ID: 1119068077

View in Genome Browser
Species Human (GRCh38)
Location 14:71550970-71550992
Sequence CAGTGTGGCTGGAGAGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 1, 1: 3, 2: 13, 3: 109, 4: 694}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119068077_1119068085 18 Left 1119068077 14:71550970-71550992 CCCTTTCCTCTCCAGCCACACTG 0: 1
1: 3
2: 13
3: 109
4: 694
Right 1119068085 14:71551011-71551033 ACGCTGTTTGTTCATATCCTAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1119068077_1119068083 -7 Left 1119068077 14:71550970-71550992 CCCTTTCCTCTCCAGCCACACTG 0: 1
1: 3
2: 13
3: 109
4: 694
Right 1119068083 14:71550986-71551008 CACACTGGCACTTTTTACCTTGG 0: 1
1: 1
2: 0
3: 10
4: 149
1119068077_1119068086 19 Left 1119068077 14:71550970-71550992 CCCTTTCCTCTCCAGCCACACTG 0: 1
1: 3
2: 13
3: 109
4: 694
Right 1119068086 14:71551012-71551034 CGCTGTTTGTTCATATCCTAGGG 0: 1
1: 0
2: 1
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119068077 Original CRISPR CAGTGTGGCTGGAGAGGAAA GGG (reversed) Intronic
900187108 1:1337717-1337739 CAGTGTGAATGGGGAGGACAGGG - Intronic
900189466 1:1347205-1347227 CAGTGGGGCTGCAGAGGTCAGGG - Intronic
900858159 1:5202888-5202910 CAGCATGGCTGGAGATGAATAGG - Intergenic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901175453 1:7295381-7295403 CAATCTGGTTGAAGAGGAAAAGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
902205535 1:14865633-14865655 CAGGATGGCTGGAGAGCAAGGGG - Intronic
902245486 1:15117921-15117943 TTTTGTGGCTGCAGAGGAAATGG + Exonic
902454936 1:16526459-16526481 CCATGTGGCTAGAGATGAAAAGG + Intergenic
902497230 1:16881436-16881458 CCATGTGGCTAGAGATGAAAAGG - Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906218100 1:44056204-44056226 TAGTGAGGCTGGAGAGTAATAGG - Intergenic
907313599 1:53553837-53553859 CTGTGTGGCTGGAGCAGAACGGG + Intronic
907652745 1:56311379-56311401 AGGAGTTGCTGGAGAGGAAAGGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908378212 1:63567729-63567751 CAGGTTGGATGGAGAGGCAAAGG + Intronic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909904241 1:81175977-81175999 CAGGATGGCTGTATAGGAAAGGG - Intergenic
910415895 1:86997746-86997768 CTGTGTGGGTGGGGAGGGAAGGG + Intronic
910441804 1:87260675-87260697 GAGTAGGGATGGAGAGGAAAAGG + Intergenic
910828822 1:91439404-91439426 CTGTCTGGCTGGTGAGGAATAGG + Intergenic
911037549 1:93566612-93566634 CAGTGTGACTGGGAAGGAACAGG + Intronic
911463738 1:98224210-98224232 CAGTGTGGCTGAAGCATAAAAGG + Intergenic
911753309 1:101523649-101523671 CTGTGTGGGTGGCGAGAAAATGG - Intergenic
911821473 1:102429301-102429323 CAGTGTTTCTGCAGAGGAAAAGG - Intergenic
911909288 1:103612087-103612109 CAGTGTGGTTGAAGATGCAATGG + Intergenic
912207342 1:107523218-107523240 CTGTGTGGCTGGAGCAGAACAGG - Intergenic
912960593 1:114192170-114192192 CAGTGTGGGTGGAGAGAGAGCGG + Intergenic
913420832 1:118667025-118667047 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
913483051 1:119307775-119307797 CAGTATGGCTAGAAAGTAAAGGG + Intergenic
913534177 1:119755479-119755501 CATTGTGAGTGGAGAGGTAAAGG + Exonic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915070706 1:153263394-153263416 CGGTGAGTCTGGAGAGGACAAGG + Intergenic
915117402 1:153609357-153609379 CAGGCTGGCTGGAGAGGGCAGGG - Intronic
915562127 1:156693456-156693478 CTGGGTGGGAGGAGAGGAAAGGG - Intergenic
915662118 1:157413138-157413160 CAGTGTTTTGGGAGAGGAAATGG + Intergenic
915974433 1:160375650-160375672 CACTGGGGGTGGAGAGGGAAGGG - Intergenic
916074703 1:161193661-161193683 CAGTGTTGCAGGAGCGGAAGCGG + Exonic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916735781 1:167605736-167605758 CTGTCTGGTTGGAGAGGAGAAGG - Intergenic
917686714 1:177423986-177424008 TTGTGTTGCAGGAGAGGAAAAGG + Intergenic
917701614 1:177587384-177587406 CTGTGTGGCTGGAAGGGAATTGG - Intergenic
917896824 1:179498935-179498957 TAGTGAGGCTGCAGAGAAAAAGG + Intronic
918238322 1:182600761-182600783 CAGGGTTGCTGTAGAAGAAAGGG - Intronic
919569987 1:199236203-199236225 CAGTTTGGCTGGAAATAAAAAGG + Intergenic
919823782 1:201489559-201489581 CAGTGAGGCTGGTGTGGCAACGG + Intronic
920307699 1:205029727-205029749 CCGTGTGGCAGAAGAGGATAAGG + Intergenic
920364699 1:205441923-205441945 CAGTCTGGCTGGGGAAGAGAGGG + Intronic
920450797 1:206059761-206059783 GAATGTGGCTGGAGAGGGGATGG + Intronic
920538784 1:206761431-206761453 CACCCTGGCTGGAGAGGACAAGG - Intergenic
920711865 1:208302893-208302915 CAGTGGGGCTGGAGAGGTAGTGG + Intergenic
922386863 1:225095026-225095048 CAGTGAGGTTGCAGAGAAAAGGG + Intronic
922960337 1:229640972-229640994 CAGTAGGGTTGAAGAGGAAAAGG - Intronic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923229497 1:231971550-231971572 CAGGGTGGCTGGAGAGGAAGGGG - Intronic
923677479 1:236092448-236092470 CACTGTGCCTGGCCAGGAAATGG + Intergenic
923699189 1:236283434-236283456 AAGAGTTGCTGGAGGGGAAAAGG - Intergenic
924003686 1:239582956-239582978 CAGACTGGCTGGAGAGCAACAGG - Intronic
924027462 1:239850323-239850345 CTGAGTGGCTGAAGAGGAGAAGG + Intronic
924474732 1:244372976-244372998 AAATGTGGATGGAGAGGATAGGG - Intronic
924488048 1:244506528-244506550 TAGTGAGGCTGTAGAGGAATTGG - Intronic
924579045 1:245307694-245307716 AATTGTGGCTTCAGAGGAAAGGG - Intronic
924867667 1:248003199-248003221 CAATGAGGATGAAGAGGAAAAGG - Intronic
924872198 1:248060750-248060772 CAATGAGGATGAAGAGGAAAAGG - Exonic
1063288206 10:4712801-4712823 CAGGGTGGCAAGCGAGGAAATGG - Intergenic
1064347885 10:14549040-14549062 CATTGAGGCTGGAGAGTACAGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1066277297 10:33881523-33881545 CAGGGTGGCAGGAGAGAGAATGG + Intergenic
1066519976 10:36206432-36206454 CAGTGGGGCTAGTTAGGAAAGGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067245647 10:44540170-44540192 TAGTGAGGCTGCAGAGAAAAGGG - Intergenic
1068491495 10:57730228-57730250 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1068949985 10:62767200-62767222 CAGTATAGCTGGAGATTAAATGG - Intergenic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070280631 10:75045660-75045682 CAGTGTGGCTGAAGTGGCAAGGG + Intronic
1070369810 10:75771527-75771549 CAGTGTGGCTGGTGAGTGAGAGG + Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070707111 10:78647736-78647758 CAAGGTGGCTGGAGAGGGAAGGG - Intergenic
1070868841 10:79729968-79729990 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071003591 10:80858370-80858392 GAATGTGGCTGGAGAGCAAGAGG - Intergenic
1071363227 10:84871993-84872015 TAGTGAGGCTGTAGAGGAAAGGG + Intergenic
1071463442 10:85919645-85919667 AGTTGTAGCTGGAGAGGAAAAGG - Intronic
