ID: 1119068163

View in Genome Browser
Species Human (GRCh38)
Location 14:71551748-71551770
Sequence CAGTGTGGCTGGAGGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 760
Summary {0: 1, 1: 1, 2: 12, 3: 93, 4: 653}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119068163_1119068171 -7 Left 1119068163 14:71551748-71551770 CCCTTTCCCCTCCAGCCACACTG 0: 1
1: 1
2: 12
3: 93
4: 653
Right 1119068171 14:71551764-71551786 CACACTGGCACTCTTTACCTTGG 0: 1
1: 1
2: 2
3: 12
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119068163 Original CRISPR CAGTGTGGCTGGAGGGGAAA GGG (reversed) Intronic
900029096 1:357890-357912 AAGTGTGGGTGTTGGGGAAAGGG - Intergenic
900278972 1:1853093-1853115 CACAGGGGCAGGAGGGGAAAGGG - Intronic
900411850 1:2516115-2516137 CAGTGTGACTGCAGGGGTCACGG - Intronic
900433242 1:2612675-2612697 CAGTGAGGGTGGAGGGGCTAGGG - Intronic
900509235 1:3050612-3050634 CAGAGTGTCTGGTGGGGCAAGGG + Intergenic
900597838 1:3490579-3490601 CAGTGTGCCCGCTGGGGAAAAGG + Exonic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
900791702 1:4684983-4685005 CACTGTGGCAGGAGGAAAAAAGG + Intronic
900804370 1:4757529-4757551 GAGTGTGGCTGGAGGGGGTGAGG + Intronic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901238865 1:7681466-7681488 CTTTGTGGGTGGAGGAGAAATGG - Intronic
901678436 1:10900036-10900058 CAGTGCTACTGGATGGGAAAGGG + Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901926082 1:12567112-12567134 CAGGGTGGCAGGAGGGGAGCAGG - Intergenic
902080295 1:13816025-13816047 CAGGGAGGCAGGTGGGGAAATGG + Intronic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
902177285 1:14660116-14660138 CAGTGGGGCTGGGAGGGGAAGGG + Intronic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
902915067 1:19633353-19633375 CCATGTGGCAGGAAGGGAAAAGG - Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904824936 1:33268267-33268289 CAGAGTGGGTGGAGGGGACTTGG + Intronic
904937325 1:34140928-34140950 AAGTGAGGCTGGAGGGGGACAGG - Intronic
905055520 1:35090264-35090286 TAGGGTGGCAGGAAGGGAAAGGG + Intronic
905093047 1:35445100-35445122 CAGTGTGGCTGGGTGGGACCTGG + Intronic
905771741 1:40642569-40642591 AAGGGTGGCTGGAAGGGAATAGG - Intronic
905859756 1:41342404-41342426 CAGGGAGCCTGGAGGGGCAAGGG - Intergenic
907313599 1:53553837-53553859 CTGTGTGGCTGGAGCAGAACGGG + Intronic
907448074 1:54522279-54522301 CAGTCTCCCTGGTGGGGAAAGGG + Intergenic
907677488 1:56532105-56532127 GAGTGTGGGTGGTGGAGAAAGGG + Intronic
908111745 1:60904803-60904825 CAGTGTGGCTTAATGGGACAAGG - Intronic
908456184 1:64307133-64307155 CAGTGTTGATGATGGGGAAAAGG - Intergenic
909101752 1:71357490-71357512 CAGGGTGGTTGGAGGGTATAGGG + Intergenic
909203673 1:72725712-72725734 CAATGTGGCTTTAGGGGAGATGG - Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909586183 1:77291319-77291341 TAGAGTGGCAGCAGGGGAAATGG - Intronic
911463738 1:98224210-98224232 CAGTGTGGCTGAAGCATAAAAGG + Intergenic
911733092 1:101309956-101309978 CAGGGAAGCTGGAGGAGAAACGG - Intergenic
911821473 1:102429301-102429323 CAGTGTTTCTGCAGAGGAAAAGG - Intergenic
912207342 1:107523218-107523240 CTGTGTGGCTGGAGCAGAACAGG - Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912617625 1:111121105-111121127 CAGTGTGTCTGATGGTGAAAAGG + Intronic
912747705 1:112259159-112259181 GATTTTAGCTGGAGGGGAAAGGG - Intergenic
913320821 1:117587292-117587314 CATGGTGGCTGGCAGGGAAAGGG - Intergenic
914417585 1:147498209-147498231 CACAGTTGCTGAAGGGGAAAGGG - Intergenic
914852059 1:151322120-151322142 CAGTCAGACTGGAAGGGAAATGG + Intronic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915280796 1:154820863-154820885 CACTGTGGCTGGCTGGGACATGG - Intronic
915302263 1:154958479-154958501 GAGTGTGGCTGCAAGAGAAAAGG - Exonic
915363428 1:155300066-155300088 CTGTGTGGCTGCAGGGGGATGGG + Intronic
916074703 1:161193661-161193683 CAGTGTTGCAGGAGCGGAAGCGG + Exonic
916195524 1:162218755-162218777 GAGTGGGGCTGGAAGGGACAGGG - Intronic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916649645 1:166822809-166822831 CAGTGTGGCTAAAGGGGTAGTGG + Intergenic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
917701614 1:177587384-177587406 CTGTGTGGCTGGAAGGGAATTGG - Intergenic
917737954 1:177937372-177937394 GAGCCCGGCTGGAGGGGAAAGGG + Exonic
918068739 1:181119577-181119599 CAGGGTGGCTGCAGGGGATCTGG + Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919352070 1:196470454-196470476 CTGTGTAGCTGAAGGTGAAATGG + Intronic
919371631 1:196734647-196734669 CAGTGTGCCTGTGGGGGGAAGGG + Intronic
919373732 1:196764341-196764363 AAGTGTGGGGAGAGGGGAAAGGG + Intergenic
919380173 1:196849018-196849040 AAGTGTGGGGAGAGGGGAAAGGG + Intronic
919666836 1:200300596-200300618 CAGTGTGCATGGATGGGACAGGG - Intergenic
919823782 1:201489559-201489581 CAGTGAGGCTGGTGTGGCAACGG + Intronic
919977992 1:202625451-202625473 CAGTGTGCGGGGAGGGGGAAGGG + Intronic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920245182 1:204582516-204582538 CAGTGTGGCTGTCGGGGGACAGG + Intergenic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920711865 1:208302893-208302915 CAGTGGGGCTGGAGAGGTAGTGG + Intergenic
920743801 1:208606622-208606644 CAGTGTGTGTTGAGGGGCAAGGG - Intergenic
920878991 1:209862979-209863001 CCCTGTGGCTGGAGGTGGAAAGG - Intergenic
921712147 1:218383642-218383664 CAGTATGGCTGAAGGGACAAAGG - Intronic
922894016 1:229086897-229086919 CAGTCATGCAGGAGGGGAAAGGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923229497 1:231971550-231971572 CAGGGTGGCTGGAGAGGAAGGGG - Intronic
923699189 1:236283434-236283456 AAGAGTTGCTGGAGGGGAAAAGG - Intergenic
