ID: 1119057831

View in Genome Browser
Species Human (GRCh38)
Location 14:71441309-71441331
Sequence CAAAATATTTAGATGGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119057822_1119057831 22 Left 1119057822 14:71441264-71441286 CCAAAGTCTTGCAGAGGGAGATT 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1119057831 14:71441309-71441331 CAAAATATTTAGATGGGATCTGG 0: 1
1: 0
2: 1
3: 23
4: 207
1119057827_1119057831 -4 Left 1119057827 14:71441290-71441312 CCTTGGAGCATAGGCTGGCCAAA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1119057831 14:71441309-71441331 CAAAATATTTAGATGGGATCTGG 0: 1
1: 0
2: 1
3: 23
4: 207
1119057826_1119057831 -3 Left 1119057826 14:71441289-71441311 CCCTTGGAGCATAGGCTGGCCAA 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1119057831 14:71441309-71441331 CAAAATATTTAGATGGGATCTGG 0: 1
1: 0
2: 1
3: 23
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119057831 Original CRISPR CAAAATATTTAGATGGGATC TGG Intronic
902781856 1:18710108-18710130 CAAAGTGCTTACATGGGATCTGG - Intronic
903117227 1:21188276-21188298 CAGGATATTTAAATGGCATCAGG - Intergenic
907078850 1:51602831-51602853 CAAAATATGTTGATGGAATAAGG + Intronic
908293838 1:62693462-62693484 CAAGAGATCTAGATGGCATCAGG - Intergenic
909526199 1:76625541-76625563 CAAAATATTTAGATTCAATTTGG + Intronic
909612591 1:77568758-77568780 GAAAATATAAAGATGGGATTGGG - Intronic
911710378 1:101064673-101064695 CAAAATATTAAGAAGGTAGCTGG - Intergenic
914889314 1:151608710-151608732 AAAAATATTTAGAAAGGATCAGG - Intergenic
918861582 1:189833092-189833114 CAAAGTATTTGAAGGGGATCAGG - Intergenic
919084762 1:192908954-192908976 CAAAATAGTTAGCCTGGATCTGG - Intergenic
919965244 1:202516704-202516726 AAAACAATTTAGATGGAATCAGG - Intronic
921402513 1:214741505-214741527 CAAAAAAATTAGCTGGGACCAGG - Intergenic
923026341 1:230207476-230207498 AGAAATATTTACATGGAATCAGG + Intronic
924381946 1:243473826-243473848 GAAAATATTTTTATGGAATCAGG + Intronic
924480114 1:244422653-244422675 CAAAATATTGAGTAGGGAGCAGG - Intronic
924694430 1:246383664-246383686 CAAAATATCAAGATGGGGTCAGG + Intronic
1062845880 10:704703-704725 CAAAATATTTAGGGAGGAACAGG + Intergenic
1064437473 10:15323647-15323669 CAAAACATTTTAATGGCATCAGG + Intronic
1064854593 10:19752308-19752330 AAAAATATTTACATGTGATTTGG + Intronic
1067423928 10:46186888-46186910 TAATATATTTGGATGGGATGGGG - Intergenic
1070330084 10:75410126-75410148 CAAAATTTTTAAATGGCACCTGG - Intergenic
1071447077 10:85758522-85758544 CAAACTTTTTACATGGCATCTGG + Intronic
1071763590 10:88636576-88636598 CAAAATAACTAGATAGCATCAGG - Intergenic
1072191161 10:93077166-93077188 CAAAATATTTACAGTGGAGCTGG + Exonic
1074343512 10:112657521-112657543 CAAAATATTTAGAACTCATCTGG - Intronic
1075367974 10:121909748-121909770 CAAAATATTTCACTGGGAGCTGG + Intronic
1076142602 10:128091690-128091712 CAAATTGTTTAGGTGGCATCTGG + Intergenic