1071511464 10:86264995-86265017 AAGTGTGGCTAGGAAGGAAAAGG - Intronic
1071635756 10:87252187-87252209 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071659487 10:87485789-87485811 CTCTGTGGCTGGAATGGAAATGG - Intergenic
1072219578 10:93316241-93316263 GAGTGTGCCAGGAGAGGGAAGGG + Intronic
1072762423 10:98067773-98067795 CAGTCTGGTGGGAGAGAAAAAGG - Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073011393 10:100362720-100362742 CAGTGTGGCAGGGGAGCACAGGG - Exonic
1073671839 10:105599719-105599741 GATTGTGGCAGGAGAGGCAAGGG + Intergenic
1074434075 10:113418754-113418776 AAGTTTGGCTGGAGGGGTAATGG + Intergenic
1074772896 10:116744758-116744780 CGGTTTTGCAGGAGAGGAAAAGG + Intergenic
1074964916 10:118482109-118482131 CAGTGTGACCTGGGAGGAAATGG - Intergenic
1075259127 10:120947911-120947933 CCGTGTGGCTGGAGCAAAAAAGG - Intergenic
1075463339 10:122632962-122632984 CAATGGGGCTGGGGAGGAGATGG + Intronic
1075559956 10:123460956-123460978 CAGAGTGGGTGGGGAGGGAAGGG - Intergenic
1075815120 10:125259150-125259172 CAGTGTGGGTGTTGAGGAATTGG + Intergenic
1075821157 10:125313112-125313134 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076311661 10:129512023-129512045 GTGTGTGGCTGGCCAGGAAAGGG + Intronic
1076325500 10:129617562-129617584 CGGTGAGGCTGTAGAGAAAACGG - Intronic
1077350938 11:2092924-2092946 CAGGGTGGCTGCAGAGGGGATGG - Intergenic
1077498471 11:2898078-2898100 GACTGTGGCTGGAGGGGAAGTGG - Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077731176 11:4731553-4731575 CAGTGTGGAAGGAGAGGGTAAGG - Intronic
1077898027 11:6468671-6468693 CAGAGTGACTGAAGAGTAAATGG + Intronic
1078211039 11:9269661-9269683 CAGGGTGGCTGGAGAGGGTTAGG + Intergenic
1078666978 11:13333894-13333916 TAGAGTGGGTGGAGAGGGAAAGG - Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1078921342 11:15833491-15833513 CAGTGTGTCTGGGGAGTAACAGG + Intergenic
1080667040 11:34345192-34345214 AGATGTGGTTGGAGAGGAAATGG - Intronic
1080687081 11:34524735-34524757 GAGTGTGCAGGGAGAGGAAAGGG - Intergenic
1080708134 11:34718780-34718802 CAATGTGGCTGGAGCAGAACAGG + Intergenic
1080849464 11:36055612-36055634 CACTGTGGCTGCACAGGCAATGG - Intronic
1081720397 11:45284910-45284932 CAGTGAGAGTGGAAAGGAAATGG - Intronic
1082759262 11:57110943-57110965 CTGTGTGGCTGGAGAAGGGAAGG - Intergenic
1082988546 11:59187798-59187820 CAGCCAGGCTGGAGAGGAGATGG - Intronic
1083488203 11:62996549-62996571 CAGTCTCTCTGGAGAAGAAAGGG + Intronic
1084039310 11:66532165-66532187 CAGTGGGGGTGGTGAGGAAGCGG - Exonic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1084694661 11:70746328-70746350 GAGTGTGGTGGGAGAGGAGATGG - Intronic
1084694692 11:70746427-70746449 GAGTGTGGTGGGAGAGGAGATGG - Intronic
1084729578 11:71064704-71064726 CAGAGAGGGTGGAGAGGGAATGG + Intronic
1085303959 11:75474678-75474700 CAGCGTGGATGGAGAGGAAGGGG + Intronic
1085389851 11:76176783-76176805 ATGTCTGGCTGTAGAGGAAAAGG + Intergenic
1085452685 11:76644911-76644933 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085754718 11:79193007-79193029 CTGGGAGGCTGGAGAGGAAGGGG - Intronic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086259166 11:84916795-84916817 CAGTGTGGCTGAAGAGAGAAAGG - Intronic
1087012670 11:93528660-93528682 CAGAGTGGGTGGAGAGGTGAAGG + Intronic
1087012965 11:93530661-93530683 CATTGTGTCAGGGGAGGAAAGGG - Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087322196 11:96676746-96676768 ATGTGTGGTTGGAAAGGAAAAGG + Intergenic
1088250751 11:107858999-107859021 CAGGGTGGCAGGAGGAGAAAGGG + Exonic
1088627125 11:111737453-111737475 CACAGTGCCTGGAGAGGACATGG - Exonic
1088656442 11:112004427-112004449 TAGTGGGGATGGAAAGGAAAAGG + Intronic
1088783083 11:113155147-113155169 CAGTGAGGAAGGAGAGGAACTGG + Intronic
1088962299 11:114681121-114681143 CAATGTGGATGGAGAAAAAAAGG - Intronic
1089413975 11:118271575-118271597 GAGTGTGAGTGGAGAGAAAAGGG + Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089864050 11:121616477-121616499 GGGTGTCTCTGGAGAGGAAAGGG - Intronic
1090361090 11:126173195-126173217 CCGTGTGGCTTGAGGGGAAAGGG + Intergenic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1091817794 12:3453110-3453132 CAGGTAGGCTGGAGAGGAGAGGG + Intronic
1094047108 12:26179263-26179285 TAGTGTGGCTGGACAGGAGAAGG + Intronic
1094392553 12:29967555-29967577 GAGTGTGGCTGTACAGGAGAAGG - Intergenic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1095177250 12:39107171-39107193 CAGGGAAACTGGAGAGGAAATGG - Intergenic
1095554503 12:43483955-43483977 CTGTGTGGCTGGAATGGAAGAGG - Intronic
1096843687 12:54393633-54393655 CTGTGTTGGTGGAGATGAAAAGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097392773 12:59035796-59035818 CAGTCTGGTTGTAGAGTAAAAGG + Intergenic
1097478457 12:60089453-60089475 CAGTATACCTGCAGAGGAAAAGG - Intergenic
1097604980 12:61742847-61742869 TAGTGTGGGTGCAGAGGGAAGGG - Intronic
1097744994 12:63291815-63291837 TAGAGTGGCTCAAGAGGAAAAGG - Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098454743 12:70659359-70659381 TATGGTGGCTGGACAGGAAATGG + Intronic
1098461431 12:70736982-70737004 CAGTGGGGCAGGAGAGGATGGGG - Intronic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1099367087 12:81780581-81780603 CTGTGAGGTTGCAGAGGAAAGGG + Intergenic
1099651838 12:85438552-85438574 TAGTGAGGCTGCAGAGAAAAGGG - Intergenic
1099717626 12:86316224-86316246 TGGTGAGGCTGCAGAGGAAAGGG + Intronic
1099886446 12:88537012-88537034 TGGTGTGGCTGCAGAGAAAAGGG + Intronic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100497405 12:95138633-95138655 CAGTGTGGTGGGAGAGAAATGGG - Intronic
1100849347 12:98693023-98693045 CAGGGAGGCTGCAGAGAAAAGGG - Intronic
1100962251 12:99975453-99975475 TGGTGAGGCTGCAGAGGAAAGGG - Intronic
1102458554 12:113086374-113086396 CAGTGTGGTTGGAGAGGCTCAGG + Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1103937508 12:124484388-124484410 CAGTGTGCCTAGAGAGGGCATGG + Intronic
1104034131 12:125086899-125086921 CAGTGAGGCAGGGCAGGAAAGGG + Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105023525 12:132833870-132833892 CAGTGTCCCAGGAGAGGGAAAGG + Intronic
1105058604 12:133127460-133127482 CAGTGAAGCTAGATAGGAAATGG - Intronic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106755439 13:32818529-32818551 CAGTGAGGATGTGGAGGAAAGGG + Intergenic
1106966507 13:35077569-35077591 CAATATGGATGGAGGGGAAAGGG - Intronic
1107107491 13:36660810-36660832 CAGTATTGCTAGAGAGGAACAGG - Intergenic
1107886961 13:44881570-44881592 CAGTGTGGGGGGCGAGGGAATGG + Intergenic
1108473841 13:50793486-50793508 TAGTGAGGCTGCAGAGAAAAGGG - Intronic