1064094517 10:12413191-12413213 CAGTCATGGTGGAGGGGAAAGGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065001971 10:21345526-21345548 CATTGGGGCTGGAGGGGGAGGGG + Intergenic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065305335 10:24363319-24363341 AAATGTGGCAGGAAGGGAAAGGG - Intronic
1065916595 10:30358535-30358557 GAGAGGGGCTGGAAGGGAAAGGG - Intronic
1066160535 10:32723005-32723027 CAGTGAAGCTGGAGGTGAACTGG - Intronic
1066254219 10:33662883-33662905 CAGTCTTTCTGGGGGGGAAAAGG + Intergenic
1066981682 10:42422463-42422485 CAGTGTAGCTGAAGGAGAGATGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1068962063 10:62877037-62877059 CAGGGAGGCTGCAGGGGAAGGGG - Intronic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1070280631 10:75045660-75045682 CAGTGTGGCTGAAGTGGCAAGGG + Intronic
1070507560 10:77127639-77127661 CAGGAAGGCAGGAGGGGAAAGGG + Intronic
1070707111 10:78647736-78647758 CAAGGTGGCTGGAGAGGGAAGGG - Intergenic
1070868841 10:79729968-79729990 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071009622 10:80922798-80922820 GTGTGTGGGTGGAGGGGTAAGGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071277952 10:84073597-84073619 AAGTGTGCGTGGATGGGAAAAGG + Intergenic
1071363227 10:84871993-84872015 TAGTGAGGCTGTAGAGGAAAGGG + Intergenic
1071635756 10:87252187-87252209 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071659487 10:87485789-87485811 CTCTGTGGCTGGAATGGAAATGG - Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1074434075 10:113418754-113418776 AAGTTTGGCTGGAGGGGTAATGG + Intergenic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1075121175 10:119666096-119666118 CAGAGGGCCTGGAGGGTAAAGGG - Intronic
1075259127 10:120947911-120947933 CCGTGTGGCTGGAGCAAAAAAGG - Intergenic
1075780980 10:125016954-125016976 CACTGTGGATGGAAGGGGAATGG + Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1077133474 11:986762-986784 CTGTGTGGAGGGAGGGGAAGTGG - Intronic
1077245021 11:1532566-1532588 CACCATGTCTGGAGGGGAAAAGG + Intergenic
1077498471 11:2898078-2898100 GACTGTGGCTGGAGGGGAAGTGG - Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077908789 11:6557033-6557055 TAGTGTGGGTGGAGGGGTGAAGG - Exonic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078171481 11:8932169-8932191 CAGGGTGCTTGGAGGGCAAAGGG + Exonic
1078216204 11:9314255-9314277 CTGTGTGTCGGGTGGGGAAAAGG - Intronic
1078858555 11:15226494-15226516 AAGTGTGGCCAGAGGTGAAATGG - Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1079158323 11:17969520-17969542 GAGTGTGGGTGGAGGGGTGAGGG + Intronic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080395765 11:31888462-31888484 CAATGTGGCTGAAGGGGGACAGG + Intronic
1080708134 11:34718780-34718802 CAATGTGGCTGGAGCAGAACAGG + Intergenic
1081646289 11:44792827-44792849 GAGTGTGGCTTGTGGGGCAAGGG + Intronic
1081717120 11:45258316-45258338 CAGTGGGGGTGGAGGTGCAAAGG - Intronic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1082576854 11:54817266-54817288 CACTGTGGCAAGAGGAGAAAGGG - Intergenic
1083591575 11:63898420-63898442 CAGTGTGCCAGAAGGGGAGATGG - Intronic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1084730699 11:71071720-71071742 CAGAGTGGCTGGAGGGGCCTGGG + Intronic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1085278298 11:75314060-75314082 CAGTGTGGCTGGAGGGTGTGTGG - Intronic
1085303959 11:75474678-75474700 CAGCGTGGATGGAGAGGAAGGGG + Intronic
1085515541 11:77109753-77109775 CGGTGAAGCAGGAGGGGAAATGG + Intronic
1086259166 11:84916795-84916817 CAGTGTGGCTGAAGAGAGAAAGG - Intronic
1087905682 11:103694289-103694311 CAGTGTTGATGAAGGGGGAAGGG + Intergenic
1088250751 11:107858999-107859021 CAGGGTGGCAGGAGGAGAAAGGG + Exonic
1088632331 11:111785849-111785871 TAGTCTTGCTGGAGGTGAAAAGG + Intronic
1089162012 11:116445605-116445627 CAGACAGGCTGGAGGGGAAGGGG - Intergenic
1089430971 11:118424200-118424222 CAGTGTGGCTGGAGGAAGAGTGG - Intronic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089733370 11:120533471-120533493 CAGTGAGGCAGCAGGGGCAATGG - Intronic
1090226405 11:125074620-125074642 GAGTGGGGTGGGAGGGGAAAGGG + Intronic
1090361090 11:126173195-126173217 CCGTGTGGCTTGAGGGGAAAGGG + Intergenic
1090421455 11:126578266-126578288 CAGAGAAGCTGGAGGGGAGAGGG - Intronic
1090523457 11:127503974-127503996 CAGGATGGCTGTAGGGGAACAGG - Intergenic
1090697175 11:129258508-129258530 AAGTTTGGCTGTAGGGAAAATGG - Intronic
1090877835 11:130806797-130806819 CAGGGTGGGAGGAGGGGAATGGG - Intergenic
1091146204 11:133282552-133282574 CAGTGCAGAGGGAGGGGAAATGG + Intronic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092954543 12:13537700-13537722 CTGGGTGGCTGGAGGGGTTAGGG - Exonic
1093471369 12:19505614-19505636 CAGCGTAGCTGGAGGGAACAAGG + Intronic
1094047108 12:26179263-26179285 TAGTGTGGCTGGACAGGAGAAGG + Intronic
1094285512 12:28788648-28788670 TAGTGTGGTTGGGTGGGAAATGG + Intergenic
1094674536 12:32606298-32606320 CAGTGTGGCTTTAGGGGGACGGG - Intronic
1095554503 12:43483955-43483977 CTGTGTGGCTGGAATGGAAGAGG - Intronic
1096394723 12:51257110-51257132 GGCTGTGACTGGAGGGGAAAGGG + Intronic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097194574 12:57236413-57236435 CAGGTGGGCTGGAGGGGATACGG + Intronic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098060036 12:66552183-66552205 CATTGTGCCTGAAAGGGAAATGG + Intronic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099324022 12:81189069-81189091 CAGGGTGGTTGGAGGGGGAGAGG - Intronic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1099693789 12:85993530-85993552 CAGTGGGGCTGGAGGGGCCTTGG + Intronic
1101404002 12:104412359-104412381 CCGTCTGGCTGGTGGGGACAGGG + Intergenic
