAAGAGGTAAGGAAGCTGCAGG - Intronic
1109594004 13:64525854-64525876 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1109680715 13:65748439-65748461 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1110987074 13:81984411-81984433 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1114383852 14:22236765-22236787 GAGGGATGGAAGTCAGCAGCAGG - Intergenic
1114384827 14:22243812-22243834 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1116013927 14:39383848-39383870 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1116016501 14:39414270-39414292 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1116467755 14:45253292-45253314 CAGGGACGCAAGAAAACTGCAGG + Exonic
1116946282 14:50838312-50838334 TAGGTAGGCAAGTGTGCTGCTGG + Intergenic
1117171812 14:53108157-53108179 GAGGGATGGAAGTCAGCGGCAGG - Intronic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1117820030 14:59638683-59638705 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1117932349 14:60856395-60856417 GAGAGAGGTGAGAAAGCTGCAGG + Intronic
1118329227 14:64802759-64802781 GAGGCAGGGAAGCAGGCTGCTGG - Intronic
1118517074 14:66542078-66542100 GAGTGAGACAAGAAAGCTGAGGG - Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119658758 14:76436030-76436052 GAGGGAAGCAAAGAAGATGCTGG - Intronic
1120592274 14:86390380-86390402 GAGGGAGGCCAGTGGGCTGAGGG + Intergenic
1121221553 14:92289096-92289118 GAGGGAGGCAGGAAGGCTTCCGG - Intergenic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1122148352 14:99707579-99707601 GATGGAGACCAGTATGCTGCTGG + Exonic
1122849964 14:104522789-104522811 GAGGGAGGCCAGCACACTGCAGG - Intronic
1123885650 15:24725418-24725440 AAGGGAGGGAAGGAAGCAGCTGG - Intergenic
1124966683 15:34437291-34437313 GGGGGCGGCGCGTAAGCTGCGGG - Intronic
1126692175 15:51296155-51296177 GAGGCAGGCAAGTCAGTTGGGGG + Intronic
1126728339 15:51655603-51655625 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1127074516 15:55312204-55312226 GAGGGATGGAAGTCAGCGGCGGG + Intronic
1127958498 15:63873263-63873285 GAAGGAAGCAAGGAAGCTGTGGG - Intergenic
1129332127 15:74833133-74833155 GAGGGAGGGAAGGAAGGAGCAGG - Intergenic
1129521738 15:76190553-76190575 GAGGGAGGCGGGACAGCTGCTGG + Intronic
1132519108 16:379252-379274 GAGGGAGACAGGTGAGCAGCAGG + Intronic
1138562904 16:57812627-57812649 GAGGGTGGCAAGAAAACGGCTGG + Intronic
1140803962 16:78515640-78515662 GAGGCCGGCAAGAAAGCTGACGG - Intronic
1141548144 16:84786158-84786180 GATGGAGGCAGGAAAGCTGGAGG - Intergenic
1142953076 17:3500129-3500151 GAGAGAGGTGAGGAAGCTGCAGG + Exonic
1143247368 17:5498316-5498338 GACGGAGGAAAGGAAGCTGGGGG + Intergenic
1143442897 17:6989241-6989263 GAGAGAGATAAGGAAGCTGCAGG + Intronic
1143684014 17:8499269-8499291 GGAGAAAGCAAGTAAGCTGCAGG - Exonic
1144853649 17:18256714-18256736 GAGTGAGGGAGGGAAGCTGCAGG - Intronic
1145047984 17:19634112-19634134 GAGGGAGACAAATAAGCTAAGGG - Intergenic
1148456332 17:47813406-47813428 GTGGGGGGCAAGGAAGGTGCAGG + Intronic
1148793060 17:50184379-50184401 GAGGGTGGAAAGTGAGCAGCGGG + Exonic