1108490295 13:50975021-50975043 AAGTGTGGCTGCAGAGGGAAGGG - Intergenic
1108623049 13:52202784-52202806 CAGGGTGGGAGGAGAGGTAATGG - Intergenic
1108663676 13:52608258-52608280 CAGGGTGGGAGGAGAGGTAATGG + Intergenic
1109576730 13:64269100-64269122 CAGGGTGGCAGGAGAGAGAATGG - Intergenic
1109702988 13:66050728-66050750 CAGTGTGGCTAAAGAGCAATAGG + Intergenic
1110443248 13:75548927-75548949 CACTGTGGCTGCAGAGTAAAGGG - Intronic
1110744366 13:79035926-79035948 TAATTTGGCTGGAGAGGAATTGG + Intergenic
1110974798 13:81817576-81817598 TGGTGAGGCTGGAGAGAAAAGGG + Intergenic
1112104764 13:96228953-96228975 CAGTGTGGATGGAGAAGCAGAGG + Intronic
1112577580 13:100650023-100650045 CAGTCTTGATGGAGAGGAGATGG - Intronic
1113657186 13:112074123-112074145 GAGTGTGGGTGAAGAGGAGAGGG + Intergenic
1113868834 13:113545960-113545982 CAGTGGGGCTGGAGATGAAGGGG + Intronic
1114199907 14:20510452-20510474 CATTTTGCCTGGAGAGGAAGCGG - Exonic
1114337250 14:21703278-21703300 CAATGAGAATGGAGAGGAAAGGG + Intergenic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1115352004 14:32405759-32405781 CAGGGTGGCAGGAGAGAGAATGG - Intronic
1115441834 14:33444571-33444593 CAGTGACGCTGGTCAGGAAATGG - Intronic
1115618319 14:35117546-35117568 CAGTGAGGCTGAAGTGGAAATGG - Intronic
1116231716 14:42226895-42226917 TGGTGAGGCTGCAGAGGAAAAGG - Intergenic
1116395307 14:44441500-44441522 CGGTGAGGCTGCAGAGAAAAAGG + Intergenic
1116403623 14:44541234-44541256 CGGTGAGGCTGCAGAGAAAAAGG + Intergenic
1116648445 14:47560032-47560054 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
1116833490 14:49746041-49746063 CAATGGGGCTGGAGAAGGAAGGG + Intronic
1116887582 14:50235999-50236021 CTGGGTGGCTGGAGATGAAAGGG + Intergenic
1117073020 14:52073148-52073170 CAGACTGGCTGAAGAGGCAAAGG + Intergenic
1117563095 14:56965102-56965124 CAGTGTGACAGGAAAGCAAAGGG + Intergenic
1117647432 14:57866237-57866259 CAGTGGGGCGCGAGAGGAGAAGG + Intronic
1117672144 14:58119066-58119088 CAGAATGGCTGGAGAAGAAAAGG + Intronic
1118333746 14:64834347-64834369 CAGTCTAGCAGGAGAGGAAGAGG - Intronic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118570040 14:67185311-67185333 CAATGTGGCTGGGAAAGAAAAGG + Intergenic
1118812402 14:69284896-69284918 CAGGGTGGCAGGAGAGAGAAGGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119942479 14:78656278-78656300 CAATGTGGCTGCTGAGGAGAAGG + Intronic
1120278988 14:82414974-82414996 TAGTGAGGCTGCAGAGTAAAAGG - Intergenic
1120758186 14:88263436-88263458 CACTGTGGCTCGGGAGGAAATGG + Exonic
1120769939 14:88368042-88368064 CAGTGAGGTTGTAGAGAAAAAGG - Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1120946763 14:90005150-90005172 GAGTGTGGCTGCAGAGCAGATGG - Intronic
1120969797 14:90197859-90197881 CTGTGTGGCCGGAGAGGCCATGG - Intergenic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121449506 14:93998354-93998376 CAGTGTGGCTTGGAAGCAAATGG + Intergenic
1121488577 14:94341435-94341457 CAGTTTGCCTGGAAATGAAAGGG - Intergenic
1121498221 14:94412505-94412527 CAGTATAGCTGGAGTGGAATGGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122692600 14:103538340-103538362 CTCTGTGGCTGGTGAGGACAGGG - Intergenic
1122941326 14:104982697-104982719 CTGTGTGGGTGCAGAGGAAGTGG - Intergenic
1123038414 14:105480612-105480634 GAGTGTGGCTGAGGAGGGAAGGG + Intergenic
1124355809 15:28993914-28993936 TAGGGTGCCTGGAGAGGACAGGG + Intronic
1124682893 15:31751421-31751443 CAGTGAGGCTACAGAGAAAAGGG + Intronic
1125185579 15:36926029-36926051 AAGCGGGGCTGGATAGGAAAGGG - Intronic
1125967805 15:43888295-43888317 GAGTGTGGATGGAGAAGCAAAGG + Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1126961968 15:54006810-54006832 CAGAGTAGCTGGAGATGGAAGGG - Intergenic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127697939 15:61470229-61470251 GAGAGTGGATGGAGAGGATAAGG - Intergenic
1127836460 15:62794743-62794765 CAGTCTGGCAGGAGAGGCACAGG - Intronic
1127861452 15:62997508-62997530 AAGTGTGGCTGGAATGCAAAGGG + Intergenic
1128456602 15:67834894-67834916 CGGTGTGGCAGGCGTGGAAATGG - Intergenic
1129175330 15:73835906-73835928 CAGTGTGGCCGGGGATGAATTGG + Intergenic
1129503687 15:76063410-76063432 CAGTGTGGATGGAGCAGAATAGG - Intronic
1130114628 15:80996048-80996070 AAGTGGGGCTGGGGAGGAAATGG + Intergenic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1130968442 15:88714416-88714438 ATGAGTGGCTGGAGAGGAAGGGG + Intergenic
1131229968 15:90652677-90652699 CAGTCCGGGTGGAGAGGCAAAGG + Intergenic
1131229978 15:90652719-90652741 CAGTCTGGATGGAGAGGCAAAGG + Intergenic
1131649323 15:94381769-94381791 CACAGTTGCTGAAGAGGAAATGG + Intronic
1132185332 15:99798331-99798353 AAGTGGGGCTGGAAAGGAAAGGG + Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133837130 16:9377343-9377365 CAGTGTGGCTGGTCTGGAAGGGG - Intergenic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134349937 16:13427658-13427680 CAGTGTGGCTGGAGAGAGAGAGG + Intergenic
1135243957 16:20838241-20838263 AAGAGAGGCAGGAGAGGAAAGGG - Intronic
1135661772 16:24303169-24303191 AAATGAGGCTGGAGAGGGAAGGG - Intronic
1135961924 16:27002132-27002154 CAGTGTGGCTGGAAGAGAATAGG + Intergenic
1136036857 16:27547109-27547131 CGGTGTGGCTGGAGAGGTAGAGG - Intronic
1136142809 16:28298185-28298207 GAGGGTGGCTGGGGAGGAGAGGG - Intronic
1136469001 16:30465903-30465925 CAGCGTGACTGGTGAGGAGAGGG + Intergenic
1136497900 16:30655056-30655078 CACTGTGGGTGGTGGGGAAATGG + Exonic
1137408855 16:48211053-48211075 CACTGGAGCTGGAGAGGAACGGG - Exonic
1138304564 16:55962622-55962644 GGGTGTGGCTGGAGAGGAGCAGG - Intergenic
1138386055 16:56636273-56636295 CAGTGTGAGTGGAGAGGACATGG + Intergenic
1138401008 16:56744048-56744070 AATTGGGGCTGGACAGGAAAAGG - Intronic
1138541139 16:57688561-57688583 CAATGTGGCTGGGGAGGGAGAGG + Exonic
1138603455 16:58071676-58071698 GAGTGTGTCTGGAGAGGATGAGG - Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139278305 16:65748462-65748484 CAGTGAAGCTGGAGAGGAAAGGG - Intergenic
1139307621 16:66000867-66000889 CAGAGAGGCTTTAGAGGAAAGGG - Intergenic
1139334232 16:66219884-66219906 CTGTGTGGCAGGGGAGGACAGGG + Intergenic
1139478675 16:67216247-67216269 AAGCGTGGCTGTAGAGGAAGGGG - Intronic
1143052133 17:4134977-4134999 TGGTGTGGCTGGAAAGGAACAGG + Intronic
1143686172 17:8517823-8517845 CAGTGTGGCTGGAGCAGGATGGG - Intronic
1143991746 17:10969870-10969892 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1144127369 17:12215585-12215607 CAGTGAGGTTGGGGAGGAAGGGG - Intergenic
1144460406 17:15454194-15454216 TAGTGTGGCTGGGGAGGGATGGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144944701 17:18963942-18963964 CAGTGTGGCTGGAGCGGGTGGGG - Intronic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145844148 17:28023105-28023127 CGGTGTGGTTGGAGAGGATGTGG + Intergenic