1077243581 11:1524851-1524873 CAAAATAATGAAATGGGACCCGG - Intergenic
1078619659 11:12895358-12895380 CCACATATTAAGATGGCATCAGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080052545 11:27871755-27871777 CAAAATCTGTAGATAAGATCAGG + Intergenic
1080764931 11:35287160-35287182 CAAAATATTTTCATTGGTTCTGG + Intronic
1082968915 11:58998586-58998608 CAGACTAGTTAGATTGGATCTGG + Intronic
1086429259 11:86719382-86719404 CAAAATATTTATAAGGGCTAAGG - Intergenic
1087832727 11:102837171-102837193 CAAAATTTTGAGAAGGGAACTGG + Intronic
1088525995 11:110755798-110755820 CAAAATATTCAGATACAATCTGG - Intergenic
1089146352 11:116332083-116332105 AAAAATATTTAAATGGGATAAGG - Intergenic
1092000891 12:5031257-5031279 CAAAATATCAAGATGGGATCAGG + Intergenic
1094044390 12:26151325-26151347 CAAAATATTTAGATTAGAACTGG + Intronic
1098837487 12:75440239-75440261 GAAAATATTTAGAAGAGATCTGG - Intergenic
1098941378 12:76541181-76541203 AAAATTATTTAGATGTGGTCAGG + Intronic
1099307832 12:80980589-80980611 CAAACTATTTTGATTGGATTTGG + Intronic
1100515558 12:95324210-95324232 CAAAATATCTAGATGCTTTCTGG - Intergenic
1103220193 12:119237802-119237824 AAAAATATTTAGCTGGGTACAGG - Intergenic
1107784988 13:43946546-43946568 CAAATTAGTTAGATGAAATCTGG + Intergenic
1110111572 13:71753942-71753964 CAAAATATTTTAATTGGTTCAGG + Intronic
1110252795 13:73399585-73399607 CTAAATATTTAAATGAGAACTGG - Intergenic
1111333166 13:86787810-86787832 CAAAATATATAGCTAGGATGTGG - Intergenic
1111369259 13:87294981-87295003 TAAAATAAATAGATGGGATAAGG + Intergenic
1112780056 13:102890617-102890639 CAGAATATATAAATGGGATGGGG - Intergenic
1113584559 13:111456105-111456127 CTAAATATTTTGATGGGGTGGGG - Intergenic
1116517599 14:45819585-45819607 CCTAATATTTAGATGGGAAGAGG - Intergenic
1117457789 14:55915084-55915106 CAAGATATTTAAATGGAATGTGG - Intergenic
1119057831 14:71441309-71441331 CAAAATATTTAGATGGGATCTGG + Intronic
1120216761 14:81688837-81688859 GAAAATATTAGGATGGGAACAGG - Intergenic
1202905762 14_GL000194v1_random:71741-71763 CAACATATTCAGATGGCAGCGGG - Intergenic
1127703412 15:61524377-61524399 CTAAATATTTAGATTGGCTCAGG - Intergenic
1135358128 16:21787786-21787808 TAAAACATTGAGATGGGGTCAGG + Intergenic
1135456633 16:22603910-22603932 TAAAACATTGAGATGGGGTCGGG + Intergenic
1136130624 16:28218547-28218569 CAAAATATTGACAAGGGAACCGG + Intergenic
1137362978 16:47837184-47837206 CAAAATCTTTACATTTGATCTGG + Intergenic
1137850193 16:51734025-51734047 TCAAATATTTTGATGGGATTTGG + Intergenic
1138036710 16:53614525-53614547 CCAAATTTTTAAATGGGATCAGG + Intronic
1138852167 16:60642196-60642218 CAAAATATTTAGAGTAGATTAGG - Intergenic
1138886470 16:61085821-61085843 TTAAAGATTTAGATTGGATCAGG + Intergenic
1139875102 16:70139782-70139804 CAAAATATTTAGATACCATTTGG - Intronic
1140360681 16:74341349-74341371 CAAAATATTTAGATACCATTTGG + Intergenic