1102159800 12:110759376-110759398 GAGTGTGGCTGGCTGGGAATAGG + Intergenic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102807601 12:115795580-115795602 CAGCCTGGCTGGAGGTGAATGGG - Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105441932 13:20422513-20422535 CAGCCTGGCTGGAGGTGCAAGGG - Intronic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106346659 13:28886099-28886121 CAGAGTTGCTGGTGGGGAGAGGG + Intronic
1106602128 13:31197177-31197199 TAGTGTGGCGGGTGGGGAGAGGG - Intergenic
1106966507 13:35077569-35077591 CAATATGGATGGAGGGGAAAGGG - Intronic
1107004290 13:35590186-35590208 CATTGTGGCTTGAAGGTAAAAGG + Intronic
1108490295 13:50975021-50975043 AAGTGTGGCTGCAGAGGGAAGGG - Intergenic
1110443248 13:75548927-75548949 CACTGTGGCTGCAGAGTAAAGGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113868834 13:113545960-113545982 CAGTGGGGCTGGAGATGAAGGGG + Intronic
1114057788 14:18988943-18988965 CTGTGTTGCTGCAAGGGAAATGG + Intronic
1114104759 14:19412810-19412832 CTGTGTTGCTGCAAGGGAAATGG - Intronic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1115618319 14:35117546-35117568 CAGTGAGGCTGAAGTGGAAATGG - Intronic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1116887582 14:50235999-50236021 CTGGGTGGCTGGAGATGAAAGGG + Intergenic
1117422329 14:55559059-55559081 CAGAGTCCCTGGAGGGGAAGAGG - Intronic
1117672144 14:58119066-58119088 CAGAATGGCTGGAGAAGAAAAGG + Intronic
1117831900 14:59759860-59759882 TAGTGAGGCTGGAGGGCAACAGG + Intronic
1117870279 14:60193433-60193455 CAGTGAGGATGTAGGGAAAATGG - Intergenic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118389189 14:65282068-65282090 CAGGCTGGCTGGAGGGGGAGTGG - Intergenic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119748179 14:77059239-77059261 GAGTGTGGGAGGAGGGGACAGGG - Intergenic
1120724310 14:87920733-87920755 TAAAGTGGCTGAAGGGGAAATGG - Intronic
1120758186 14:88263436-88263458 CACTGTGGCTCGGGAGGAAATGG + Exonic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121011066 14:90520645-90520667 CAAGGTGCCAGGAGGGGAAAGGG - Intergenic
1121157382 14:91699337-91699359 CAGTATGGATGTGGGGGAAAGGG - Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121377309 14:93424718-93424740 TAGTGGGGGTGGAGGGGCAATGG + Intronic
1121498221 14:94412505-94412527 CAGTATAGCTGGAGTGGAATGGG - Intergenic
1121580208 14:95024479-95024501 CAGTGTGGCTGGCGGAGGTAAGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1123115981 14:105894247-105894269 CGGTGTAGCTGGCGGGGAAGGGG + Intergenic
1124342672 15:28900241-28900263 CAGTGTGGCTGTGTGGGAATGGG + Intronic
1124483892 15:30099763-30099785 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1124490268 15:30151082-30151104 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1124493600 15:30173375-30173397 CAGTGTGCGGGGAGGGGGAAGGG + Intergenic
1124519687 15:30397461-30397483 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1124538966 15:30568760-30568782 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1124749968 15:32365274-32365296 CAGTGTGCGGGGAGGGGGAAGGG - Intergenic
1124753265 15:32387247-32387269 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1124759683 15:32438812-32438834 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1124787850 15:32698674-32698696 CAGAGTGGCTGGAAGGAGAAGGG + Intergenic
1124975005 15:34522947-34522969 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1125405733 15:39351129-39351151 CAGCAGGGCAGGAGGGGAAAAGG + Intergenic
1125768122 15:42148528-42148550 CATTGTTGCTGCTGGGGAAAGGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127606107 15:60590855-60590877 CCCTGTGGCTTGAGGGGAATGGG - Intronic
1127861452 15:62997508-62997530 AAGTGTGGCTGGAATGCAAAGGG + Intergenic
1128456602 15:67834894-67834916 CGGTGTGGCAGGCGTGGAAATGG - Intergenic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128988352 15:72237574-72237596 CATTCTGGCTGGTGGGGAGAGGG - Intergenic
1129181805 15:73882431-73882453 CATTGTGGAGGGAGGAGAAAGGG - Intronic
1129391331 15:75222421-75222443 CCGTCTGGCTGCTGGGGAAAGGG - Intergenic
1129472973 15:75765445-75765467 CTGTCTGGCTGCTGGGGAAAGGG + Intergenic
1129503687 15:76063410-76063432 CAGTGTGGATGGAGCAGAATAGG - Intronic
1129689879 15:77707133-77707155 CAGGGATGCTGGAGGGGAACAGG + Intronic
1129840254 15:78739345-78739367 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130114628 15:80996048-80996070 AAGTGGGGCTGGGGAGGAAATGG + Intergenic
1130275941 15:82476409-82476431 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130462370 15:84168746-84168768 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130468302 15:84203801-84203823 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130490302 15:84426039-84426061 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130495964 15:84469741-84469763 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130501894 15:84504797-84504819 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130590595 15:85208399-85208421 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130596271 15:85252309-85252331 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130854276 15:87827111-87827133 CAGTGGGGTTGGATGGGAATTGG + Intergenic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131175482 15:90206584-90206606 CATTGCTGCTGGAGGGGTAATGG + Intronic
1131229978 15:90652719-90652741 CAGTCTGGATGGAGAGGCAAAGG + Intergenic
1131449750 15:92529406-92529428 CAGAGAGGTTGGAGGGGGAATGG - Intergenic
1131721823 15:95177597-95177619 CAGTGTGGCTAAAGGGTATATGG - Intergenic
1132185332 15:99798331-99798353 AAGTGGGGCTGGAAAGGAAAGGG + Intergenic
1132219265 15:100093171-100093193 CAGTGTGGCACCAGGGGAAGTGG - Intronic
1132311593 15:100861721-100861743 CTGGGAGGCTGGAGGGGAAGTGG - Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132715219 16:1286675-1286697 CAGTGTGGTTGGAAGGAAAGCGG + Intergenic