1146011899 17:29201272-29201294 CAGTGGGGCTGGACAGGCAGAGG - Intergenic
1146696370 17:34911679-34911701 CAGTGTGGCTGGAGAGAGTTGGG + Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147461965 17:40578443-40578465 CATTGTTGCTGGAGAGGATGTGG + Intergenic
1148019899 17:44546847-44546869 CATTATGGCAGGAGGGGAAATGG - Intergenic
1148139965 17:45321327-45321349 CAGGGAGGCAGGAGGGGAAATGG + Intergenic
1148354728 17:46968267-46968289 CAGTGCGGAGGGAGAGGAAGAGG - Intronic
1148568367 17:48646944-48646966 CAGAGCGGCTGGTGAGGAGATGG + Intergenic
1148773331 17:50079362-50079384 CAGGGTTGCAGGAAAGGAAAGGG - Intronic
1148859422 17:50596349-50596371 AGGTGTGGCTGGAGAGGCAGAGG + Intronic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1149919147 17:60639948-60639970 CAGTGTAGCTGGAACGGATAAGG + Intronic
1150514570 17:65794738-65794760 GGGTGTGGGTGGAAAGGAAAGGG - Intronic
1150525018 17:65913706-65913728 ATGGTTGGCTGGAGAGGAAAAGG - Intronic
1150532604 17:66000201-66000223 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1150642310 17:66957851-66957873 CAGGGAGGCTGGAGATGAAAAGG + Intergenic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1151390783 17:73785444-73785466 CAGAGAGGATGGAGAGGAAGAGG + Intergenic
1151412566 17:73941004-73941026 CAGGGTGGGATGAGAGGAAAGGG + Intergenic
1151480953 17:74369813-74369835 CAGTGTGGCTTCAGGGGAACAGG + Intronic
1151618758 17:75232067-75232089 CAGTGTGGCTCGTGAGGAGGAGG - Intronic
1151623679 17:75262937-75262959 CAGTGTAGCTTAAGAGCAAATGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152912357 17:83012656-83012678 CATGGAGGCTGGAGAGGAAAGGG - Intronic
1153215528 18:2816929-2816951 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
1153493767 18:5676610-5676632 CAGGATGGGTGGAGTGGAAATGG + Intergenic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155906484 18:31458377-31458399 AAGTGGGGGTGGAGAGGGAAAGG + Intronic
1155989952 18:32270102-32270124 CAGGGTGGTGGGAGAGGAAATGG - Intronic
1156080705 18:33331356-33331378 CAGGATGGCTGAAGAGCAAAAGG - Intronic
1156187351 18:34678452-34678474 CAGTGGGGGTGGAAAGGGAAGGG - Intronic
1156357406 18:36354092-36354114 CTGTGTGCCTGGGGAGAAAAGGG + Intronic
1156492697 18:37505731-37505753 CAGTGGGGCTAGAGAGGTTAAGG - Intronic
1157058937 18:44264331-44264353 CAGTGTGTCTGGCTATGAAAGGG - Intergenic
1157815667 18:50728059-50728081 GAGTGTGACTGGAGAGGCACAGG - Intronic
1158475253 18:57774059-57774081 CAGGGTGGCTGTAGATGAGAGGG - Intronic
1159304799 18:66626761-66626783 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160579472 18:79875400-79875422 CAGTGAAGCTGGAGTGGAAATGG - Intronic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162175378 19:8826249-8826271 CAGTGGGGCTGGGCAGGGAATGG + Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163025373 19:14508019-14508041 CAGTGGGGCAGGAGAGACAACGG - Intergenic
1164146459 19:22515454-22515476 CAGTGAGGAGTGAGAGGAAAAGG + Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1164759780 19:30720070-30720092 CAGTGATCCTGGGGAGGAAATGG - Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164937669 19:32227799-32227821 CCGTGTGGCTGAAAAGGAGAAGG + Intergenic
1165819130 19:38663493-38663515 CTGTGTCCCGGGAGAGGAAAGGG + Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1167399485 19:49255468-49255490 CAGTGTCACTGGTGAGGAGAGGG - Intergenic
1167404739 19:49298561-49298583 TGGTGAGGCTGCAGAGGAAAGGG + Intronic
1167423923 19:49419995-49420017 CAGTGTGTCTGGAGAGCCATAGG + Intergenic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168354044 19:55691334-55691356 CAGTCTGGCTGGAGAAGGCACGG + Intronic
1168536511 19:57174705-57174727 CAGTGTTCCTGGAGAGGGCATGG + Intergenic
925337456 2:3108596-3108618 CAGTGTGGAAGGAAAGGCAAGGG + Intergenic
925905921 2:8539683-8539705 CAGTGTGGTTGGGGATGACATGG - Intergenic
926051101 2:9745269-9745291 CAGTGGGTGTGGGGAGGAAAGGG - Intergenic
927571887 2:24167211-24167233 CAGCGTGGGTGGAGAGGAGCTGG + Intronic
927982352 2:27381894-27381916 CAGGGTGGTAGGAGAGGAATGGG + Intronic
927993325 2:27463849-27463871 CAGTGTGGTTGGAGACTAATGGG + Intronic
929083746 2:38147608-38147630 TGGTGAGGCTGCAGAGGAAAGGG + Intergenic
929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG + Intergenic
929768251 2:44868895-44868917 CAGTGTGTCAGGAGAGGACTGGG + Intergenic
930212655 2:48657731-48657753 CAGCAAGGCTGCAGAGGAAAAGG - Intronic
930237347 2:48900705-48900727 CTGGGTAGCTGAAGAGGAAAGGG - Intergenic
930618781 2:53623031-53623053 AAGTGTGTCTGGAGCGGAAGGGG + Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
930875780 2:56213997-56214019 CAGTGAGGCTGGAGAGACATTGG + Intronic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
932036059 2:68248090-68248112 TAGCGTGGCTGGAGAGGAAGGGG - Intronic
932344254 2:70985362-70985384 CGTTGTGGGTGGCGAGGAAAGGG + Intronic
932447701 2:71790908-71790930 CATGGTGGCTGGAGAGGGCAAGG + Intergenic
932506036 2:72233221-72233243 CAGGGTGGCAGGAGAGGCCAAGG + Intronic
933192486 2:79350770-79350792 TGGTGTGGATGCAGAGGAAAGGG - Intronic
933808244 2:86015637-86015659 CACTGTGGCAGGGGAGGGAAGGG - Intergenic
935659685 2:105455433-105455455 CAGTGTTGCTGGAGATCCAATGG - Intergenic
936049102 2:109209609-109209631 CTGTGTAGGTGGGGAGGAAAGGG + Intronic
936149632 2:110008144-110008166 CACCCTGGCGGGAGAGGAAAGGG - Intergenic
936195046 2:110363225-110363247 CACCCTGGCGGGAGAGGAAAGGG + Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937457586 2:122055786-122055808 CAGTGGGGCTGGTGGGGGAAAGG - Intergenic
937769751 2:125706561-125706583 CAGTGAGGCTGAAGAGAAATAGG + Intergenic
938262804 2:129907313-129907335 CACAGTGGCTGGAGATGAGAGGG + Intergenic
938283421 2:130085250-130085272 CCGTGTTGCTGCAGGGGAAATGG - Intronic
938334053 2:130473815-130473837 CCGTGTTGCTGCAGGGGAAATGG - Intronic
938355767 2:130646852-130646874 CCGTGTTGCTGCAGGGGAAATGG + Intronic
938432188 2:131253641-131253663 CCGTGTTGCTGCAGGGGAAATGG + Intronic
938475861 2:131612251-131612273 CCGTGTTGCTGCAAAGGAAATGG + Intergenic
939070557 2:137535929-137535951 TGGTGTGGCTGGAGTGGATAAGG + Intronic
939474822 2:142673944-142673966 CGATGTGGTTGGAAAGGAAAAGG - Intergenic
939495921 2:142928550-142928572 CAACGTGGCTGGAAGGGAAATGG + Intronic
939833413 2:147099723-147099745 CAGTGTGGCTAAAGAGGAAAAGG - Intergenic
940029295 2:149243886-149243908 CAATATGGCTGATGAGGAAAAGG + Intergenic
940551316 2:155160572-155160594 CAGTGATGCTGGAGATGAAGGGG + Intergenic