1141743446 16:85909778-85909800 CAAAGTACTGAGCTGGGATCTGG + Intronic
1144647108 17:16982557-16982579 CAATATATTCAGATGGAATAAGG + Intergenic
1145107044 17:20126514-20126536 AAAAATATTTAGTTTGGAACTGG + Intronic
1148393199 17:47288408-47288430 GAAAATATTTAAATTGAATCAGG + Intronic
1149181239 17:53939505-53939527 AAAAATGTAGAGATGGGATCTGG - Intergenic
1150364566 17:64570143-64570165 CAAAAAATTTAAATGAGAACTGG - Intronic
1150584661 17:66506305-66506327 AAAATTATTTACTTGGGATCTGG + Intronic
1155062007 18:22237113-22237135 CAAAATATTAAGATGTCATTGGG + Intergenic
1155795630 18:30033408-30033430 CAAAATACATAGATTTGATCAGG - Intergenic
1158086492 18:53657477-53657499 GAAGCTATTGAGATGGGATCTGG + Intergenic
1161350501 19:3788636-3788658 AAAAAAATAGAGATGGGATCTGG + Intronic
1163325204 19:16599117-16599139 CAAAATGATTCGATGGCATCTGG - Intronic
1167082257 19:47284896-47284918 TAAAATATTTAGAAGAGATGGGG + Intergenic
924974901 2:163560-163582 CAAAAAATCTAGATGGGATGAGG + Intergenic
925914461 2:8595077-8595099 GAAAATATTCAGATGTGAACAGG - Intergenic
926246851 2:11128087-11128109 TAAAATAATGAGATGGGACCTGG - Intergenic
927115396 2:19895858-19895880 CAAAAAATGTAGATGGCATATGG + Intergenic
927683818 2:25157385-25157407 CAAAGCAGTTTGATGGGATCTGG + Exonic
928821679 2:35369096-35369118 CAACATAATTAGATGTGATTTGG - Intergenic
929376674 2:41295822-41295844 CAAATTATTTAGATGTGGTAAGG + Intergenic
930692979 2:54383316-54383338 AACATGATTTAGATGGGATCAGG - Intronic
930818732 2:55624254-55624276 CAAAAAAATTAGAAAGGATCAGG - Intergenic
931176524 2:59860292-59860314 CAAAATCTTTAAATGAGTTCTGG + Intergenic
932537492 2:72615047-72615069 CAAAATATTTAAATGGGGGAGGG + Intronic
934962611 2:98690220-98690242 CATAATATGTGGATGGGGTCAGG + Intronic
935996743 2:108782181-108782203 CAAACTTTATAGATGGGATCGGG + Exonic
937008707 2:118542519-118542541 CAAATGATTTAGATGGGAGAGGG + Intergenic
937805402 2:126137121-126137143 AAAAATATCTAGATGGAATATGG - Intergenic
937997316 2:127704320-127704342 GAAAATTTTTAAATGTGATCTGG + Exonic
938940820 2:136168177-136168199 CACAATCTTTTGATGTGATCAGG + Intergenic
939575577 2:143891091-143891113 CTAAATATTTAGATGGAATGCGG + Intergenic
940071569 2:149694057-149694079 CAAAAGATTTAGTTTGGCTCAGG - Intergenic
940351234 2:152691080-152691102 CAAAATCTTTAGAGAGGATGAGG - Intronic
940447848 2:153798530-153798552 CAAAATATTTATATGCAAACTGG + Intergenic
941556326 2:166987143-166987165 CAGAAGTTTTAGATGGGATGAGG + Intronic
942716405 2:178897557-178897579 CAAAATATTCAGTTAGGATGAGG + Intronic
943327976 2:186524547-186524569 CTAAATATTTAGATTGTATTTGG - Intergenic
943498926 2:188661577-188661599 TAAAATTTGTAGATGGGAGCAGG - Intergenic
944827024 2:203494511-203494533 GAAAATATTTACATGGGGCCAGG + Intronic
947310113 2:228792432-228792454 CAAAATATTTACATTGTATTAGG + Intergenic
1169144579 20:3244059-3244081 AAAAATATTTGGAGGGGAACAGG - Intergenic
1172341801 20:34163861-34163883 CAAAATAATTAAATGAGATCAGG + Intergenic