1132826815 16:1909310-1909332 TGATGTGGGTGGAGGGGAAAGGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133837130 16:9377343-9377365 CAGTGTGGCTGGTCTGGAAGGGG - Intergenic
1134349937 16:13427658-13427680 CAGTGTGGCTGGAGAGAGAGAGG + Intergenic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134852263 16:17489585-17489607 AATGGTGGGTGGAGGGGAAAAGG + Intergenic
1135490659 16:22906518-22906540 CCCTGTGGCTGGTGGGGAAGGGG - Intronic
1135961924 16:27002132-27002154 CAGTGTGGCTGGAAGAGAATAGG + Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136036857 16:27547109-27547131 CGGTGTGGCTGGAGAGGTAGAGG - Intronic
1136054789 16:27680319-27680341 CAGCATGGCTGCAGGGGAGACGG + Intronic
1136497900 16:30655056-30655078 CACTGTGGGTGGTGGGGAAATGG + Exonic
1138151176 16:54658553-54658575 CAGTGTGGCTGGAAGGTTAGAGG + Intergenic
1138386055 16:56636273-56636295 CAGTGTGAGTGGAGAGGACATGG + Intergenic
1138537671 16:57668420-57668442 CAGCGTGGCAGGAGGGGATGAGG - Intronic
1138580761 16:57939293-57939315 CAGGGTGGCTGAGGGGGCAATGG + Intronic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139278305 16:65748462-65748484 CAGTGAAGCTGGAGAGGAAAGGG - Intergenic
1139578555 16:67857868-67857890 AGGTGTGGGTGGAGGGGAAGTGG + Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1142088323 16:88196534-88196556 TGGAGTGGCTGGAGGGGAAGTGG - Intergenic
1142211044 16:88808574-88808596 GAGTGTGGCTGGGGGTGAAGGGG + Exonic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1143134686 17:4705181-4705203 CATTGCTGCTGGAGGGGTAATGG - Intergenic
1143472545 17:7185068-7185090 CAGTTTGGGAGGAGGAGAAAAGG + Intergenic
1143686172 17:8517823-8517845 CAGTGTGGCTGGAGCAGGATGGG - Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144944701 17:18963942-18963964 CAGTGTGGCTGGAGCGGGTGGGG - Intronic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145711446 17:26982535-26982557 TGCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145987603 17:29057639-29057661 CAGGGTGGGTGGAGGGGTGAGGG + Intergenic
1146121431 17:30198947-30198969 CAGTGTGTCTGCAGGAGACAAGG - Intronic
1146371770 17:32268938-32268960 CAGTGAGGATGGACGGGAAGAGG + Intronic
1146500350 17:33359026-33359048 CATTGTTGCTGGAAGAGAAAGGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148019899 17:44546847-44546869 CATTATGGCAGGAGGGGAAATGG - Intergenic
1148139965 17:45321327-45321349 CAGGGAGGCAGGAGGGGAAATGG + Intergenic
1149919147 17:60639948-60639970 CAGTGTAGCTGGAACGGATAAGG + Intronic
1150642310 17:66957851-66957873 CAGGGAGGCTGGAGATGAAAAGG + Intergenic
1150730476 17:67688724-67688746 CAGAGTGGCTGAGGGGGAACTGG - Intronic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1151480953 17:74369813-74369835 CAGTGTGGCTTCAGGGGAACAGG + Intronic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152699290 17:81811154-81811176 CGGTGGGGCTGGATGGGAACGGG + Intronic
1152912357 17:83012656-83012678 CATGGAGGCTGGAGAGGAAAGGG - Intronic
1152950663 17:83228666-83228688 AAGTGTGGGTGTTGGGGAAAGGG + Intergenic
1153493767 18:5676610-5676632 CAGGATGGGTGGAGTGGAAATGG + Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1153917236 18:9757157-9757179 CAGTGTGGGTGGCTGGGGAAGGG + Intronic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155293727 18:24366365-24366387 TAGAGGGGCTGAAGGGGAAATGG - Intronic
1155989952 18:32270102-32270124 CAGGGTGGTGGGAGAGGAAATGG - Intronic
1156276890 18:35592486-35592508 CAGTGTGGCTGAAGGGCCATTGG + Intronic
1156449884 18:37260987-37261009 CAGCATGGTTGGAGGGGACAGGG - Intronic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160579472 18:79875400-79875422 CAGTGAAGCTGGAGTGGAAATGG - Intronic
1160803027 19:979335-979357 CAGCGTGGCTGGAGGTGGACAGG + Intergenic
1161204605 19:3034461-3034483 CAGGGTGGCTGGAGGGGGTTGGG - Intronic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161543868 19:4867998-4868020 CAGTTTGGCCATAGGGGAAATGG - Intergenic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163394706 19:17052959-17052981 CAGGGCGTCTGGAGGGGAAGAGG + Exonic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1164471827 19:28542675-28542697 CGGTGAGGGTGTAGGGGAAATGG - Intergenic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1164825869 19:31284519-31284541 GAGAGGGGCTGGAGGGGAACCGG - Intronic
1164952524 19:32349324-32349346 CAGTGAGCCTAGAGGGCAAATGG + Intronic
1165837803 19:38770229-38770251 CACTGTGACGGGAGGGGAAGCGG - Intergenic
1165841763 19:38792468-38792490 CACTGTGACGGGAGGGGAAGCGG + Intergenic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168655728 19:58126157-58126179 AAGTGTGGATGGAGGGGCATTGG - Intergenic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
925818015 2:7772171-7772193 CAGTGTGGGTGGCAGGCAAAAGG - Intergenic
926309075 2:11661567-11661589 CAGTGTTGTAGGAGGGAAAATGG + Intronic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927940394 2:27099804-27099826 CAGGCTGGATGGAGGGGAGAAGG - Exonic
928081937 2:28319610-28319632 CAGTGTTGCTGAAGGAGACAGGG - Intronic
928455127 2:31413822-31413844 CAGTGTTGTAGGAGGGCAAATGG + Intronic
929173696 2:38956880-38956902 CGTTCTGGATGGAGGGGAAAAGG - Exonic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
929773281 2:44911109-44911131 CATGGTGGCAGGAGGGGAAGGGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929934887 2:46287044-46287066 TAGTGGGGCAGGAAGGGAAAAGG + Intergenic
930358030 2:50346006-50346028 CAGAGTGGATGGAAGGGGAATGG + Intronic
930618781 2:53623031-53623053 AAGTGTGTCTGGAGCGGAAGGGG + Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
930744074 2:54862931-54862953 CAGTCAGGCTGCAGGGGAACAGG + Intronic
931152523 2:59590383-59590405 CAGTAAAGCTGGAGGAGAAAAGG - Intergenic