940994081 2:160128379-160128401 GAGTGTGGCAGGTGGGGAAATGG + Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941267652 2:163382886-163382908 TAGTGAGGCTGCAGAGAAAAAGG - Intergenic
941874796 2:170421521-170421543 CAGGGTGGCTGGAGAGGGCTGGG - Intronic
941954430 2:171190152-171190174 GAGTGTTGCTGGAGTGGCAAGGG + Intronic
942206992 2:173629097-173629119 CAGTGTGGCTGGATATGAGTGGG + Intergenic
943731776 2:191309619-191309641 CAGCGTGGCTGGGGAAGAGAGGG - Intronic
943749120 2:191493680-191493702 CTGAGTGGCTGGAGATAAAATGG + Intergenic
943901676 2:193446684-193446706 CAGTGAGGATGCAGAGAAAAAGG - Intergenic
944189212 2:196983367-196983389 CAGTGTGGCTGGAGACTCAAGGG - Intronic
945540206 2:211076117-211076139 TGGTGAGGCTGCAGAGGAAAAGG + Intergenic
946570472 2:221018626-221018648 CAGTCTGGATGGAAAGGAAATGG + Intergenic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948197430 2:236106198-236106220 CAGTGTGGCTGGAGCTGGAGAGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948297121 2:236869081-236869103 CAGTTTGGAAGGAGGGGAAAGGG - Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
949005670 2:241645757-241645779 CAGTGTGGTGGGAGAAGCAAGGG + Intronic
1169100017 20:2939466-2939488 CACAGTGTCTGGTGAGGAAAAGG + Intronic
1169268250 20:4180771-4180793 CAGCCAGGGTGGAGAGGAAAGGG - Intronic
1170242491 20:14183670-14183692 TAGTGTGGTTGTAGAGAAAAAGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1171248594 20:23632520-23632542 AAGTCAGGGTGGAGAGGAAAAGG + Intronic
1171277992 20:23874948-23874970 CCATGGGGGTGGAGAGGAAATGG + Intergenic
1172282268 20:33716313-33716335 CAGTGTGGCTGGAGCAGCAGAGG - Intronic
1172288373 20:33757281-33757303 CAGCGTTGCTGGAGAGTCAAAGG - Exonic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1173008094 20:39156597-39156619 CAGAGTGGCTGGAGTTGAACAGG + Intergenic
1173021446 20:39271135-39271157 CAGCCTGGCTGGTGAGGAACTGG + Intergenic
1173787304 20:45803505-45803527 CAGTGTGGCTGGAGGTGGAGAGG - Intronic
1173847547 20:46197679-46197701 AAAGGTGGCTGGAGAGGAAGTGG - Intronic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174187898 20:48720007-48720029 CAGGGTGACTGGAAAGGAAGAGG - Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174500329 20:50979649-50979671 TGGTGAGGCTGGAGAGGAAGAGG - Intergenic
1174528457 20:51192102-51192124 GAGTTGGGCTGGAGAGGAAGAGG + Intergenic
1174625479 20:51910948-51910970 CAGCGTGGCTGTACAAGAAAAGG - Intergenic
1174779236 20:53372951-53372973 GAATGTGGCTGGAAAGGTAAGGG - Intronic
1174918444 20:54677353-54677375 CAGGGTGGCTGTAGAGGAAGGGG + Intergenic
1175074786 20:56363183-56363205 CATTCTGGCAGGACAGGAAAGGG + Intronic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175801318 20:61802650-61802672 CAGAATGGCTGCAAAGGAAATGG + Intronic
1175853601 20:62107061-62107083 CAGAGTGGCTGGAGGGGCAGAGG - Intergenic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1177206569 21:18017429-18017451 CAGAGTGGCTGGAAGGCAAAGGG - Intronic
1178378856 21:32091901-32091923 CAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1178640011 21:34338013-34338035 CAGTGTGGCTGGCGAGGGTGTGG + Intergenic
1178930154 21:36810994-36811016 CAGTGCTGATTGAGAGGAAAAGG + Intronic
1180013978 21:45071137-45071159 CTGTGTGGCTGGAAAGGGAAAGG + Intergenic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1181100124 22:20533287-20533309 CAGGCCAGCTGGAGAGGAAAGGG + Intronic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1181266860 22:21635544-21635566 CAGTGAGGCGGGAGATGAAGAGG - Intronic
1181320759 22:22004320-22004342 CACTGTGGGTGGGTAGGAAAGGG - Intergenic
1181551010 22:23639176-23639198 AACTGAGGCTGCAGAGGAAAGGG - Intergenic
1181630013 22:24145938-24145960 CACCCTGGCTGGTGAGGAAATGG + Intronic
1181797270 22:25319511-25319533 AACTGAGGCTGCAGAGGAAAGGG + Intergenic
1181861421 22:25822135-25822157 CAGTGTGGCTGGAATGTAACGGG - Intronic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1183203095 22:36399593-36399615 CTTTGTGGTTGGAGAGGAAAGGG - Intergenic
1183840601 22:40497430-40497452 CAGAGAGGCTGGTGAGGAAGAGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184154866 22:42660850-42660872 TAGTGTGCCTGGAGAGGGCATGG - Intergenic
1184335339 22:43849530-43849552 CAGTGTGACTTCAGAGGAACAGG + Intronic
1185022490 22:48387117-48387139 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
949393754 3:3592580-3592602 CAGTGAGGTTGTAGAGAAAAAGG + Intergenic
949600100 3:5588889-5588911 GAGTGGTGCTGGAAAGGAAAGGG - Intergenic
949669361 3:6380676-6380698 CAGGCTGGCTGGAGCAGAAATGG + Intergenic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950076474 3:10190912-10190934 CACTGTGGCTGGGGAAGAGAGGG + Intronic
950161939 3:10766803-10766825 TACTGTGGCTGCAGAGGAAATGG - Intergenic
950194278 3:10998300-10998322 CTGTGAGGCTGGGGAGAAAAGGG + Intronic
950345170 3:12287164-12287186 CAGCGTGGCAGGAAAAGAAAAGG + Intergenic
950531221 3:13553306-13553328 GAGTGGGCCTGGAGAGGACAAGG + Intronic
950542344 3:13620042-13620064 CAGTGTGGCTGCATAGGAATGGG + Intronic
950608132 3:14102871-14102893 CAGTGAGGCTGCAGAGAAAATGG + Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
952121173 3:30246159-30246181 CAGTGTGGCTGCTGATGAAGAGG + Intergenic
952486644 3:33818424-33818446 CAGTGTGGCAGGAGAGAGCAAGG - Intronic
952533095 3:34282189-34282211 CAGAGTGGCTCCAGAAGAAAAGG - Intergenic
952849930 3:37719545-37719567 CAGGGTGGGTGGAGGGGACATGG - Intronic
953201420 3:40781374-40781396 CAGCTTGGCGGAAGAGGAAAGGG + Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953407244 3:42665533-42665555 CAGAGTAGCTGGTGAGGAACTGG - Exonic
954225827 3:49180448-49180470 CTGAGTGACTGGAGAGGGAATGG - Intronic
954747673 3:52796198-52796220 CAGGGTGACTGGACGGGAAAGGG + Intronic
955336308 3:58089004-58089026 CACTGTGGCAGGGGAGGGAAGGG - Intronic
955408675 3:58642111-58642133 CATTGAGGCTGGAGTGGAACAGG + Intronic
955474348 3:59320475-59320497 CAATCAGGCTGGAGAAGAAAGGG - Intergenic
955809188 3:62768701-62768723 TAGTCTAGGTGGAGAGGAAAAGG + Intronic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956559742 3:70561819-70561841 CAGTGAGGATGTGGAGGAAAGGG - Intergenic
957481420 3:80801880-80801902 CAGTGAGGATGCAGAGAAAATGG + Intergenic
957689396 3:83548404-83548426 CAGTGTTGTTAGAGAGGTAAAGG + Intergenic
958495042 3:94834316-94834338 CAGTGAGGTTGCAGAGAAAAGGG + Intergenic
959166145 3:102780781-102780803 TCCTGTGACTGGAGAGGAAATGG - Intergenic
959388903 3:105748502-105748524 CAGTGGGGATATAGAGGAAAAGG + Intronic
959494351 3:107032055-107032077 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
959538336 3:107512439-107512461 AAGTATGACTGGAGAGGAGAAGG + Intergenic