1149274554 17:55018326-55018348 GAGGGATGGAAGTCAGCAGCGGG + Intronic
1152241517 17:79163694-79163716 GAGGGAAGCAAGTGGGGTGCGGG - Intronic
1152840812 17:82566868-82566890 GAGGAAGGCGAGTGACCTGCTGG - Intronic
1153133137 18:1880966-1880988 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
1153815704 18:8788233-8788255 AAGGGAGCAAAGAAAGCTGCCGG - Intronic
1153846937 18:9058492-9058514 GAAGGAGGCATGTACACTGCAGG - Intergenic
1154341690 18:13508187-13508209 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1156483017 18:37447952-37447974 GATGGAAGCAAGGGAGCTGCAGG - Intronic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1158470803 18:57735226-57735248 GAGGGATGGAAGTCAGCGGCGGG - Intronic
1158570207 18:58591688-58591710 GAAGGAGGCAGGAAAGCTTCAGG + Intronic
1159276122 18:66223468-66223490 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1160312697 18:77810705-77810727 GAGGGAGACAAGGCGGCTGCAGG - Intergenic
1160988396 19:1850758-1850780 GAGGGAGCCAAGCAGGCTTCTGG + Intergenic
1161554769 19:4934774-4934796 TAGGGAGGTCAGTGAGCTGCGGG + Intronic
1162148841 19:8630882-8630904 GATGGAGGTAGTTAAGCTGCAGG - Intergenic
1162936827 19:13985698-13985720 CAGGAAGGAAAGTAAGCTGGGGG + Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1164750573 19:30651431-30651453 GAGGGAGGAAGGGAAGCTCCAGG + Intronic
1165725871 19:38112453-38112475 AAGGGAGGGAGGTCAGCTGCAGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166887861 19:45972850-45972872 GAGGGAGGCTGGGAAGCTCCCGG + Intronic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
1168138352 19:54366977-54366999 GAGGAATTCAAGTAGGCTGCTGG + Intronic
1168492309 19:56821311-56821333 GAGGGAGCCAGGAAAGCTGTGGG - Intronic
925837461 2:7960012-7960034 GAAGGAGGAAAGAAAGCAGCCGG + Intergenic
926150562 2:10423389-10423411 CAGGGAGGCAAGCATGCTGGTGG + Intronic
927638678 2:24833503-24833525 AAGGGAGGCGGGTATGCTGCTGG - Intronic
928319124 2:30269293-30269315 GAGGGATGGAAGTCAGCGGCGGG - Intronic
929542359 2:42832127-42832149 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
929567938 2:43001155-43001177 GAGGGAGTCAAGTGACCAGCAGG - Intergenic
930102948 2:47617293-47617315 GAGGGAGGCAAACAAGTTGAGGG - Intergenic
930237656 2:48903280-48903302 GAGGGATGCCAGTAAGAGGCTGG - Intergenic
930454624 2:51590894-51590916 GAGGGATGGAAGTAAGATGCCGG + Intergenic
930831377 2:55747251-55747273 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
936531642 2:113280106-113280128 GAGGGGGGCAAGGAAGGTGCAGG + Intergenic
937666696 2:124495950-124495972 GAGGGAGACACGTATTCTGCTGG - Intronic
938392874 2:130918614-130918636 GAGGGCGGCAGATAAGGTGCTGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940398754 2:153222643-153222665 GAGGGAGGCCAGTGACCTGAGGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
945211200 2:207384406-207384428 GAGAGAGGCAATAAAGATGCTGG + Intergenic
945395001 2:209306618-209306640 GAGGGATGGAAGTCAGCGGCCGG - Intergenic
946119337 2:217495824-217495846 AAGGGAGGCATGTGAGCTCCGGG - Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
947050407 2:226036358-226036380 GAAGGAGATAAGGAAGCTGCAGG + Intergenic
947458637 2:230282720-230282742 GAGGGAGGCAAGTTAGTGCCTGG + Intronic
948519899 2:238529370-238529392 GAGGGAAGGAAGTTAGCTGGGGG + Intergenic
948955088 2:241283224-241283246 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
948961694 2:241343991-241344013 GAGGGCGGCAATGAAGCTGCTGG - Intronic
1169768977 20:9180984-9181006 GAGTGAGGCACTTAAGCTGCAGG + Intronic
1170682761 20:18541164-18541186 GAGAGAGGTAAGGAAGCTGCAGG - Intronic
1170870050 20:20197380-20197402 GAGGTATGCAAGTAAGATGGAGG - Intronic
1171388065 20:24783522-24783544 GATGGCGGGAAGTCAGCTGCTGG - Intergenic
1171500791 20:25591460-25591482 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1174189064 20:48727389-48727411 GAGAGAGGCAAGGGGGCTGCAGG - Intronic
1174641621 20:52049558-52049580 GAGGGAGGCAATTAAGGTCGAGG + Intergenic
1174670811 20:52306005-52306027 GGGTGAGGCAAGTCAGCTGCAGG + Intergenic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1177046150 21:16172742-16172764 GAGAGAGGCGAGGAAGCTGCAGG - Intergenic
1177234422 21:18368528-18368550 GAGAGTGGCAAGTAAGGAGCAGG + Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179783988 21:43719465-43719487 GAGGGAGGCTCGGGAGCTGCGGG + Intronic
1181461913 22:23090648-23090670 GAGGGAGGCAAGCAGGCATCAGG - Intronic
1181546568 22:23605682-23605704 GGGGGAGGCCAGTGAGATGCTGG + Intergenic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1182895802 22:33858255-33858277 GAGGGATGGAAGTCAGCGGCAGG + Intronic
1183710686 22:39501741-39501763 GAGGGAGGCGAGGAAGGGGCTGG + Intronic
1184340122 22:43881430-43881452 GAGGGACGCAGGTAAGCAGGTGG + Intronic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1185050884 22:48553425-48553447 GAGGGAGGGAAGCAGGATGCAGG + Intronic
1185335236 22:50268316-50268338 GAGGGAGGCCCGTCTGCTGCAGG - Intronic
949811671 3:8012939-8012961 GAGGGATGGAAGTCAGCCGCGGG + Intergenic
950471107 3:13186954-13186976 GAGGGAAGGAAGTAAGGAGCGGG - Intergenic
951326072 3:21303102-21303124 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
951670309 3:25174306-25174328 GAGGGAGGCAAATGCACTGCAGG - Intergenic
951837646 3:27001168-27001190 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
953193526 3:40711704-40711726 CAGGGAGGCATGCAAGGTGCTGG - Intergenic
954507359 3:51090035-51090057 GAGGTGGGCAAGCAAGCAGCTGG - Intronic
954963933 3:54593462-54593484 GAGGGAGGGAAGGAAGGTGAAGG + Intronic
955379400 3:58424793-58424815 GCAGGAGGCAAGGGAGCTGCTGG - Exonic
956163105 3:66375187-66375209 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
956853725 3:73255707-73255729 GTGGGAGGAAAGAAACCTGCAGG - Intergenic
957000504 3:74877912-74877934 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
957036063 3:75294228-75294250 AAGGCAGGCAAGAAAGCTTCTGG - Intergenic
957687045 3:83515320-83515342 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
957927146 3:86828794-86828816 AAGGGAGGAAAGAAAGCTGGAGG + Intergenic
958630366 3:96675019-96675041 GAGGGATGTAAGTCAGCAGCGGG + Intergenic
960863227 3:122173731-122173753 GAGAAAGGTAAGTAAGCTGCAGG - Intergenic