931152659 2:59592212-59592234 CAGTAAAGCTGGAGGAGAAAAGG - Intergenic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
931297161 2:60938567-60938589 CAGTGCTGCTGGAGGTGTAATGG - Intergenic
932036059 2:68248090-68248112 TAGCGTGGCTGGAGAGGAAGGGG - Intronic
932217566 2:69976701-69976723 CTCTGTGCCTGGAGGGGGAAAGG - Intergenic
933003167 2:76953262-76953284 CAGTGTTCCTGTGGGGGAAAAGG - Intronic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937457586 2:122055786-122055808 CAGTGGGGCTGGTGGGGGAAAGG - Intergenic
937536099 2:122889531-122889553 CAGAGGGGCGAGAGGGGAAATGG - Intergenic
938283421 2:130085250-130085272 CCGTGTTGCTGCAGGGGAAATGG - Intronic
938334053 2:130473815-130473837 CCGTGTTGCTGCAGGGGAAATGG - Intronic
938355767 2:130646852-130646874 CCGTGTTGCTGCAGGGGAAATGG + Intronic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
938432188 2:131253641-131253663 CCGTGTTGCTGCAGGGGAAATGG + Intronic
938760794 2:134424172-134424194 CAGTGTGACTGAAAGGGAAGAGG + Intronic
938767132 2:134467817-134467839 CAGGCTGGATGGAGGGGATATGG + Intronic
939070557 2:137535929-137535951 TGGTGTGGCTGGAGTGGATAAGG + Intronic
939302869 2:140368957-140368979 AGGTGTGAATGGAGGGGAAAGGG + Intronic
939495921 2:142928550-142928572 CAACGTGGCTGGAAGGGAAATGG + Intronic
939833413 2:147099723-147099745 CAGTGTGGCTAAAGAGGAAAAGG - Intergenic
940994081 2:160128379-160128401 GAGTGTGGCAGGTGGGGAAATGG + Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
941954430 2:171190152-171190174 GAGTGTTGCTGGAGTGGCAAGGG + Intronic
942212625 2:173686653-173686675 CAGTGTGATTGGAGGACAAAGGG - Intergenic
942371869 2:175294144-175294166 CTGTGTGCCTGGAGGGGGCATGG - Intergenic
942743583 2:179206850-179206872 CAGTGTGGTTGGTGGGGGCAAGG + Intronic
942945474 2:181667534-181667556 CAATGTTGAGGGAGGGGAAAGGG + Intronic
943041127 2:182806878-182806900 CAGTGTGTCTAGAAGGGATAAGG - Intergenic
943869373 2:192974431-192974453 AATTGTGGCAGAAGGGGAAAGGG - Intergenic
944189212 2:196983367-196983389 CAGTGTGGCTGGAGACTCAAGGG - Intronic
944825918 2:203483047-203483069 CAGTATGGCTAGTGGGGTAAGGG + Intronic
944987469 2:205193831-205193853 CTGTGACACTGGAGGGGAAAAGG + Intronic
946570472 2:221018626-221018648 CAGTCTGGATGGAAAGGAAATGG + Intergenic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947564649 2:231186057-231186079 CAGGCAGGCTGAAGGGGAAATGG + Intergenic
947628710 2:231637662-231637684 AAGTGGGGGAGGAGGGGAAAAGG + Intergenic
947720286 2:232365823-232365845 CAGCTGGGCTGGAGGGGGAAGGG + Intergenic
947903896 2:233745709-233745731 CAGAATGGCTGGAGGGTAAGAGG + Intronic
947989985 2:234479197-234479219 CAATGTAACTAGAGGGGAAAAGG - Intergenic
948197430 2:236106198-236106220 CAGTGTGGCTGGAGCTGGAGAGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948297121 2:236869081-236869103 CAGTTTGGAAGGAGGGGAAAGGG - Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948647824 2:239419257-239419279 CAGAGATGCTGGAGGGGAGATGG + Intergenic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
948742317 2:240056128-240056150 GCGTGCGGCTGGAGGGGACACGG + Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168862523 20:1056062-1056084 CTGTGTGGCTGGAGGGTGACAGG - Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1172029415 20:31971190-31971212 CAGTGTGTATTGTGGGGAAAAGG + Intronic
1172110944 20:32544555-32544577 CATTTTGGCTGCAGGGTAAAGGG + Intronic
1172282268 20:33716313-33716335 CAGTGTGGCTGGAGCAGCAGAGG - Intronic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1172764572 20:37344756-37344778 AACTGAGGCTAGAGGGGAAAGGG - Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172838884 20:37890162-37890184 AAGTGGGGTTTGAGGGGAAAGGG + Intergenic
1172885106 20:38225685-38225707 CGGTGTGGCAGTAGGGGAAGGGG + Exonic
1173008094 20:39156597-39156619 CAGAGTGGCTGGAGTTGAACAGG + Intergenic
1173229168 20:41180798-41180820 CAGAGTGGCTGGAGGAAAAGTGG - Exonic
1173787304 20:45803505-45803527 CAGTGTGGCTGGAGGTGGAGAGG - Intronic
1174087473 20:48019366-48019388 ATGTGTGGCTGGAGGGTGAAGGG + Intergenic
1174128814 20:48327604-48327626 ATGTGTGGCTGGAGGGTGAAGGG - Intergenic
1174273628 20:49387387-49387409 GAGTCTGGCTGGAGGGGACTGGG + Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174403845 20:50291292-50291314 CAGAGTGGCTGGTGGGGAGGTGG + Intergenic
1174918444 20:54677353-54677375 CAGGGTGGCTGTAGAGGAAGGGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175714091 20:61244036-61244058 GCCTGTGTCTGGAGGGGAAATGG + Intergenic
1175853601 20:62107061-62107083 CAGAGTGGCTGGAGGGGCAGAGG - Intergenic
1175865712 20:62175287-62175309 CGGTGTGGCGGGAGGTGACAGGG + Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1177206569 21:18017429-18017451 CAGAGTGGCTGGAAGGCAAAGGG - Intronic
1177428814 21:20962004-20962026 CAGTGTGGATAGAGGTGACAAGG - Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179776320 21:43665765-43665787 CATCTTGGCTGGAGGGGAAGGGG - Intronic
1179801978 21:43815367-43815389 GGGCGTGGCTGCAGGGGAAAGGG + Intergenic
1180013978 21:45071137-45071159 CTGTGTGGCTGGAAAGGGAAAGG + Intergenic
1180015513 21:45080220-45080242 GATGGTGGCTGGAGGGGACATGG + Intronic
1180296793 22:10946222-10946244 TTGTGTGGGTGGGGGGGAAAAGG + Intergenic
1180476272 22:15711555-15711577 CTGTGTTGCTGCAAGGGAAATGG + Intronic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1181434184 22:22900690-22900712 CAGGATGGCAGGAGGGGACAGGG + Intergenic
1181435120 22:22906056-22906078 CAGGATGGCAGGAGGGGACAGGG + Intergenic
1181861421 22:25822135-25822157 CAGTGTGGCTGGAATGTAACGGG - Intronic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182366886 22:29785124-29785146 CAGCCCGGCTGGAAGGGAAAAGG - Intergenic