1172366532 20:34354272-34354294 CAAAAAAATTAGATGGGACTGGG - Intergenic
1173409918 20:42801178-42801200 CAAAATAATGTGATGGCATCTGG - Intronic
1174751956 20:53120069-53120091 CCAATTATCTAGATGGGATGTGG - Intronic
1175157728 20:56983427-56983449 TAAAATATTTACAAAGGATCTGG - Intergenic
1176013937 20:62918429-62918451 GAAAATCTTTAGGTGGGAGCTGG - Intronic
1177681427 21:24376163-24376185 CAAAATATTTTTATTGCATCTGG - Intergenic
1180730265 22:17976178-17976200 CAAAATATGTTGTGGGGATCAGG + Intronic
1180731624 22:17986561-17986583 CAGCCTACTTAGATGGGATCGGG - Intronic
1181720306 22:24769200-24769222 CAAAGTATTTACATGGTATTAGG - Intronic
949153068 3:793815-793837 CAAAAAAATTAGCTGGGTTCGGG + Intergenic
949231470 3:1755985-1756007 TAAAATATTCAGATGGGGCCAGG + Intergenic
949457977 3:4259499-4259521 CAAAATATTTGGATTCGATGTGG + Intronic
950509454 3:13417030-13417052 CAAAATATCTAGAAGGAATCAGG + Intronic
952971312 3:38651936-38651958 CAAAAAATTTAAATAGGGTCTGG - Intergenic
954217897 3:49134481-49134503 CAAAATAAATAGATGGGGCCTGG - Intergenic
954979163 3:54728233-54728255 CAAAAAATAAATATGGGATCTGG - Intronic
955980015 3:64515391-64515413 CAATATATTTAGGTGGGCTTTGG - Intergenic
956252715 3:67251893-67251915 CAAACTCTTCAGATGGGACCAGG - Intergenic
957943384 3:87033486-87033508 CAAAATATTTGCAAGGGATCTGG + Intergenic
959858863 3:111193810-111193832 CTAATTATTTAGCTGGGATTTGG + Intronic
960709549 3:120513752-120513774 CATAAAATTTAGAGGAGATCTGG - Intergenic
964181378 3:153891111-153891133 CAAAATAAGTAGATGAGGTCTGG - Intergenic
964385436 3:156142805-156142827 GGAAATATTTTGGTGGGATCTGG - Intronic
964920866 3:161893708-161893730 GAAAAAGTTTAGATGGGGTCAGG - Intergenic
967600234 3:191378182-191378204 CCAAATATTTAGAGGGGAAATGG - Intronic
967841898 3:194011798-194011820 CAAGATATTTACATCTGATCAGG - Intergenic
972873576 4:43330056-43330078 AAACATATTTAGATTGTATCAGG - Intergenic
973228852 4:47819104-47819126 AAAAATATTTAAAAGGGAGCTGG + Intronic
973974705 4:56251101-56251123 CAAAGTATTTATATGCCATCAGG - Intronic
974247638 4:59341244-59341266 CAAAATAATTAGTTGACATCAGG + Intergenic
975667231 4:76744150-76744172 CAAAGTATTTAATTGGGATTTGG - Intronic
976556897 4:86460773-86460795 CAAAATAAAGAGATGGGCTCTGG - Intronic
977572398 4:98642553-98642575 GAAAATATTTAGAGGTGATACGG + Intronic
977760939 4:100736143-100736165 CAGAATAGTTACATGGGATGAGG - Intronic
977967043 4:103164931-103164953 AAAAATACTTAGAAGAGATCGGG + Intronic
978320367 4:107487011-107487033 CAAAATTTTTAAATGGTTTCAGG - Intergenic
979168211 4:117564031-117564053 AAAAATATTTAGATGATATATGG + Intergenic
979635099 4:122948188-122948210 CATAGCATTTACATGGGATCAGG + Intronic
981061064 4:140426593-140426615 CAAAATCATCAGATGAGATCGGG + Intronic
981866566 4:149427419-149427441 GAAAATATTAAGATGGCACCAGG - Intergenic
983625315 4:169796328-169796350 CAAAACAGTTGGATGGGGTCGGG - Intergenic