960456395 3:117878189-117878211 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
961537587 3:127579382-127579404 CACTGTGGCTAGCAAGGAAAGGG - Intronic
961815963 3:129550525-129550547 CAGAGTGGCTGGAGGGTTAACGG - Intronic
962960781 3:140309430-140309452 CTGGGTGTCTGTAGAGGAAAAGG + Intronic
963033672 3:141005195-141005217 CGGGGTGGGTGGAGAGGAAGAGG - Intergenic
964093752 3:152907337-152907359 TAGTGAGGCTGCAGAGAAAATGG + Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964586499 3:158311566-158311588 CAGTATGTGTGTAGAGGAAAAGG - Intronic
964732384 3:159881423-159881445 CAGTGTGGCTCGAGAGCCATTGG - Intronic
965284189 3:166796145-166796167 TAGTGAGGATGCAGAGGAAAGGG + Intergenic
965708166 3:171530521-171530543 CAGTGAGGCAGGAAACGAAAGGG + Intergenic
965716942 3:171614850-171614872 CACTGTGGTGGGAGAGGAATGGG - Intronic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966323209 3:178724118-178724140 TGGTGAGGCTGGAGAGAAAAGGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966492610 3:180544971-180544993 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
966726082 3:183109888-183109910 CAGTGAGGCTGTAGAGAAAAGGG - Intronic
966828690 3:183987569-183987591 CAGTGTTGCCAGAGAAGAAATGG - Intronic
966965699 3:184990264-184990286 CAGTGAGGGTGGAAAGGCAAGGG - Intronic
967229121 3:187320895-187320917 CAGTGGACCTGGAGAGGAAAAGG - Intergenic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
968862637 4:3184809-3184831 CAGACTGGCTGGAGAGGAGGAGG + Intronic
969299536 4:6289627-6289649 CAGAGAGGCAGGGGAGGAAAGGG + Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970269846 4:14334373-14334395 CAGTGAGGTTGCAGAGAAAAAGG + Intergenic
970336842 4:15055795-15055817 CACTGAGGCTGGAGAGAACAAGG - Intronic
970680822 4:18505928-18505950 TAGTGAGGCTGCAGAGAAAAGGG - Intergenic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
970780783 4:19734978-19735000 CATCGGGACTGGAGAGGAAAAGG + Intergenic
970894438 4:21086005-21086027 CAGTGAGGGAGCAGAGGAAATGG - Intronic
971317615 4:25580592-25580614 TAGTGTGGCCTGAGAGGAAGAGG + Intergenic
971434985 4:26611081-26611103 CAGGGAGGCTGTAGAGAAAAGGG - Intronic
972086989 4:35230162-35230184 GAATGTGGCTGGAGAGAAATAGG - Intergenic
972847990 4:43013031-43013053 TAGTGAGGCTGCAGAGAAAAGGG + Intronic
972926548 4:44015715-44015737 CAAGGTGGCAGGAGAGGCAAGGG - Intergenic
972994686 4:44865326-44865348 TGGTGTGGCTGCAGAGAAAATGG - Intergenic
973163317 4:47046101-47046123 CAGAGTGGCCGGAGAGAGAAGGG - Intronic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
974277812 4:59748677-59748699 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
975547137 4:75571347-75571369 CAGTGTGTCTGGAGTGGGAAAGG - Intergenic
976116215 4:81730391-81730413 CAGTGAGGTTGTAGAGAAAAAGG + Intronic
977350902 4:95885853-95885875 CAGTGTTGCTGGGTAGAAAATGG + Intergenic
977845809 4:101765234-101765256 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
978400464 4:108325350-108325372 CAGCATGGCTGGAGAGCACAGGG + Intergenic
978462468 4:108971567-108971589 CAGTGTGTCTGAAGAGGACATGG + Intronic
979174478 4:117646068-117646090 TAGTGAGGCTGAAGAGAAAAGGG - Intergenic
979268506 4:118731986-118732008 CAGTGTGGCTGAAGTGGGATGGG + Intronic
980464203 4:133152140-133152162 CAGGGTGGCGGTGGAGGAAAGGG - Exonic
980862956 4:138521579-138521601 AAGAGTGGATGGAGAGGCAATGG + Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
982020569 4:151199612-151199634 CAGTGTGGCAGGAAAGAAGAGGG - Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
982673600 4:158350379-158350401 CAGTGGAGCTGAAAAGGAAATGG - Intronic
983556137 4:169060727-169060749 CTGTGTAGCAGAAGAGGAAATGG + Intergenic
983577530 4:169274567-169274589 CAGAATTGATGGAGAGGAAAAGG - Intergenic
983695014 4:170517713-170517735 CATTGTGCCAGGAGGGGAAAAGG + Intergenic
984507380 4:180636770-180636792 CAGTGTGGAGGAAGGGGAAAGGG - Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985088528 4:186340287-186340309 GAGTGAGACTGGAGAGGAAGAGG + Intergenic
985354744 4:189106453-189106475 CAGAGTGTCGGGAGAGGATAAGG - Intergenic
985912686 5:2896079-2896101 CAGAGGGGCTGGGGAGGAACTGG + Intergenic
986215656 5:5716669-5716691 GAGTATGGATAGAGAGGAAAGGG + Intergenic
986992727 5:13572487-13572509 AAGTGGGGCTGGAAAGGAACAGG - Intergenic
987037542 5:14033194-14033216 GGGTGTGGCTGGGGAGGAGAGGG - Intergenic
987079044 5:14409887-14409909 GAGCGGGGCTGGAGAGGCAATGG - Intronic
987996629 5:25290474-25290496 TGGTGAGGCTGCAGAGGAAAAGG + Intergenic
988879625 5:35486907-35486929 CAGTGTGGAATGAGAGGTAAAGG + Intergenic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
990742093 5:58922673-58922695 CGGTGGGGCTGGGGAGGAAATGG - Intergenic
990746108 5:58960695-58960717 CAGTTTGGTTGGAAAGGAATGGG - Intergenic
990981184 5:61603733-61603755 CAGACTGGATGGAGAGGAAAGGG + Intergenic
991446198 5:66702677-66702699 GAGTGTGGCTGGAGCAGAACAGG + Intronic
991770000 5:70031445-70031467 CAGTTTGACTGGAGATGAGAAGG + Intronic
991849295 5:70906864-70906886 CAGTTTGACTGGAGATGAGAAGG + Intronic
992441485 5:76801274-76801296 CTGTGTGGCTGGAGAGAGCATGG + Intergenic
992900936 5:81294628-81294650 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
993706473 5:91177455-91177477 CAGGGTGGCTGGAGTGGTAAGGG - Intergenic
994695784 5:103072049-103072071 AAGGGTGGCTGGTGAGGGAAGGG - Intergenic
995033138 5:107502249-107502271 CAGTGAGTCATGAGAGGAAATGG - Intronic
995696849 5:114888356-114888378 CAGTGAGGCTGTAGAAAAAAAGG + Intergenic
996031674 5:118712048-118712070 CACTGTGGCTGGTGAGGCACTGG - Intergenic
996549241 5:124712532-124712554 CAGAGTGGCTGGAGAGGGACTGG + Intronic
997608449 5:135193209-135193231 CAGAGTGGCTGGAAATAAAAGGG - Intronic
997827794 5:137123188-137123210 CAGTGTTGGAGGAGAGGAGACGG + Intronic
998253926 5:140570738-140570760 CAGTCTGGCTGGAGCTGAACAGG - Intronic
998305086 5:141068211-141068233 AAGAGAGGCTAGAGAGGAAAGGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998718933 5:144920033-144920055 CAGTGTGATTGGTGAGGCAATGG + Intergenic
998943374 5:147310404-147310426 CTTTCTGGCTGGAGAGGCAAAGG + Intronic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999203637 5:149833305-149833327 CACTGCGGCTGGAGGTGAAAAGG + Exonic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999596771 5:153214143-153214165 AAGTGTGAATAGAGAGGAAAAGG + Intergenic
999903468 5:156112830-156112852 CAGAGTGCCTGGCTAGGAAATGG - Intronic
1000037001 5:157456504-157456526 CATTGTGGCTAGAGGAGAAAAGG + Intronic
1000059216 5:157638301-157638323 CAGTGTGGCTGGATGGCCAAGGG + Exonic
1000243071 5:159426528-159426550 GACTGTGGTTGGGGAGGAAAAGG + Intergenic
