ID: 1119067965

View in Genome Browser
Species Human (GRCh38)
Location 14:71549741-71549763
Sequence GAGGGCAAGTTTCAGTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119067965 Original CRISPR GAGGGCAAGTTTCAGTTGAG AGG (reversed) Intronic
900510768 1:3059821-3059843 GAGGGTAATTTTCATTTTAGAGG - Intergenic
903158526 1:21467445-21467467 GAGGGTGAGTTTGAGATGAGAGG - Intronic
903420063 1:23212441-23212463 GAGGACAAGTTTCAGTAAAGAGG - Intergenic
904577986 1:31517769-31517791 GAGTGCAAGTTTTTATTGAGTGG + Intergenic
905126643 1:35719991-35720013 GGGGTCAAGCTTCAGTAGAGTGG - Intergenic
905892867 1:41528143-41528165 GAGGGCAAGTGTGAGTGTAGGGG - Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909519273 1:76548223-76548245 GAGGGGACATTTAAGTTGAGAGG - Intronic
912925559 1:113910097-113910119 GAGTGGAAGTTTCAATTGAAGGG - Intronic
914372715 1:147043783-147043805 AAGAGAAAGATTCAGTTGAGAGG + Intergenic
914978834 1:152394086-152394108 GAGGGCATGTGTCACTGGAGAGG - Intergenic
914993519 1:152518817-152518839 GAGGGCAAGTTACTGTGGACTGG + Intronic
919365125 1:196650290-196650312 GAGGGCAACTTTTTATTGAGTGG - Intergenic
919963066 1:202491713-202491735 GAGGGAAAGATTCAGTAGAGAGG + Intronic
921917485 1:220628413-220628435 TGGGGGAAGTTTCAGTGGAGTGG - Intronic
922024444 1:221737664-221737686 GAGGGCAAGTTTGAGGAGAGCGG + Intronic
1062786293 10:268010-268032 GAAGGCACGATTGAGTTGAGTGG + Intergenic
1063311449 10:4956493-4956515 GAGGGCAAGATTTTATTGAGTGG + Intronic
1063316348 10:5009975-5009997 GAGGGCAAGATTTTATTGAGTGG - Intronic
1066219650 10:33322676-33322698 CTGGCCAAGTTTCAATTGAGTGG + Intronic
1067291658 10:44948036-44948058 GAAGCCAAGTTGCAGTTAAGTGG + Intergenic
1071129020 10:82370222-82370244 GAGTGCAAGGTTTTGTTGAGTGG + Intronic
1072354333 10:94591748-94591770 GAGAGCTACTTTCATTTGAGTGG - Intronic
1072945011 10:99801942-99801964 GAAGGCAAATTCCAGTTGGGGGG - Intronic
1073955667 10:108868633-108868655 AAGGTCAAGATTCAGTTGAAAGG - Intergenic
1075673473 10:124280207-124280229 GAGGACAAGTTGCAATTGGGTGG + Intergenic
1077895635 11:6451263-6451285 GAGGGCAAGTTCAAGGTGAGAGG - Exonic
1078042081 11:7876023-7876045 GAAGCTAAGTTTCAGGTGAGAGG + Intergenic
1079100334 11:17537654-17537676 GAAGGCAGGATTCAGATGAGAGG - Intronic
1079143185 11:17827642-17827664 GAGGGCAAGATTCAGTGATGCGG - Intronic
1081059962 11:38462050-38462072 GAGTGCAAGTTTTTATTGAGGGG + Intergenic
1087250718 11:95896146-95896168 GAGGTGATATTTCAGTTGAGAGG - Intronic
1089371186 11:117959574-117959596 GAGGGCATGTTTCTGGTGGGAGG - Intergenic
1097899634 12:64859674-64859696 GAGGGCAAGTTTCTGAGGGGAGG + Intronic
1098585278 12:72146865-72146887 GAGTGCAAGTTTTTATTGAGTGG + Intronic
1103688830 12:122753606-122753628 GTGGGGAGGTTTCTGTTGAGAGG + Intronic
1104458350 12:128933716-128933738 GAGAGGGAGTTTCAGTTGGGTGG - Intronic
1108450082 13:50552933-50552955 CATGGCAAGTTTCAGTTGATAGG - Intronic
1114329968 14:21626988-21627010 GAAATCAAGTTTCAGCTGAGGGG - Intergenic
1117446158 14:55805555-55805577 TAGGGCCAGGTTCAGTTGTGTGG + Intergenic
1119011936 14:71002101-71002123 GAGGGGAAGATTCCGTTCAGAGG + Intronic
1119067965 14:71549741-71549763 GAGGGCAAGTTTCAGTTGAGAGG - Intronic
1121554136 14:94823553-94823575 GAGGGCACGTTGCCCTTGAGAGG - Intergenic
1127312513 15:57765322-57765344 GAATGCAAGTTTCAGGTTAGAGG - Intronic
1130103024 15:80908276-80908298 GAGGGCTAGTTTGAGCTCAGTGG - Intronic
1131838361 15:96412215-96412237 GGGGGCAAGTTTGAGATGTGTGG - Intergenic
1134346646 16:13397890-13397912 GAGTGCAAGGTTTAATTGAGTGG + Intergenic
1138284283 16:55796210-55796232 GATGGCTAGTTTCAGCAGAGAGG + Intergenic
1138284719 16:55800777-55800799 GATGGCTAGTTTCAGCAGAGAGG - Intergenic
1139113859 16:63925415-63925437 GAGGGAAAGTTTGAGTGGAGAGG - Intergenic
1139263776 16:65621167-65621189 GAGGGCAAGTTCCATTTGTGAGG - Intergenic
1139571315 16:67814481-67814503 GTGGGCATGTTTCAGGTGGGTGG - Intronic
1139582002 16:67879355-67879377 AAGGGCAAGGGTCAGTAGAGTGG - Intronic
1144574995 17:16423753-16423775 GAGGGCAAGATCGAGGTGAGCGG + Exonic
1147158725 17:38558740-38558762 GAGGGCAAGGTTAAGTTCTGGGG + Intronic
1148255391 17:46126858-46126880 GCGGGCAAATTTTTGTTGAGTGG - Intronic
1149217087 17:54370169-54370191 GAGTGCAAGTTTTTATTGAGTGG + Intergenic
1150325232 17:64251654-64251676 GAGGGCTACTTCCAGATGAGTGG - Intronic
1151712141 17:75813040-75813062 GAGGGCAGGGGTCAGGTGAGAGG - Intronic
1155685269 18:28540677-28540699 GAGGGCCAGTGTCAGTTGTTTGG - Intergenic
1156317089 18:35980034-35980056 GAGGGGAAATTTCAATTAAGAGG + Intergenic
1161065145 19:2233853-2233875 GAGGCCAGGTTCCAGCTGAGTGG - Exonic
1164046109 19:21543395-21543417 TAGGGCAAGTGTAAGTTAAGAGG + Intronic
1164645431 19:29855686-29855708 GGGGGCAGGTGTCAGATGAGAGG - Intergenic
925049172 2:797868-797890 GAGTGCAGGGTTCTGTTGAGTGG + Intergenic
925157057 2:1656860-1656882 GAGGGCAGGTTTCAGTCAGGAGG - Intronic
925157157 2:1657207-1657229 GAGAGCAAGTTTCAGTCAGGAGG - Intronic
928284018 2:29973256-29973278 AAGGGCAAATCTCAGCTGAGAGG - Intergenic
930297936 2:49578847-49578869 GAGGGCAAGGTTTTATTGAGTGG + Intergenic
933438719 2:82282554-82282576 GAGTGCAAGGTTTTGTTGAGTGG + Intergenic
936165971 2:110119835-110119857 GAGAGCAAGTTTGAGTTTTGAGG + Intergenic
936351021 2:111712647-111712669 GAGGGCAAGCCTCGGATGAGAGG + Intergenic
936970370 2:118171057-118171079 CTTGGCAAGTTTCAGTGGAGTGG - Intergenic
942497627 2:176556303-176556325 CAGGACCAGTTCCAGTTGAGAGG + Intergenic
942873540 2:180765246-180765268 GAGGGCAAGCTGAAGTAGAGCGG + Intergenic
943496940 2:188631813-188631835 GAGGAAAAATTTCAGCTGAGAGG - Intergenic
945785047 2:214223864-214223886 GAGGGCATGTTTCAGTTATGAGG + Intronic
945974060 2:216257317-216257339 GAGGGCCAGATTAAGTTGAAGGG + Intergenic
946092917 2:217246631-217246653 AAAGGCAAGTTTCAGTTGCAGGG - Intergenic