960945844 3:122966037-122966059 GAGAGATTCAAGTTAGCTGCTGG - Intronic
961624746 3:128254198-128254220 GAGGAAGGCAAGTTTGCTTCTGG + Intronic
961817320 3:129557858-129557880 CAGGGAGGCAGGAAAGCAGCCGG - Intronic
962409978 3:135132641-135132663 GAGGCAGACAAGAGAGCTGCCGG + Intronic
962986149 3:140537878-140537900 GAGTGAGTCAGGTAGGCTGCTGG + Intronic
963102709 3:141622010-141622032 GAGGGAGGTGGGGAAGCTGCTGG + Intergenic
963545855 3:146658003-146658025 GTTGGAGCCAAGGAAGCTGCAGG + Intergenic
963575888 3:147060182-147060204 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
963915313 3:150854403-150854425 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
963961564 3:151314843-151314865 GAGGAAGGGAAGTGAGCTCCTGG + Intronic
969032611 4:4226770-4226792 GAGGGAGGCGAGCAGGCCGCTGG + Exonic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969162620 4:5274827-5274849 GAGGGATGAAAGTCAGCGGCGGG - Intronic
969601025 4:8176471-8176493 CAGGGAGGCAAGTATGATGGTGG + Intergenic
970738111 4:19198109-19198131 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
973245874 4:48010807-48010829 GAGGGATGGAAGTCAGCAGCAGG + Intronic
974190092 4:58493391-58493413 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
974536945 4:63185879-63185901 GAGGGAGGGAAGCAATCTCCAGG - Intergenic
975313225 4:72925995-72926017 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
976207913 4:82639802-82639824 GAGGAAGGAGAGGAAGCTGCTGG - Intronic
977762225 4:100752533-100752555 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
978379440 4:108111601-108111623 GAGGGAGGCAAGAAAGGTGCTGG + Intronic
978587557 4:110290069-110290091 GAGGGAGACAAGAAAGCAGGAGG - Intergenic
978902701 4:113971947-113971969 GAAGGAGTCAAGTAAGCTTAGGG - Intronic
979597274 4:122547806-122547828 GAGAAAGGCCAGTAAGCTGAAGG - Intergenic
980603938 4:135064551-135064573 GAAGGAGGCACCTAATCTGCAGG + Intergenic
981483435 4:145260400-145260422 GAGGAATTCAAGTAGGCTGCAGG - Intergenic
981509858 4:145544181-145544203 GAGGGAGGCTAGGAAGGTGTGGG + Intronic
981944694 4:150327492-150327514 CAGGGAGGCATGTGGGCTGCCGG - Intronic
982036358 4:151349814-151349836 GAGAGAGGTAAGGAAGCTGCAGG + Intergenic
983777796 4:171629912-171629934 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
984663996 4:182405836-182405858 AAGGCAGGCAAGAAAGCTGGAGG + Intronic
985552092 5:538892-538914 GAGAGAGTCAAGGAAGCAGCCGG + Intergenic
985640154 5:1059791-1059813 GAGGGAGGGAAGCGAGCTGGAGG - Intronic
986668528 5:10123981-10124003 GAGAGAGGCAAGCAAGCCCCCGG - Intergenic
987508228 5:18800456-18800478 GAGGGATGGAAGTCAGCAGCGGG - Intergenic
990113784 5:52363271-52363293 GAGGGAGGATAGTATGCTCCAGG - Intergenic
990464707 5:56061076-56061098 GAGGGAGGCAAGTATGCCCAGGG + Intergenic
992083804 5:73259971-73259993 TAGGGAAGCCAGTAAGCTGAGGG + Intergenic
992116176 5:73540505-73540527 GAGGGAGGGAGGAAAGCGGCAGG + Intergenic
992362907 5:76060537-76060559 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
993054986 5:82970956-82970978 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
993982339 5:94557924-94557946 GAGGGATGGAAGTTAGCAGCGGG - Intronic
994683444 5:102919351-102919373 GAGGGAGGCAACAAAGCTGTGGG - Intronic
994760951 5:103853345-103853367 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
997364638 5:133318214-133318236 GAGGGATGCAAGCAAGGTGAGGG - Intronic
1000095453 5:157967402-157967424 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
1000367755 5:160506732-160506754 GAGAAAGGAAAGAAAGCTGCTGG - Intergenic
1001106446 5:168858610-168858632 GAGGGAGCTCAGAAAGCTGCTGG - Intronic
1002327008 5:178416319-178416341 GAGGGAGGCAGGCCAGCTGCAGG - Intronic
1004256413 6:14068840-14068862 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
1004864231 6:19837687-19837709 GAGGGAGGCAGGCAAGCTCCGGG - Exonic
1005816658 6:29558618-29558640 GAGGGATGGAAGTCAGCCGCGGG - Intronic
1006197548 6:32255110-32255132 GAGGGAGAGAAGGAAGCTGAGGG + Intergenic
1006780934 6:36631807-36631829 CAGGGAGGCATGTGAGCAGCTGG + Intergenic
1006902297 6:37511021-37511043 GAGGGAGCCATGTAGGCTTCAGG - Intergenic
1007166141 6:39830412-39830434 GAGGGAGGCAGGTGGGCTTCAGG + Intronic
1007661594 6:43490098-43490120 GAGGGAGGCAGCCAGGCTGCGGG - Intronic
1008516256 6:52322094-52322116 GAGGGAGGTGAGGAAGCTTCAGG - Intergenic
1009519546 6:64664042-64664064 GAGGGATGGAAGTAAGCGGCAGG + Intronic
1009964808 6:70566994-70567016 GAGAGCGGCAAGTAAGCACCTGG + Exonic
1016343649 6:143087535-143087557 GAGGGATGGAAGTCAGCGGCGGG + Intronic
1018219608 6:161565171-161565193 GAGGGAGGCTAAGAAGCTGAGGG - Intronic
1018238470 6:161749441-161749463 GAGGAAGGAAAGTAATTTGCAGG + Intronic
1018760552 6:166891225-166891247 GAGGGATGGAAGTCAGCGGCGGG - Intronic
1021885339 7:25131920-25131942 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1022989917 7:35696672-35696694 GAGGGATGGAAGTCAGCTGTGGG - Intergenic
1024148016 7:46536751-46536773 AAGGGAGGGAAGTCAGCGGCGGG + Intergenic
1024228497 7:47346364-47346386 AAGGGAGACAAGCAGGCTGCAGG + Intronic
1024230662 7:47361021-47361043 GAGGGAGGGAAGTAAGCAAGTGG - Intronic
1024603270 7:51005457-51005479 TAGGGTGTCAAGAAAGCTGCTGG - Intergenic
1025785620 7:64640909-64640931 GAGGGAAACAGGTAAGATGCTGG + Intergenic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1027546105 7:79529416-79529438 GAGAGGGGCAGGTAAGCAGCTGG + Intergenic
1028013988 7:85684138-85684160 GAGGGATGGAAGTCAGCTGCGGG - Intergenic
1028467003 7:91163739-91163761 GAGGGAGGAAAGGAAGTTGTTGG - Intronic
1028993390 7:97074823-97074845 GAGGGATGGAAGTCAGCAGCAGG - Intergenic
1029991578 7:104967312-104967334 CAGGGAGCAAAGTAAGCAGCTGG + Intergenic
1030061068 7:105621752-105621774 GAGAGAGGCCAGGGAGCTGCTGG - Intronic
1031234620 7:119158800-119158822 GAGAGAGGTATGAAAGCTGCGGG - Intergenic
1031742824 7:125455912-125455934 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
1032854249 7:135821206-135821228 GCAGGAGACAAGTAAGCAGCTGG - Intergenic
1035633467 8:1126467-1126489 GAGGGAGGCAAGGCAGGTGAGGG + Intergenic
1039652672 8:39359145-39359167 GAGAGAAGTGAGTAAGCTGCAGG + Intergenic
1039824525 8:41161732-41161754 GAGGGAGGCAAGAAAGAAGAAGG - Intergenic