1001180322 5:169514107-169514129 GGGAGTGGCTGGAGAGGAAGGGG + Intergenic
1001200795 5:169714430-169714452 GATTGTGGATGGAGAGGAAGTGG + Exonic
1001805906 5:174585977-174585999 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002107752 5:176888558-176888580 TAGAGGGGCTGGAGGGGAAAGGG + Exonic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1002634960 5:180602736-180602758 CTGTGTGCCTGAGGAGGAAAGGG + Exonic
1002660527 5:180788370-180788392 CTGTGAGGGTGGAGAGGAAGAGG - Intergenic
1002867045 6:1130809-1130831 CTGTGTTGCTGGTGAGGCAAAGG - Intergenic
1002885501 6:1290158-1290180 CAATGTAGATGTAGAGGAAATGG + Intergenic
1003002694 6:2350803-2350825 CGGTGAGGCTGCAGAGAAAAGGG - Intergenic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1003575274 6:7287470-7287492 CATTGTCCCAGGAGAGGAAAAGG - Exonic
1003668221 6:8131407-8131429 CAGCTTAGATGGAGAGGAAATGG - Intergenic
1004086107 6:12451193-12451215 AAGTGTGGCTGGAGAGGGCAGGG + Intergenic
1004363617 6:14993305-14993327 CAGGGTAGCGGGAGAGGGAATGG + Intergenic
1004395304 6:15242559-15242581 CAGCGAGGCTGGATTGGAAATGG + Intergenic
1005088657 6:22033514-22033536 TAGTGAGGCTGCAGAGAAAAAGG - Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1006046804 6:31305813-31305835 CTCTGTGCCTGGAGAAGAAAGGG + Intronic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1006430616 6:33993446-33993468 GAGTGAGGCTGGAGAGGATTGGG + Intergenic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007626068 6:43247063-43247085 CAGTGTGGCGGAGGAGGAAGAGG + Intronic
1007741949 6:44016958-44016980 TGGTGTGCCTGGAGAGGACATGG + Intergenic
1008237487 6:49067821-49067843 CAGTGAAGATGTAGAGGAAAGGG + Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1009701780 6:67193636-67193658 CAAAGTTGCTGGAGAGGATATGG - Intergenic
1010629355 6:78178934-78178956 CAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012401014 6:98843086-98843108 CAGGAAGACTGGAGAGGAAAGGG + Intergenic
1013033218 6:106356411-106356433 CAGTGATGCTGGAGAAGAGAGGG - Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013573881 6:111459775-111459797 CAGTGGGGCTGTGGAGAAAAGGG + Intronic
1013816211 6:114101557-114101579 TAGTGAGGCTGCAGAGAAAAGGG + Intronic
1013825432 6:114205433-114205455 CAGAGTAACTGGAGAGGGAATGG - Intronic
1013984800 6:116177866-116177888 CAGGGAGGTTGGAAAGGAAATGG + Intronic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015655895 6:135518784-135518806 CAGTGTTTCTGGGGAGGAAATGG - Intergenic
1015816898 6:137220005-137220027 CAATGTGGCTGCAGTGGAATAGG - Intergenic
1016389703 6:143562327-143562349 CAATGAGGCTGGAAAGCAAAGGG + Intronic
1017602562 6:156099756-156099778 CAGGGTGGCAGGAGAGAAAAGGG - Intergenic
1017889608 6:158627673-158627695 CAGCGTGGCTGGAGATGAGCAGG + Intronic
1018198530 6:161375606-161375628 CTGTGTGGCAGGCGACGAAAAGG + Intronic
1018209735 6:161469290-161469312 CAGGGTGGCAGGAGAGAGAATGG - Intronic
1018254908 6:161908367-161908389 CAATCTGGCAGGAGAGGAGAAGG - Intronic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018934640 6:168265683-168265705 CTCTGTGGCTTGAGAGGAGACGG + Intergenic
1019310427 7:357765-357787 CAGGGTGGGTGGGCAGGAAAGGG - Intergenic
1020417263 7:7960452-7960474 CATTGTGGCTGGAACTGAAAAGG + Intronic
1020428383 7:8094975-8094997 CAGTGTGGCATAAGAAGAAATGG + Intergenic
1020564562 7:9778880-9778902 GAGGGTAGCTGGAGAGGGAATGG + Intergenic
1020657172 7:10941256-10941278 TAGTGTGGCTGGAAAGTAAAAGG + Intergenic
1020990306 7:15187398-15187420 CAGAGAGGCTGGAGAGGCAATGG - Intergenic
1021665857 7:22978874-22978896 GAGTGTGGTGGGAGAGGAAAAGG - Intronic
1021870065 7:24996907-24996929 AAGAGTGGCTGGAGAGGATGTGG - Intergenic
1022067738 7:26877326-26877348 CAAGCTGGCTGGAGAGGAATTGG - Intronic
1022130669 7:27401704-27401726 GAGAGGGGCTGGAGAGGAACAGG - Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023148265 7:37174452-37174474 CATTGTGCCTAAAGAGGAAAGGG + Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023300395 7:38764387-38764409 AGGTGAGGCTGGAGAGGAAGGGG + Intronic
1023312492 7:38902340-38902362 CAGTGTGGCTGGAGGGTCACAGG - Intronic
1023745436 7:43318747-43318769 CAGGGTGTCAGGAGAGAAAAGGG + Intronic
1023991239 7:45130073-45130095 GAGGGTGGCTGGGGAGAAAAGGG - Intergenic
1025107621 7:56185266-56185288 CAGGGTGGCAGGAGAGAGAATGG - Intergenic
1026310625 7:69180824-69180846 CAGGGTGGCAGGAGAGAGAATGG + Intergenic
1026666867 7:72348342-72348364 CTGTATCGCTGCAGAGGAAAAGG + Intronic
1028856345 7:95597644-95597666 TAGAGTGTCGGGAGAGGAAAAGG - Intergenic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030132986 7:106218911-106218933 CTTTGTGGATGGAGAGGAATGGG + Intergenic
1030333934 7:108303379-108303401 CAGAGGGGCTGAAGAGGAGACGG - Intronic
1030361534 7:108600150-108600172 CAGGGTGGCAGGAGAGAGAATGG + Intergenic
1030576986 7:111300454-111300476 CAATGTGGCTAGAGAGTACATGG - Intronic
1030955356 7:115845076-115845098 GAATGTGGGTGGTGAGGAAATGG + Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032778327 7:135139227-135139249 TAGTGAGGTTGCAGAGGAAAGGG - Intronic
1032805249 7:135347853-135347875 CAGAGGGGATGGAGAGGATATGG - Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033586387 7:142777821-142777843 TGGTGAGGCTGCAGAGGAAATGG - Intergenic
1034336063 7:150324271-150324293 CAGAGGGGCTGGAGAGGGACTGG + Intronic
1034533230 7:151710405-151710427 CAGTGTGGCAGCGGAGCAAAGGG - Intronic
1036158093 8:6361101-6361123 CAGGCTGGATGGAGAGGCAAGGG + Intergenic
1037104879 8:15094821-15094843 CAGGGTGGCAGGAGAGAGAATGG - Intronic
1037173169 8:15917916-15917938 CAGTGTCACTGAAGAGGGAAGGG + Intergenic
1037261955 8:17019535-17019557 CAGAGTGTCTGTAGTGGAAAAGG - Intergenic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037604472 8:20425757-20425779 CAGGGTGGCTGGGGAGCCAAAGG + Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038772197 8:30493380-30493402 CAGTGAGACAGGAGAGGAAAAGG + Intronic
1039247190 8:35621872-35621894 TAATGTGGCTGAAGAGGAAATGG + Intronic
1039385051 8:37128278-37128300 CATTGTGGCTGGAGAGTGAGTGG + Intergenic
1039436642 8:37564105-37564127 AGGTGTGGCTGTGGAGGAAATGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039954002 8:42193559-42193581 CAGCGTGGCTGCTGGGGAAAAGG - Intronic
1040083914 8:43319164-43319186 CTGTGTTGCTGCAGAGGAAATGG + Intergenic
1040836779 8:51740464-51740486 TAGTGAGGCTGTAGAGGAATAGG - Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043208997 8:77486742-77486764 TAGTCTTTCTGGAGAGGAAAAGG - Intergenic
1043695136 8:83208200-83208222 CAGTGAGGCTGAAGTGGCAAAGG - Intergenic