946744161 2:222829403-222829425 GAGGGAAAGTGGCAGTTGATGGG - Intergenic
1172281358 20:33710356-33710378 GAGGGCTTGTTTCAGTATAGAGG - Intronic
1173849085 20:46206656-46206678 GAGGGCCACTTTGAATTGAGTGG - Intronic
1175052171 20:56165959-56165981 GAGGGTATGTTTCATTGGAGGGG + Intergenic
1179342290 21:40523613-40523635 GAGTGCAAGGTTTTGTTGAGTGG - Intronic
1180930432 22:19586874-19586896 GAGTGCAAGGTTTTGTTGAGTGG + Intergenic
1182091485 22:27598083-27598105 GGGGTGAAGTTTCAGTGGAGGGG - Intergenic
1182714055 22:32340954-32340976 GAGGGCTGGTCTCAGTGGAGGGG + Intergenic
1184508860 22:44920260-44920282 GAGGGGAAGGTGCAGCTGAGAGG + Intronic
949475397 3:4440321-4440343 AAGGGCAAGTTTCAGTACATAGG - Intronic
951356548 3:21674056-21674078 GCAGGCAAGTCTCAGTTAAGAGG - Intronic
951610061 3:24481647-24481669 GAGGGAAAGTGTCATTGGAGTGG + Intronic
954215347 3:49121368-49121390 AAGGGCAGGTGTCAGTTTAGGGG + Intronic
955070578 3:55569350-55569372 GATGGCATGTTTAAGTTCAGTGG + Intronic
955429521 3:58828111-58828133 GAGGGCAAGTCTCAGATCATGGG + Intronic
960814269 3:121657412-121657434 GAGGGCATGTGTCAGTTGGGTGG - Intronic
962050774 3:131812705-131812727 GAGAGTAAGTTACAGCTGAGAGG + Intronic
962202883 3:133415125-133415147 GAGGGCAGGGTTGAGTAGAGGGG - Intronic
962202924 3:133415275-133415297 GAGGGCAAGGGTGAGTAGAGGGG - Intronic
962202947 3:133415359-133415381 GAGGGCAGGGTTGAGTAGAGGGG - Intronic
962203165 3:133416226-133416248 GAGGGCAGGGTTGAGTAGAGGGG - Intronic
962203267 3:133416659-133416681 GAGGGCAAGGGTGAGTAGAGGGG - Intronic
962203284 3:133416718-133416740 GAGGGCAAGGGTGAGTAGAGGGG - Intronic
962203364 3:133417048-133417070 GAGGGCAGGGATGAGTTGAGGGG - Intronic
962203420 3:133417261-133417283 GAGGGCAAGGGTGAGTAGAGGGG - Intronic
963474744 3:145790852-145790874 GATTGCAAGTTTCACATGAGTGG - Intergenic
965067139 3:163864384-163864406 GAGTGCAAGTTTTTATTGAGTGG - Intergenic
975439229 4:74391749-74391771 GAGGGGAAGTTTCACTGAAGAGG + Intergenic
975695353 4:77007492-77007514 GAGGGAAAGTCCCAGTTTAGGGG - Intronic
976394172 4:84538268-84538290 GAGTTCAGGGTTCAGTTGAGAGG + Intergenic
977069581 4:92367603-92367625 AAGGGCAAGTTTCCGTTAAAGGG + Intronic
977437150 4:97012801-97012823 GAGGCCAAGTTAGAGTGGAGGGG - Intergenic
979346847 4:119597808-119597830 GAGGCCAATTTTCAACTGAGAGG + Intronic
980926225 4:139140934-139140956 TAGTAAAAGTTTCAGTTGAGTGG - Intronic
986571207 5:9168071-9168093 TTGGGCAACTTTCAGTGGAGTGG - Intronic
991226270 5:64276811-64276833 GAAGGTAATTTTCATTTGAGTGG - Intronic
993143920 5:84070153-84070175 GAGTGCAAGGTTTTGTTGAGTGG - Intronic
993522950 5:88927347-88927369 GAAGGCAAGTTGCTATTGAGAGG + Intergenic
996262080 5:121484230-121484252 GAGGGCAGGTTTCAGGGGAATGG - Intergenic
998913732 5:146992510-146992532 GAGGGCTTGTTTCTGTTGGGTGG + Intronic
1000274823 5:159724881-159724903 AAAAGCAAGTTTCAGTTGCGCGG - Intergenic