1182659781 22:31917143-31917165 CAGCCTGGCTGGAGGGGATTAGG - Intergenic
1183203095 22:36399593-36399615 CTTTGTGGTTGGAGAGGAAAGGG - Intergenic
1183495408 22:38140551-38140573 CAGTGTGGATGGGAGGGAAGGGG + Intronic
1183750958 22:39720021-39720043 CACTGTGGTTGGAGGGGACTGGG + Intergenic
1183971319 22:41479651-41479673 CAGTGAGGCTGGTGGGGGAGAGG + Intronic
1184109259 22:42385412-42385434 CCATGTGGCTGGAGGGCAATGGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184332848 22:43836971-43836993 CTGCGAGGCTGGAGGGCAAAGGG - Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185326545 22:50228382-50228404 CAAAGGGGCTGGGGGGGAAATGG + Intronic
949358340 3:3205302-3205324 TGGTGTGGCTGAAGGGGTAATGG - Intergenic
949669361 3:6380676-6380698 CAGGCTGGCTGGAGCAGAAATGG + Intergenic
949926428 3:9045957-9045979 CAGTGAGAATGGAGGAGAAAGGG - Intronic
950161939 3:10766803-10766825 TACTGTGGCTGCAGAGGAAATGG - Intergenic
950371372 3:12533684-12533706 AAATGTGGGTGGTGGGGAAATGG + Intronic
950542344 3:13620042-13620064 CAGTGTGGCTGCATAGGAATGGG + Intronic
950608132 3:14102871-14102893 CAGTGAGGCTGCAGAGAAAATGG + Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
952849930 3:37719545-37719567 CAGGGTGGGTGGAGGGGACATGG - Intronic
953045822 3:39293629-39293651 TAGTGAGGATGGAGGGGAAGGGG - Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
954465431 3:50651670-50651692 CAGTGTGGCTGTCCGTGAAATGG + Intergenic
954747673 3:52796198-52796220 CAGGGTGACTGGACGGGAAAGGG + Intronic
955333734 3:58068409-58068431 CTGTGTGGATGGAAGGGATATGG + Intronic
955408675 3:58642111-58642133 CATTGAGGCTGGAGTGGAACAGG + Intronic
955833744 3:63031333-63031355 CAGGGTGGCTAGAGGGGATGGGG + Intergenic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956314167 3:67915386-67915408 CAGTGTGGACGGATGGGACAGGG + Intergenic
957935591 3:86937505-86937527 CAGTGTGGAAGTAGGGGGAAGGG + Intergenic
959681297 3:109099670-109099692 AGGTTTGGCTGCAGGGGAAAGGG + Intronic
960133839 3:114086250-114086272 GATTGAGGCTTGAGGGGAAATGG + Exonic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960707381 3:120494064-120494086 CAGTTTCTCTGGAGGGGCAAAGG - Intergenic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961419805 3:126793500-126793522 CATTATGGGGGGAGGGGAAAGGG - Intronic
961815963 3:129550525-129550547 CAGAGTGGCTGGAGGGTTAACGG - Intronic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962079031 3:132117579-132117601 CAGCTTGGCTGGAGGGGTCAAGG + Intronic
962101944 3:132351885-132351907 CAGAGTGGCTGGAAGGTATAGGG - Intronic
962627188 3:137237460-137237482 AAGTGGGGGTGGATGGGAAAAGG + Intergenic
963779768 3:149475672-149475694 GAGCATGGCTGGAGGGGTAATGG - Intronic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964009037 3:151867296-151867318 CAGAGTGGTTAGAGGGGATACGG - Intergenic
965636825 3:170790556-170790578 AACTGTTGGTGGAGGGGAAAAGG - Intronic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966726082 3:183109888-183109910 CAGTGAGGCTGTAGAGAAAAGGG - Intronic
966855766 3:184193032-184193054 AGGTGTGGCTGGAGGGCACAGGG + Intronic
967229121 3:187320895-187320917 CAGTGGACCTGGAGAGGAAAAGG - Intergenic
967424986 3:189316658-189316680 CAGTGTGCGTGGTGGGGACAGGG - Intronic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
967647774 3:191947400-191947422 CATTGAGGCTGGAAGGCAAAAGG + Intergenic
967653626 3:192017855-192017877 AAGTGTGGCTTGCTGGGAAATGG + Intergenic
968690706 4:1988423-1988445 CAGTGTGGCTGAAGGGTCAGGGG + Intronic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970287474 4:14533955-14533977 CCCTGTGGCTGTAGGAGAAAAGG + Intergenic
970581446 4:17477561-17477583 CACTGAGGCAGGAGGGGTAATGG + Intronic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
971489371 4:27194837-27194859 CAGAGTGGGTGAAGGGGAGATGG + Intergenic
971665315 4:29475972-29475994 ATGGGTGGCTGGAGGGGAAGTGG + Intergenic
972249165 4:37281040-37281062 GAGTGGGTCTGGAGGGGCAAAGG + Intronic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
972925071 4:43994350-43994372 GAGTGAGGTTGGAGGGCAAAAGG + Intergenic
973652950 4:53015066-53015088 CAGTGAGTCAGGAGGAGAAAAGG + Intronic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
974931213 4:68363510-68363532 AAGTGAGGGTGAAGGGGAAAGGG + Intergenic
975158313 4:71096240-71096262 TAGGGTGGCTGGAGGCTAAAGGG + Intergenic
975547137 4:75571347-75571369 CAGTGTGTCTGGAGTGGGAAAGG - Intergenic
977654457 4:99505101-99505123 CAGGGTGGTTGGAAGGGCAAAGG + Intergenic
978462468 4:108971567-108971589 CAGTGTGTCTGAAGAGGACATGG + Intronic
978935895 4:114375086-114375108 CAGTGTTGATGGAGGTGTAAAGG - Intergenic
979154670 4:117369305-117369327 AGGTGGGGCAGGAGGGGAAATGG - Intergenic
979268506 4:118731986-118732008 CAGTGTGGCTGAAGTGGGATGGG + Intronic
980080305 4:128337290-128337312 AAGTGGGGCATGAGGGGAAATGG + Intergenic
981011373 4:139928668-139928690 CTGTGTGTCTGGGTGGGAAATGG + Intronic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981824515 4:148924883-148924905 CAGTGAGGGTAGAAGGGAAATGG - Intergenic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
982816632 4:159893933-159893955 CGGTGAGGTTGGAGGGCAAAAGG + Intergenic
983695014 4:170517713-170517735 CATTGTGCCAGGAGGGGAAAAGG + Intergenic
984507380 4:180636770-180636792 CAGTGTGGAGGAAGGGGAAAGGG - Intergenic
984852406 4:184165439-184165461 CACCGTGGCTGGAGGGGAGCAGG - Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
986003450 5:3648445-3648467 CAGGGTGGCTCGAAGGCAAATGG + Intergenic
986403996 5:7407415-7407437 AATTGTGGCTGAAGGGGAAGGGG + Intronic
986599410 5:9456626-9456648 CAAAGGGGCTGGAGGAGAAAAGG + Intronic
987034405 5:14005811-14005833 GAATGAGTCTGGAGGGGAAATGG + Intergenic
988628178 5:32899950-32899972 AATTGTGGCTGAAGGGGAAGGGG + Intergenic