983783384 4:171701199-171701221 CAATATATTTAAATGGGTACTGG + Intergenic
984685105 4:182658471-182658493 CAAAATATGTAGTTGAGATCTGG - Intronic
985220630 4:187700113-187700135 CAAAGTATTCATATGTGATCTGG + Intergenic
987953879 5:24712279-24712301 CAAAATATTTACATTGTATTAGG + Intergenic
988261180 5:28887523-28887545 CATAATATTTTGATGGGGCCAGG + Intergenic
988542645 5:32125493-32125515 CAAAATACTAAGATGGGAGCAGG + Exonic
991395815 5:66204149-66204171 CAGCATATTTATATGGGCTCAGG - Intergenic
993184210 5:84595909-84595931 CAAAATATTTAGATGTCAACAGG - Intergenic
993325532 5:86530860-86530882 AAAAATTTTTAGATGAAATCTGG + Intergenic
993426598 5:87772687-87772709 CACAATCTTTTGATGGGATGAGG - Intergenic
995615022 5:113952170-113952192 CAAAATGTGGAGAAGGGATCTGG + Intergenic
995906737 5:117133497-117133519 CAAAAAATTTAGATGAGAATTGG - Intergenic
997880495 5:137584965-137584987 AAAACTATTTAGATCTGATCAGG + Intronic
999061027 5:148635386-148635408 AAACATATGTTGATGGGATCTGG + Intronic
999895065 5:156023641-156023663 CAAAGTGTTGAGATGGGCTCAGG + Intronic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1002979516 6:2122197-2122219 CTAAAGGTTTAGATGAGATCAGG - Intronic
1002993159 6:2256608-2256630 CAAAATTTGTACATGGAATCTGG - Intergenic
1003193085 6:3891203-3891225 CAAAATTCTTGGATGGGACCTGG - Intergenic
1003443122 6:6161647-6161669 CAAAATATTTTGATAGCATGGGG + Intronic
1003898797 6:10633604-10633626 CAAAATAAGCAAATGGGATCTGG + Intergenic
1004757031 6:18621431-18621453 AAAAATATTTACATGGGCTCAGG + Intergenic
1005979583 6:30826674-30826696 AAAAATATTTAGATTTGCTCAGG + Intergenic
1006739740 6:36299166-36299188 CAAAATAATTGAATAGGATCTGG - Intronic
1009351158 6:62680622-62680644 AAAAATATTGAGATGGGGCCGGG + Intergenic
1009767553 6:68100755-68100777 CAAAAAATTTACATCAGATCTGG + Intergenic
1012695690 6:102379843-102379865 CAAAATAGCTAGCTGGGATTTGG + Intergenic
1013960677 6:115896070-115896092 TAAAATATTTAAAAGGGCTCAGG + Intergenic
1014679781 6:124413580-124413602 CAAAATATCTTGCTGGGATTGGG + Intronic
1015556428 6:134466257-134466279 AAAAATATTTATTTGGCATCTGG - Intergenic
1015592081 6:134831925-134831947 CAAAAAATTTAGATTGGGGCTGG + Intergenic
1015949551 6:138538002-138538024 CAAAATATTTTGATAGAATTTGG - Intronic
1016131575 6:140479043-140479065 CAAAATATTTATTTGGGATTGGG + Intergenic
1016676973 6:146782305-146782327 CAAAGTATCTAGATGGTTTCTGG - Intronic
1021411587 7:20335091-20335113 CAAAATATTTAGTTGGGAGAAGG - Intronic
1022250719 7:28605343-28605365 CACAATATCTAGATGGATTCAGG - Intronic
1024809791 7:53195283-53195305 CAAAATGTTTACATGGAATATGG + Intergenic
1024842092 7:53599316-53599338 AAAAATATTTAGATGTGGGCTGG + Intergenic
1026376657 7:69758304-69758326 CAATAGATTTAGATTGGATAGGG + Intronic
1026531446 7:71201523-71201545 CACAAAATTTAGATTGGATACGG + Intronic
1028834485 7:95359154-95359176 CATAATATTTAGATGATATTAGG - Intergenic