1002096293 5:176833104-176833126 GAGGCCAAGTTGGAGTTGAGAGG + Intronic
1003399210 6:5778035-5778057 GAGGGAAATTTTCAGGTGATGGG + Intergenic
1004953614 6:20702462-20702484 GAGTGCAAGGTTTAATTGAGTGG + Intronic
1005029302 6:21494089-21494111 GAGAGCAAGGTTTTGTTGAGTGG - Intergenic
1006445096 6:34075543-34075565 GATGGCAAGTGCCAGTGGAGAGG - Intronic
1011767792 6:90642496-90642518 GAGGTCCAGTGTCAGATGAGTGG + Intergenic
1013553509 6:111233513-111233535 GAAGGGCAGTTTCAGTGGAGTGG - Intergenic
1013807028 6:114007484-114007506 CAGGGCATGTTTCAGAGGAGAGG + Intronic
1014447631 6:121547040-121547062 GAGTGCAAGGTTTAATTGAGTGG + Intergenic
1015397963 6:132756269-132756291 GATGGGATGTTTCAGTAGAGAGG - Intronic
1016454718 6:144218563-144218585 GAGAGCCAGCTTTAGTTGAGAGG + Intergenic
1017125976 6:151065219-151065241 GGGGGCATTTTTCAGGTGAGTGG + Intronic
1018283411 6:162212296-162212318 AAGGGCAAGTTTCATGTCAGTGG + Intronic
1019206592 6:170366570-170366592 GAGGGGAAGCTTCACTTGGGAGG + Intronic
1019351669 7:556964-556986 GAGGGCAAGGGGCAGCTGAGTGG - Intronic
1022870394 7:34471925-34471947 GAGGGCAAGTTTGCTTTGAGTGG + Intergenic
1027874339 7:83749645-83749667 GAGAGCAAGTCCCAGTTGCGGGG - Intergenic
1027931789 7:84546479-84546501 GAGGGCAAAGTTCTGTTGACTGG + Intergenic
1032512958 7:132486615-132486637 GAGCGCAAGGGTCAGTTGGGGGG - Intronic
1032673316 7:134106117-134106139 GAGGGCAAGGTTTTATTGAGTGG + Intergenic
1032903176 7:136334278-136334300 CAGGGCAACTTTCAGTTGTTTGG + Intergenic
1037807977 8:22069070-22069092 CAGGGCAAGTTGCAGGTGTGGGG - Intronic
1039865673 8:41499446-41499468 GAGTGCAAGGTTTTGTTGAGTGG + Intronic
1044555809 8:93560800-93560822 GGGGCCAGGATTCAGTTGAGAGG - Intergenic
1045942519 8:107755463-107755485 GAGGGCAAGGTTTTATTGAGTGG - Intergenic
1049698081 8:143993334-143993356 GATGGCATGTTTCAGGGGAGGGG + Exonic
1050546553 9:6714685-6714707 TAGGGCATGTTTCAGTTTTGTGG + Intergenic
1053036207 9:34828385-34828407 ACGGGAAAGATTCAGTTGAGAGG - Intergenic
1056239477 9:84630020-84630042 GAGGACAAGTTTCAGTGCAGGGG - Intergenic
1056551628 9:87657885-87657907 GAGAGCAAGTTTCAGGAGAAGGG + Intronic
1057091546 9:92262505-92262527 GGGAGGAAGTTTCAGATGAGGGG + Intronic
1057927463 9:99166039-99166061 TATGGCAAGTTTGGGTTGAGAGG - Intergenic
1060436443 9:123597101-123597123 GATGGCAAGTGGCAGTTGTGTGG - Intronic
1061463147 9:130756625-130756647 TAGGGCTAGTGTGAGTTGAGGGG + Intronic
1188635382 X:32424137-32424159 GACTGCAATTTTCAGCTGAGTGG - Intronic
1189301967 X:39958624-39958646 GAGGGCAGGCTTCAGTGCAGGGG - Intergenic
1191998043 X:67117485-67117507 GTGGGAAACTTTCAGTTTAGGGG - Intergenic
1193202803 X:78712213-78712235 CAAGGCAATTTTGAGTTGAGTGG + Intergenic
1200826576 Y:7651070-7651092 GAGTGCAAGGTTTAATTGAGTGG + Intergenic
1202298720 Y:23387593-23387615 GAGGGAAAGATTCAGCAGAGAGG + Intergenic
1202572089 Y:26283005-26283027 GAGGGAAAGATTCAGCAGAGAGG - Intergenic