1044804105 8:95987360-95987382 CAAGGTGGCTGGAGTGGAATGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1046173184 8:110539929-110539951 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1046356355 8:113090608-113090630 CAGTGTGGATGGGGAAGAAAGGG - Intronic
1046932631 8:119856187-119856209 CAATGTGGACGGCGAGGAAATGG - Intergenic
1046970977 8:120223112-120223134 CAGTGTGGCTGGAACCCAAAAGG + Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1048192339 8:132301335-132301357 CATGGTGGCTGGAGTGGACAGGG - Intronic
1048324329 8:133427489-133427511 CAATGAAGCTGGAGAGAAAAGGG + Intergenic
1049627678 8:143633265-143633287 GAGTGTGGCTGGAAGGCAAAAGG - Intergenic
1049673454 8:143879591-143879613 CAGTGTGGCAGGTGTGGACAGGG - Intergenic
1049713312 8:144077348-144077370 CAGAGTGGCTGTAGAGCAGAGGG + Intergenic
1050135027 9:2453622-2453644 CCAGGTGGCTGAAGAGGAAATGG + Intergenic
1050237216 9:3594658-3594680 CAGGGTGGCAGGAGAGAGAAGGG + Intergenic
1050504300 9:6331459-6331481 CACTGTGGCTAGAGAGGAAGGGG + Intronic
1050885252 9:10756513-10756535 CAGTGAGGCTGTGGAGAAAAGGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1052325759 9:27215288-27215310 CCTTGGGGCTGGGGAGGAAAGGG + Intronic
1052355655 9:27502593-27502615 CCGTGTTCCTGGGGAGGAAAGGG - Intronic
1052886416 9:33652542-33652564 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
1052902139 9:33802477-33802499 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
1053161320 9:35815130-35815152 CAAAGTGGCTGCAGAGGCAATGG - Intronic
1053196765 9:36125829-36125851 CAGTGTAGCTGGAAGGGCAAGGG - Intergenic
1054821565 9:69526577-69526599 CAGTGAGGCTGTGGAGAAAAGGG + Intronic
1055290775 9:74779829-74779851 CAATGTGGTTGGAGAGGAATGGG + Intronic
1055745171 9:79436291-79436313 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1056765104 9:89440275-89440297 CACAGGGGCTGGAGAGGAATGGG - Intronic
1057020437 9:91693268-91693290 CAGTTTGGGTGGAGAGGCCAAGG - Intronic
1057730083 9:97601002-97601024 CAGAGAGGCTGGTGATGAAAAGG + Exonic
1058069906 9:100591387-100591409 CAGTGTGGCTGAGGAACAAAGGG + Intergenic
1058557814 9:106188569-106188591 TAGTGAGGCTGCAGAGAAAAGGG - Intergenic
1058578766 9:106431927-106431949 CACTGTTGCTGGAGTGTAAACGG - Intergenic
1058793486 9:108473942-108473964 CACTGAGGCTGGTGAGGACAGGG - Intergenic
1058906496 9:109486431-109486453 CAGTTTGGGTGGAGTGGAAAAGG + Intronic
1059047193 9:110881736-110881758 CAGTGTGGAGGAAGAGGAATTGG - Intronic
1059303877 9:113339024-113339046 CAGAAAGGCTGGAGAGGACATGG + Intronic
1059760696 9:117334610-117334632 CACTGTGGCTGGTGTGTAAAAGG - Intronic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1059874619 9:118620540-118620562 GAGTGTGGCTGGTGAAGACATGG - Intergenic
1060152122 9:121295549-121295571 CACTGTGGCTGGGGATGGAAGGG + Intronic
1060228800 9:121812388-121812410 CAGGGTAGCTGGAGAGGACTTGG + Intergenic
1060314118 9:122492632-122492654 CGGTGAGGCTGCAGAGAAAAGGG - Intergenic
1060492305 9:124093801-124093823 CAGGGTGGCTGAACAGGGAAGGG + Intergenic
1060857195 9:126924268-126924290 CAGTGTGACTGTATAGGAAAAGG + Intronic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061070128 9:128304534-128304556 CAGTGTGGGAAGAGAGGAACTGG + Intergenic
1061299924 9:129698368-129698390 CAGTCTGGCTGCAGAGAAGAGGG + Intronic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061399589 9:130361094-130361116 AAGTGTGGTTGGATAGAAAATGG - Intronic
1061432074 9:130537347-130537369 CAGTGGGGCCAGCGAGGAAAGGG - Intergenic
1061750448 9:132773336-132773358 CAGGAAGGCTGGAGAGGACAGGG - Intronic
1061764797 9:132875004-132875026 CAGGGTTCCTGGAGAGGAAGAGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061799027 9:133104182-133104204 CACCGTGGCTAGAGAGGAAAGGG + Intronic
1062267641 9:135694686-135694708 GACTGTGGCTGGAGAGAAACCGG - Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1185973398 X:4690672-4690694 CAGTGAGAGTGAAGAGGAAATGG + Intergenic
1186835609 X:13434425-13434447 CATTGAAACTGGAGAGGAAAGGG + Intergenic
1187184955 X:16975349-16975371 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1187823009 X:23308338-23308360 GAGTGTGGCTGGATGGGGAAAGG + Intergenic
1188429139 X:30085773-30085795 CAGTGAGGCTGCAGAGAGAAGGG + Intergenic
1190212472 X:48459452-48459474 CAGGATGGCTGGAGGTGAAAGGG - Intronic
1190641930 X:52488300-52488322 GGGTGCGGGTGGAGAGGAAACGG + Intergenic
1190645742 X:52524566-52524588 GGGTGCGGGTGGAGAGGAAACGG - Intergenic
1190897658 X:54637007-54637029 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1192175518 X:68882528-68882550 CCCTGCTGCTGGAGAGGAAATGG - Intergenic
1192658500 X:73017974-73017996 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1193499314 X:82254610-82254632 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1193623943 X:83793990-83794012 CAGTGCAGCTAGAGTGGAAAGGG + Intergenic
1193942441 X:87692206-87692228 TGGTGAGGCTGCAGAGGAAAGGG + Intergenic
1194201647 X:90958909-90958931 CAGTTTCACTGGAGAGGCAATGG - Intergenic
1194233433 X:91352196-91352218 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1194429401 X:93782421-93782443 CAGTGTGACTGGAGCATAAAGGG + Intergenic
1194847864 X:98833964-98833986 TAGTGAGGCTGCAGAGAAAAAGG - Intergenic
1195672911 X:107484253-107484275 CAGTGCTGCTGGGGAAGAAAGGG + Intergenic
1195792895 X:108608156-108608178 CATTGTGGGTGGAGTGTAAATGG - Intronic
1195949408 X:110251670-110251692 CAGTGAGGCTGAAGAGGATGGGG + Intronic
1196265628 X:113641904-113641926 CGGTGAGGCTGCAGAGAAAAGGG - Intergenic
1196337228 X:114551481-114551503 CAGTTTGCCTGGAGGGCAAATGG - Intergenic
1196492157 X:116280710-116280732 CAGTTTGGCTGAAGTGAAAATGG + Intergenic
1196642628 X:118080618-118080640 CAGTGAGGCTGCAGAGAAAAGGG + Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196704509 X:118705244-118705266 CAGTGTCACTGGATAGGAAGGGG - Intergenic
1197579121 X:128259855-128259877 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197973460 X:132139438-132139460 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198787919 X:140311615-140311637 CGGTGAGGCTGTAGAGCAAAGGG + Intergenic
1199227344 X:145393728-145393750 AAGAGGGGGTGGAGAGGAAAAGG - Intergenic
1199372720 X:147070046-147070068 CAGAGAGACTGGAGAGGAAGGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199940802 X:152625860-152625882 CAGTGTGACTAGAAAGTAAAGGG + Intergenic
1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG + Intronic
1200381006 X:155837283-155837305 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1200547486 Y:4534364-4534386 CAGTTTCACTGGAGAGGCAATGG - Intergenic
1201370658 Y:13259523-13259545 CAATGTGGCTGGAAAGTAGATGG - Intronic
1201506972 Y:14712584-14712606 AAGGGTGGCTGGTGAGGAAGAGG - Intronic