1040648865 8:49428351-49428373 GAGGGAGGGAAGTGATCTCCAGG - Intergenic
1041694700 8:60723549-60723571 GGGGGAAGCAAGTACTCTGCTGG + Intronic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1045650588 8:104338634-104338656 GAGGGAGGGAGGAAAGCTGAGGG - Intronic
1046024406 8:108704779-108704801 GAGGGAGGGAGGTTACCTGCAGG + Intronic
1047229605 8:122985190-122985212 CAGGGAGTTAAGTAAGCTTCTGG + Intergenic
1047493038 8:125390020-125390042 GAGGCAGGCAAGTAAAATGCTGG + Intergenic
1048752492 8:137696021-137696043 GAGGGAGGCAAGGAGGTTTCTGG - Intergenic
1050393228 9:5168371-5168393 GAGGAAGACAAGTAACCTGATGG + Intronic
1050766488 9:9141194-9141216 GAGGGAGGGAAGCAAGCAGATGG - Intronic
1051084898 9:13337358-13337380 GAAAGAGGTAAGGAAGCTGCAGG - Intergenic
1051562705 9:18459912-18459934 GTGGGAGGAAGGTAGGCTGCAGG + Intergenic
1051699192 9:19801389-19801411 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1051970174 9:22878044-22878066 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1055431340 9:76247191-76247213 GAGGGATGGAAGTCAGCGGCAGG + Intronic
1056695548 9:88847272-88847294 GAGAGAGGCAAGAAAGCTGCAGG - Intergenic
1057473920 9:95382744-95382766 GAAGGAGGAAAATAAACTGCTGG + Intergenic
1057546303 9:96022014-96022036 GAGGAAGGGAAGGCAGCTGCAGG - Intergenic
1057976375 9:99609925-99609947 GAGGAGGGCATGTAGGCTGCTGG - Intergenic
1060183915 9:121552380-121552402 GAGGGAGGAAAGTAGGCTGGTGG - Intergenic
1060460471 9:123848929-123848951 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061187541 9:129063509-129063531 AAGGGAGGGGAGTGAGCTGCCGG - Intronic
1061859580 9:133460959-133460981 GAGGGAGGCAGGTCAGCTCCAGG + Intronic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1186429242 X:9490286-9490308 GATGGAATCAAGGAAGCTGCAGG - Intronic
1187131928 X:16511618-16511640 GATGGAGGCCATTAAGCTGGAGG - Intergenic
1187613820 X:20971887-20971909 GAGGGATGGAAGTCAGCAGCGGG - Intergenic
1189755218 X:44264417-44264439 GGGAGAGGCAAGTCAGCTGGTGG - Intronic
1193295493 X:79827537-79827559 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1194103278 X:89734556-89734578 GAGGGATGGAAGTCAGCGGCTGG + Intergenic
1195584606 X:106551422-106551444 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1195599137 X:106726608-106726630 GAGGGAGGAAAGGACACTGCGGG - Intronic
1195913345 X:109911638-109911660 GAGGGAGGCATGGAACCTGGGGG + Intergenic
1196410351 X:115411921-115411943 GAGGGAATGAAGTAAGCAGCTGG - Intergenic
1198566838 X:137913880-137913902 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1199268784 X:145858474-145858496 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1199603634 X:149559126-149559148 GAGGAAGGCAAGAGAACTGCTGG - Intergenic
1199646753 X:149920348-149920370 GAGGAAGGCAAGAGAACTGCTGG + Intergenic
1200373651 X:155756151-155756173 AAGGGAGGCCAGCATGCTGCAGG - Intergenic
1201143774 Y:11050425-11050447 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1201530378 Y:14984803-14984825 GAGGGAGGGAAGTGATCTCCAGG - Intergenic
1201989723 Y:20010243-20010265 GAGGGAGGGAAGGAATCTCCAGG + Intergenic