989124876 5:38042758-38042780 CAGTGTGTTTGTAGGGAAAACGG - Intergenic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
990368786 5:55095888-55095910 CAGTGGGGCAGGGTGGGAAAGGG - Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
990742093 5:58922673-58922695 CGGTGGGGCTGGGGAGGAAATGG - Intergenic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990981184 5:61603733-61603755 CAGACTGGATGGAGAGGAAAGGG + Intergenic
991446198 5:66702677-66702699 GAGTGTGGCTGGAGCAGAACAGG + Intronic
992982338 5:82188694-82188716 CAGAGGACCTGGAGGGGAAATGG + Intronic
993706473 5:91177455-91177477 CAGGGTGGCTGGAGTGGTAAGGG - Intergenic
994298562 5:98119438-98119460 TGGGGTGGCGGGAGGGGAAAGGG + Intergenic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
995508667 5:112886006-112886028 CCATGTCGCTGAAGGGGAAAGGG - Intronic
996549241 5:124712532-124712554 CAGAGTGGCTGGAGAGGGACTGG + Intronic
996578618 5:125004993-125005015 CAGCATGGTTTGAGGGGAAATGG - Intergenic
998253926 5:140570738-140570760 CAGTCTGGCTGGAGCTGAACAGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999203637 5:149833305-149833327 CACTGCGGCTGGAGGTGAAAAGG + Exonic
999450883 5:151677298-151677320 CTTTGTGGCTGCAGGGGAGATGG - Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1000037001 5:157456504-157456526 CATTGTGGCTAGAGGAGAAAAGG + Intronic
1000059216 5:157638301-157638323 CAGTGTGGCTGGATGGCCAAGGG + Exonic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001485209 5:172115097-172115119 CAGTGTGGTGGGTGGGGAGATGG - Intronic
1001679903 5:173548864-173548886 CAGTGTGGCTTGTGGGGATTGGG + Intergenic
1001845602 5:174918171-174918193 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002107752 5:176888558-176888580 TAGAGGGGCTGGAGGGGAAAGGG + Exonic
1002130747 5:177080051-177080073 CAAAGTGGATGGAGGGGAACTGG - Intronic
1002183364 5:177442676-177442698 CTGTGTGGGTGAAGGGGATAGGG + Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002521066 5:179793527-179793549 CAGTGTGGCTGGGGGGGCGCTGG + Intronic
1002744894 5:181462481-181462503 AAGTGTGGGTGTTGGGGAAAGGG + Intergenic
1002885078 6:1286305-1286327 CAGTGTGTGTGGTGGGGTAAGGG + Intergenic
1003602101 6:7526983-7527005 CATGGAGGCTGGAGGGGGAAGGG - Intergenic
1004086107 6:12451193-12451215 AAGTGTGGCTGGAGAGGGCAGGG + Intergenic
1004395304 6:15242559-15242581 CAGCGAGGCTGGATTGGAAATGG + Intergenic
1005143482 6:22661404-22661426 CATTGTGGCAGGAAGGAAAAGGG + Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1005989459 6:30893872-30893894 GAGTGGGGTTGGAGGGGCAAAGG + Intronic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007221541 6:40282811-40282833 GAGGGTGGCTTGAGGGAAAATGG - Intergenic
1007640276 6:43332916-43332938 AAGTCTGGCTGGAAGGAAAAAGG + Intronic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1010189165 6:73176754-73176776 CAGGCTGGCTTGAGGGGAGATGG + Intronic
1010629355 6:78178934-78178956 CAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011401850 6:86971329-86971351 CAGTGAGGCTACAGGAGAAAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013752720 6:113425694-113425716 CAGTGTGGTAGAAGGGGAATTGG + Intergenic
1014857530 6:126420237-126420259 CAGAGTGGCTGGATGTGAGATGG + Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015655895 6:135518784-135518806 CAGTGTTTCTGGGGAGGAAATGG - Intergenic
1015816898 6:137220005-137220027 CAATGTGGCTGCAGTGGAATAGG - Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017494920 6:154975142-154975164 CAAGGTGGCTGGAGGGGTCAGGG + Intronic
1017521217 6:155204957-155204979 CATTGTGGCTGAAGGTGGAAGGG + Intronic
1017602562 6:156099756-156099778 CAGGGTGGCAGGAGAGAAAAGGG - Intergenic
1018391695 6:163346068-163346090 CAGGGCTGCTGGAGGGGAATGGG - Intergenic
1018597299 6:165495335-165495357 GAGAGGGGGTGGAGGGGAAAGGG + Intronic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1020070814 7:5225868-5225890 CAGTGTTGCTGGAGGCGGAGAGG - Exonic
1020417263 7:7960452-7960474 CATTGTGGCTGGAACTGAAAAGG + Intronic
1020657172 7:10941256-10941278 TAGTGTGGCTGGAAAGTAAAAGG + Intergenic
1020990306 7:15187398-15187420 CAGAGAGGCTGGAGAGGCAATGG - Intergenic
1021389589 7:20075155-20075177 CAGTGTGGGTGGTGGGGAGGGGG + Intergenic
1021665857 7:22978874-22978896 GAGTGTGGTGGGAGAGGAAAAGG - Intronic
1021745390 7:23735639-23735661 CAGTGTGGATATAGGGGAAGAGG + Exonic
1021802048 7:24316837-24316859 CTGTAGGGCTGGAGGGGCAAGGG - Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023312492 7:38902340-38902362 CAGTGTGGCTGGAGGGTCACAGG - Intronic
1023338359 7:39193331-39193353 TATGGTGGGTGGAGGGGAAATGG - Intronic
1023585875 7:41729280-41729302 TACTGGGGGTGGAGGGGAAATGG - Intergenic
1026931423 7:74224847-74224869 GAGTGTGGGTGGAGGGGCCATGG + Intronic
1027675267 7:81149626-81149648 AAGTGTAGTTGGAGGGGGAATGG + Intergenic
1028395513 7:90364832-90364854 CAGTGAGGCTGGCGGGGGAGGGG - Intronic
1028492787 7:91432362-91432384 CAGTGTGGGTGGAGGGGTCGAGG + Intergenic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030081765 7:105784548-105784570 CAGCATGGCAGGAGGGGAAGTGG + Intronic
1031456549 7:121987541-121987563 TAGTGAGGCTGCAGGGAAAAGGG - Intronic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1034283626 7:149870371-149870393 CAGTGTGGGTTGAGGGGCACTGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037261955 8:17019535-17019557 CAGAGTGTCTGTAGTGGAAAAGG - Intergenic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037749415 8:21670922-21670944 AATTGTGGGTGGAGGGGTAAAGG + Intergenic
1038005605 8:23427362-23427384 CTGTGTGACTGGAAGGGGAAAGG - Intronic
1038197274 8:25379927-25379949 AAGTCTGGTTGGAGGGGGAAGGG - Intronic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1038772197 8:30493380-30493402 CAGTGAGACAGGAGAGGAAAAGG + Intronic