1030432143 7:109463745-109463767 TAAAATAATTATATGGGTTCTGG + Intergenic
1030781480 7:113605930-113605952 AAATCTATTTAGATGGGTTCAGG + Intergenic
1031915855 7:127562389-127562411 CAAAAAATTTAAATATGATCTGG - Intergenic
1032372764 7:131375861-131375883 AATAATATTTAAATGGCATCAGG + Intronic
1032382403 7:131498642-131498664 AAAAATGTAAAGATGGGATCTGG + Intergenic
1033524905 7:142201741-142201763 CATAATGTTTACATTGGATCAGG + Intronic
1033885225 7:145935757-145935779 CAGAATATTTAACTGGGATTAGG - Intergenic
1034127797 7:148689418-148689440 CAAAAACTTTTGATGGGACCGGG - Intergenic
1034578319 7:152020740-152020762 TAAACTGTTTAGCTGGGATCAGG + Intergenic
1037139399 8:15502464-15502486 GAAAATATATATATTGGATCCGG - Intronic
1037601872 8:20403614-20403636 CAGCATGTTTACATGGGATCAGG - Intergenic
1039195593 8:35027877-35027899 TAAAGTATTTAGATGGCATCTGG + Intergenic
1042423658 8:68621024-68621046 CAATATATTGAAATTGGATCTGG + Intronic
1043197082 8:77308893-77308915 TGAAATATTTTGATGGCATCAGG - Intergenic
1045029105 8:98117855-98117877 CAGAATACTTACAAGGGATCTGG - Intronic
1045836566 8:106528279-106528301 CAAAATATTAAGTTGGGAAATGG + Intronic
1046436749 8:114199466-114199488 CAAAACATTTAGAGGTCATCCGG + Intergenic
1046909177 8:119607173-119607195 AAAAATATCTAGATGGTCTCAGG - Intronic
1050281216 9:4052035-4052057 CAAATTATTTAGAAGTGAACAGG - Intronic
1052509899 9:29402654-29402676 TAAAATATTTAACTGGAATCAGG - Intergenic
1052706858 9:32004496-32004518 CAAAGTATTCAGATGTGACCAGG - Intergenic
1053299602 9:36939490-36939512 CAAGACATTTAGATTGGATTTGG - Intronic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1060644215 9:125264165-125264187 TAAAAAATTTGGATGGGATCAGG + Intronic
1186404671 X:9291448-9291470 CACAATAATTAGATGAGAACTGG - Intergenic
1186714005 X:12231209-12231231 CAAAATATTTATTTGGGGCCTGG - Intronic
1186948930 X:14600483-14600505 GAAAATAATTAGATGGCATATGG - Intronic
1187793273 X:22974175-22974197 CAAAATATTTGAAAGGAATCAGG - Intergenic
1188673426 X:32909064-32909086 CAAAACAGTTAGATGGTACCAGG - Intronic
1189460070 X:41233909-41233931 CAAAATATTTAAATAGAATAGGG - Exonic
1193241393 X:79174301-79174323 CAAAACATATTGATGGGATAAGG - Intergenic
1193329818 X:80223464-80223486 CCAAATATTCAAATGGGATTGGG + Intergenic
1193396367 X:80988494-80988516 CAAAATAAAGGGATGGGATCTGG + Intergenic
1193833543 X:86316002-86316024 CCAAAGATTTAGTTGGGACCAGG + Intronic
1194890851 X:99376576-99376598 CAAAATATAATGATGGGATAGGG + Intergenic
1195868559 X:109460769-109460791 CAAAATGTTTAGATTGGAATAGG + Intronic
1196214056 X:113029391-113029413 CATAAAATTTATATGGAATCCGG - Intergenic
1197033568 X:121848189-121848211 GATAATATTTAGATGAGATTTGG + Intergenic
1199539127 X:148938871-148938893 CAAGATATTTAGAGGGGATTTGG + Intronic
1199656065 X:149996616-149996638 CAATACATTGAGATGGGATATGG - Intergenic
1200894119 Y:8356385-8356407 CAAAATATTTAAGTGGGATTGGG - Intergenic