1039144980 8:34437621-34437643 CAGTGCTGTTGGAGGGGACATGG + Intergenic
1039247190 8:35621872-35621894 TAATGTGGCTGAAGAGGAAATGG + Intronic
1039521060 8:38172228-38172250 CAGTGTGGCAGAGTGGGAAAAGG + Intronic
1039954002 8:42193559-42193581 CAGCGTGGCTGCTGGGGAAAAGG - Intronic
1040083914 8:43319164-43319186 CTGTGTTGCTGCAGAGGAAATGG + Intergenic
1040594906 8:48827950-48827972 CAGTGTGGTCGGAGGCGAAGTGG + Intergenic
1040638738 8:49306272-49306294 CAGTATGGCTGGTTGGGAGATGG - Intergenic
1041467620 8:58172815-58172837 CCGTGTAGCTGGAGGAGATATGG - Intronic
1041790805 8:61694268-61694290 CAGTGAGGCTGGGGGAGAAGGGG - Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042813721 8:72854793-72854815 CACCGTGGCAGGAGGGGACATGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043695136 8:83208200-83208222 CAGTGAGGCTGAAGTGGCAAAGG - Intergenic
1044804105 8:95987360-95987382 CAAGGTGGCTGGAGTGGAATGGG + Intergenic
1045008020 8:97932780-97932802 CATGGTAGCTGGAGGGGACAGGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045489703 8:102658787-102658809 CAATGTGGCTGGAGGTGCAGAGG + Intergenic
1046356355 8:113090608-113090630 CAGTGTGGATGGGGAAGAAAGGG - Intronic
1046970977 8:120223112-120223134 CAGTGTGGCTGGAACCCAAAAGG + Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047536675 8:125726469-125726491 GAGAGTGGCTGGAGGTGAGATGG + Intergenic
1048192339 8:132301335-132301357 CATGGTGGCTGGAGTGGACAGGG - Intronic
1048550422 8:135428244-135428266 CACTGGGGCTGGAGGGACAAGGG - Intergenic
1048896143 8:138994028-138994050 CAATGTGGCAGGAGGGGGAGAGG - Intergenic
1049363224 8:142224198-142224220 CGGGGTGGCTGGTGGGAAAAGGG + Intronic
1049611862 8:143559582-143559604 CAGGGAGGCTGGATGGGAGAGGG + Intronic
1049627678 8:143633265-143633287 GAGTGTGGCTGGAAGGCAAAAGG - Intergenic
1049673454 8:143879591-143879613 CAGTGTGGCAGGTGTGGACAGGG - Intergenic
1050090383 9:2012560-2012582 AAATGTGGTTGGAGGGTAAAAGG - Intergenic
1050504300 9:6331459-6331481 CACTGTGGCTAGAGAGGAAGGGG + Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052423156 9:28270225-28270247 CAGGCTGACTGAAGGGGAAAGGG - Intronic
1052831741 9:33221404-33221426 CAGTGTGCCTGGAGGGTTCAGGG - Intronic
1053196765 9:36125829-36125851 CAGTGTAGCTGGAAGGGCAAGGG - Intergenic
1054778209 9:69141435-69141457 CAGGCTGGCTGGAGGGTACAGGG - Intronic
1055290775 9:74779829-74779851 CAATGTGGTTGGAGAGGAATGGG + Intronic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1058578766 9:106431927-106431949 CACTGTTGCTGGAGTGTAAACGG - Intergenic
1058906496 9:109486431-109486453 CAGTTTGGGTGGAGTGGAAAAGG + Intronic
1059760696 9:117334610-117334632 CACTGTGGCTGGTGTGTAAAAGG - Intronic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060465441 9:123900460-123900482 AAGTGCGGCAGGAGGGTAAAGGG + Intronic
1060521642 9:124297457-124297479 CAGTGAGGCTGGCGGGGAGCTGG - Intronic
1060807761 9:126588255-126588277 CAGGGAGGCTGGTGGGCAAAGGG - Intergenic
1060836030 9:126755729-126755751 CACGGTGGGTGGAGGTGAAAGGG - Intergenic
1060857195 9:126924268-126924290 CAGTGTGACTGTATAGGAAAAGG + Intronic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061799027 9:133104182-133104204 CACCGTGGCTAGAGAGGAAAGGG + Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062161075 9:135080255-135080277 CAGAGAAGCTGGAGGGGAAGAGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062234069 9:135499849-135499871 CATTGTGCCTGGAGGAGAAGCGG + Exonic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1203610705 Un_KI270748v1:92960-92982 AAGTGTGGGTGTTGGGGAAAGGG + Intergenic
1185979807 X:4765383-4765405 CAGTGTGGTTCGAGGGGAGGAGG + Intergenic
1186403118 X:9277891-9277913 TAGTATGGCTGGAGGGGACGTGG - Intergenic
1187654883 X:21460674-21460696 CAGTGGGGGTGGAGGAGAAGTGG - Intronic
1187823009 X:23308338-23308360 GAGTGTGGCTGGATGGGGAAAGG + Intergenic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1189419420 X:40843455-40843477 TAGTGTTGTTGGAGGGTAAAGGG - Intergenic
1189453619 X:41163339-41163361 CTGATTGGCTTGAGGGGAAAAGG + Intronic
1190212472 X:48459452-48459474 CAGGATGGCTGGAGGTGAAAGGG - Intronic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1190420817 X:50282495-50282517 CAGTGTGTATGTAGGGGACATGG + Intronic
1192215750 X:69156961-69156983 GAGGGTGGCAGGAGGGGAAGGGG + Intergenic
1192422459 X:71045714-71045736 GATTGTGGGGGGAGGGGAAATGG - Intergenic
1192623765 X:72706781-72706803 TAGTGGGGCTAGAGGGTAAAGGG - Intronic
1193623943 X:83793990-83794012 CAGTGCAGCTAGAGTGGAAAGGG + Intergenic
1194429401 X:93782421-93782443 CAGTGTGACTGGAGCATAAAGGG + Intergenic
1194887914 X:99340865-99340887 GAGGGTGGCTGGAGGGGAGGTGG - Intergenic
1195390698 X:104359012-104359034 TAATGCGGCTGGTGGGGAAATGG + Intergenic
1195792895 X:108608156-108608178 CATTGTGGGTGGAGTGTAAATGG - Intronic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196337228 X:114551481-114551503 CAGTTTGCCTGGAGGGCAAATGG - Intergenic
1196492157 X:116280710-116280732 CAGTTTGGCTGAAGTGAAAATGG + Intergenic
1196553307 X:117056694-117056716 CAGGGTAGCTTGAGGAGAAAGGG + Intergenic
1196642628 X:118080618-118080640 CAGTGAGGCTGCAGAGAAAAGGG + Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196756225 X:119159746-119159768 CATTGTGTTTGGAGGGGACAGGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199099758 X:143785193-143785215 CAGGGTGGGTGGAGGGCAAGGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199530518 X:148842169-148842191 CTGTGTGGATGGAAGAGAAATGG - Intronic
1202376922 Y:24246384-24246406 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1202493858 Y:25423737-25423759 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic