ID: 1119073611

View in Genome Browser
Species Human (GRCh38)
Location 14:71613264-71613286
Sequence GCAGTTAATATGTTTAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119073611 Original CRISPR GCAGTTAATATGTTTAAATC TGG Intronic
904649372 1:31993115-31993137 GCAGTTACTATGTGCAAATTAGG - Intergenic
904861757 1:33543227-33543249 ACAGTTGATTTGTTTGAATCAGG + Intronic
907028435 1:51146161-51146183 AAAGTTAATATGTTTAGACCAGG + Intronic
908706163 1:66957347-66957369 GGAGTTAGACTGTTTAAATCTGG + Intronic
909737501 1:78981607-78981629 ATGGTTAATATGTTTAAATAAGG - Intronic
909881278 1:80882003-80882025 GCAGTTAAAATCATTAAATGAGG + Intergenic
911441478 1:97932173-97932195 GCAGTTAATATCTTATAGTCAGG - Intergenic
912404735 1:109427111-109427133 GCAGTGAATATTTTGAAGTCTGG - Intergenic
913614566 1:120545439-120545461 AAAGGTAATATGTTTAATTCAGG - Intergenic
914203625 1:145507422-145507444 AAAGGTAATATGTTTAATTCAGG + Intergenic
914482747 1:148080576-148080598 AAAGGTAATATGTTTAATTCAGG + Intergenic
914575705 1:148965462-148965484 AAAGGTAATATGTTTAATTCAGG + Exonic
915822296 1:159037830-159037852 GCATTAAATATCTTTAAATAGGG + Intronic
915879178 1:159647609-159647631 GCAGTAAATATGTATAACTTTGG + Intergenic
920163967 1:204022134-204022156 GTAGTAAATGTGTTTAAATCTGG - Intergenic
923872663 1:238013011-238013033 ACAGTTCATAAGTATAAATCAGG + Intergenic
924260559 1:242226092-242226114 TCAGAAAATATCTTTAAATCTGG + Intronic
1065473816 10:26112168-26112190 GCATTGAATATGTTTAAATTTGG - Intronic
1070473257 10:76805422-76805444 GCAGATAATATGATAACATCAGG - Intergenic
1072073733 10:91947141-91947163 GTAGAAAATATGTGTAAATCAGG - Intronic
1073502048 10:103948752-103948774 GAAGTTTGTTTGTTTAAATCAGG + Intergenic
1073902103 10:108234260-108234282 GCAGCAAATATATTTAAATTAGG - Intergenic
1074741290 10:116486673-116486695 GCAGTTAATTTGTTTAAATTGGG + Intergenic
1076279250 10:129231616-129231638 GCAGTCAACATTTTTAAATATGG - Intergenic
1076413665 10:130269782-130269804 ACAGTGATTTTGTTTAAATCTGG + Intergenic
1078075918 11:8160482-8160504 GCATTTTATTTGTTTAAATTTGG - Intronic
1078359359 11:10656505-10656527 GCAGATAAAATATTTAAATATGG - Intronic
1079278622 11:19066746-19066768 GCAGTCTATATGTTTTAATTGGG + Intergenic
1080317029 11:30961035-30961057 GAAATTGATATGTTTAATTCTGG - Intronic
1081185020 11:40031765-40031787 GAATATAATAAGTTTAAATCTGG + Intergenic
1082869329 11:57929635-57929657 GCAGTTAAAAGGTTTTAAGCAGG + Intergenic
1082908219 11:58336801-58336823 GATATTAATATTTTTAAATCAGG + Intergenic
1085287173 11:75371024-75371046 ACAGTTGGTATGTTTAAATCTGG + Intergenic
1085942211 11:81218522-81218544 GCAGTGAATATCTTCAAATGAGG + Intergenic
1087109755 11:94451753-94451775 TCAGCTTATTTGTTTAAATCAGG - Intronic
1087115833 11:94523178-94523200 GCAGGTAATATGAGTAAAGCTGG - Intergenic
1088339772 11:108750641-108750663 GCAGTTAATATATTAAAGTCAGG - Intronic
1090143077 11:124286695-124286717 GCATTTAATATATTTAGGTCTGG + Intergenic
1090279976 11:125447457-125447479 TCAGTTTATTTGTTTGAATCAGG - Intronic
1094596942 12:31874351-31874373 AAAGTAAATATGTTTAAATGGGG - Intergenic
1095301048 12:40584228-40584250 GTAGTTGATGTGTTCAAATCAGG - Intergenic
1098276376 12:68815851-68815873 GTTGTTAATAGGTTTATATCTGG + Intronic
1098706304 12:73694624-73694646 GCAGTTAAAATGTTCATTTCTGG - Intergenic
1099023872 12:77441453-77441475 GCAAGTCAGATGTTTAAATCTGG - Intergenic
1099882734 12:88487612-88487634 TCATTTTATATGTTTGAATCAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102695467 12:114795782-114795804 ACAGTTATTTTGTTTAAATCAGG + Intergenic
1105278967 13:18952250-18952272 GCAGTTAACAGGCTCAAATCCGG + Intergenic
1105550861 13:21394723-21394745 GCACTAAATCTGTTTAAATAAGG + Intronic
1109119305 13:58434015-58434037 TCAGTTAATTTGTTGAAATGTGG - Intergenic
1109174249 13:59135766-59135788 CCAGTTAATATGTTGGCATCTGG + Intergenic
1109476483 13:62886056-62886078 GCAGTTAAATTGTTTAAACCCGG + Intergenic
1109805699 13:67439406-67439428 GCAGTCAATCTGTTATAATCTGG - Intergenic
1110109069 13:71719903-71719925 ACAGTTAATATATTTCAATAAGG - Intronic
1110138406 13:72097807-72097829 CCAGATAATGTGTTTAAATATGG - Intergenic
1111590159 13:90336185-90336207 TCAATTAATATTTTTCAATCTGG - Intergenic
1111675335 13:91380180-91380202 GTACTTAGTATGTTTAAAACTGG - Intergenic
1112757721 13:102657291-102657313 GCTGTTAATAATTTTAAATACGG - Intronic
1112974233 13:105297596-105297618 CCAGATAATATTTTGAAATCTGG - Intergenic
1113658509 13:112087064-112087086 TCTGTTAATATTTTTAAATGAGG + Intergenic
1113723186 13:112576833-112576855 TCAGTTTATATGATAAAATCTGG + Intronic
1115272223 14:31566078-31566100 TCATTTAATATGTTTAACTGTGG + Intronic
1119073611 14:71613264-71613286 GCAGTTAATATGTTTAAATCTGG + Intronic
1119795231 14:77390385-77390407 GCAGATAATATGTTCAGATTAGG - Intronic
1119845289 14:77824749-77824771 ACAGTTAGTTTGTTCAAATCTGG + Intronic
1119875991 14:78059904-78059926 GCTTTTAATATCTTTAAAACTGG + Intergenic
1120644725 14:87059906-87059928 ACACTTAATATGCTTAATTCAGG + Intergenic
1121101218 14:91251672-91251694 TAAGTTAATATCTTTAAATGTGG + Exonic
1122447403 14:101780168-101780190 GCAGTTAATATTTTTAGGTGAGG - Intronic
1124819037 15:33024545-33024567 CTAATTAATATTTTTAAATCTGG - Intronic
1125401991 15:39313732-39313754 GCAGTTAAGGTGGTTAAAGCAGG - Intergenic
1129080036 15:73031628-73031650 GCAGATAAAGTATTTAAATCAGG - Intergenic
1129611371 15:77061224-77061246 GTAGATAAAATGTTAAAATCTGG + Intronic
1129667295 15:77586569-77586591 CCAGTTAATATTTTAAAATGTGG + Intergenic
1131646678 15:94352301-94352323 GAAGTTAATATGTTTCTAACTGG + Intronic
1137618753 16:49862081-49862103 GCAGGTAAATTGTTTGAATCTGG - Intergenic
1137849633 16:51727290-51727312 GCAGTTATTATCTTTATCTCTGG - Intergenic
1139049305 16:63103729-63103751 GCAGTAAATATATTCAAATTTGG + Intergenic
1139629001 16:68216026-68216048 GCACTTAATATGTGTAAATCTGG - Intronic
1139949268 16:70661264-70661286 GCAGTGACTATATTTAAATCGGG + Exonic
1140241015 16:73200743-73200765 ATAGTTAATTTGTTGAAATCAGG + Intergenic
1140548886 16:75841620-75841642 GCAGTTAATCTTTTTATACCAGG - Intergenic
1140791098 16:78391928-78391950 ATAGTTAATTTGTTTGAATCAGG + Intronic
1140809405 16:78562745-78562767 GGAGTTAAGATCTTTAACTCAGG + Intronic
1141406389 16:83797444-83797466 ACAGAGAATATGTTTAAATAAGG - Intronic
1142737318 17:1909081-1909103 GCAGTTCATATGTTTTAATCTGG - Intergenic
1143353374 17:6306299-6306321 GCAGTTCACATGTCTAAATGGGG - Intergenic
1145203869 17:20970073-20970095 TCAGTTGATTTGTTCAAATCAGG + Intergenic
1146338713 17:31999819-31999841 GCTGTTCATATCTTTAAATTAGG + Exonic
1147221844 17:38938732-38938754 GCGCTTTATATGTCTAAATCAGG - Exonic
1147281682 17:39367202-39367224 GAAGTTTATATTTTTCAATCTGG + Intronic
1155875775 18:31086333-31086355 ACTGTAAATATGTTTATATCAGG + Intronic
1155996541 18:32336517-32336539 GGAATTAAGATGTTTAAATTTGG - Intronic
1156567587 18:38212647-38212669 GAAATAAATTTGTTTAAATCTGG - Intergenic
1157703986 18:49785947-49785969 ACAGTTACTATGTTGAAATGTGG + Intronic
1158167650 18:54558279-54558301 GCTGATCATCTGTTTAAATCTGG + Intergenic
1158243937 18:55409351-55409373 GCAGTTAAGACATTTAATTCAGG + Intronic
1158298202 18:56022659-56022681 GGAGGTAATAAGATTAAATCAGG + Intergenic
1159342127 18:67148390-67148412 GTTGTTATTATTTTTAAATCAGG + Intergenic
1159815059 18:73063263-73063285 GCAATTAATTTCTTTAAATAGGG - Intergenic
1162636543 19:11972789-11972811 CCAGTCAAGATGTTTAAAACAGG - Intronic
925152850 2:1627532-1627554 TCAGTTAGCATGTTTGAATCTGG - Intergenic
926109720 2:10174041-10174063 GCAGTAATTATGGTTAAATGAGG + Intronic
926575721 2:14578552-14578574 TTAGTTAATATGATTAAATAAGG + Intergenic
932590920 2:73066626-73066648 GTAGTTGATTTGTTTGAATCAGG - Intronic
936824141 2:116559933-116559955 GCAGTTAACATCTTTATTTCAGG - Intergenic
938887926 2:135672383-135672405 ACAGTTAATATGTTTTAATGGGG - Intronic
940390414 2:153126534-153126556 TCAGAAAATATGTTGAAATCAGG - Intergenic
940511751 2:154624398-154624420 ACAGTTAATATGTGAAAGTCAGG - Intergenic
942497784 2:176557933-176557955 TCAATTAAAATGTTTAACTCTGG - Intergenic
942644802 2:178098320-178098342 GAAGATAATATGGTAAAATCTGG + Intronic
943404925 2:187470211-187470233 GCAGATAATATGTGTGAATGTGG + Intronic
944039885 2:195341067-195341089 ACAGTTAATATGTTTAAAAATGG - Intergenic
944538750 2:200737095-200737117 GCAGTTAGTCTGTTTTTATCAGG - Intergenic
944648129 2:201800700-201800722 ACAGTTAATTTGTTCAAATCAGG + Intronic
944944998 2:204673660-204673682 GCAGTTTGTATTTTTAAATAAGG - Intronic
945810208 2:214540528-214540550 GGAGTTGATATCTTTAACTCTGG + Intronic
947098997 2:226598659-226598681 GCATTTGATATGTTTAAAGTGGG + Intergenic
947777719 2:232727475-232727497 GCTGTTAACATGTTTACCTCAGG + Intronic
949077027 2:242066689-242066711 TCAGCTAACATGTTTACATCTGG + Intergenic
1168837686 20:888590-888612 GCAGGTAATAAGCTTAAGTCAGG - Intronic
1169753805 20:9022775-9022797 GCATTTATTATGTCCAAATCTGG - Intergenic
1170608668 20:17894206-17894228 ACAGTTAAAATGTTATAATCAGG + Intergenic
1170646530 20:18201250-18201272 GCAGTCTATATTTTTAAATTGGG + Intergenic
1170775302 20:19370207-19370229 ACAATTAATATGCTTAGATCAGG - Intronic
1174113357 20:48211137-48211159 GTAGTCAAAATGTTTAAATAAGG + Intergenic
1177014624 21:15770714-15770736 GCACTTTAAATGTTTAATTCTGG + Intronic
1177924658 21:27199033-27199055 GAAGTTCATTTGTTTACATCTGG - Intergenic
1182680107 22:32072708-32072730 ACAGTTAGTTTGTTTGAATCAGG + Intronic
1184434646 22:44463083-44463105 GCAGGTAATATGTTAATGTCAGG - Intergenic
1184540648 22:45121969-45121991 GCAGCTATTATGGTTAATTCAGG + Intergenic
952111660 3:30130681-30130703 TTAATTAATGTGTTTAAATCTGG + Intergenic
952333744 3:32387285-32387307 GGAGATAATATGGTTAAATGAGG + Intergenic
953297950 3:41740094-41740116 GAAGAAAATATGTTTAAATATGG - Intronic
954074730 3:48169626-48169648 ACAGTTTATTTGTTAAAATCTGG - Intronic
956137735 3:66115587-66115609 GCAGTTAATCTGATTGAATTAGG - Intergenic
960180511 3:114570296-114570318 GCAGTTATTATTTTTAAGTCAGG - Intronic
960851139 3:122055955-122055977 TCAGTTAATATGTCATAATCAGG + Intronic
961516104 3:127437786-127437808 GCTGTTATTATTTTTAATTCTGG - Intergenic
962285544 3:134082993-134083015 GTAGTTGGTTTGTTTAAATCAGG - Intronic
962420869 3:135228187-135228209 TCATTTAATATCTTTTAATCAGG + Intronic
962941389 3:140127769-140127791 CCAGTTAATATATATAAAGCAGG + Intronic
965062373 3:163801289-163801311 CTATTTAATATGTTTAATTCTGG + Intergenic
968246882 3:197159580-197159602 TCACTTAATATGTTGAAATTGGG + Intronic
970288510 4:14545886-14545908 GCAGTGATTATTTCTAAATCGGG + Intergenic
972929665 4:44056188-44056210 TGAGTTAATATGTTGAAAACAGG - Intergenic
974313072 4:60238335-60238357 TCAGTTAATAAGTATAAAGCTGG - Intergenic
974452401 4:62083157-62083179 TCAGTTATTAATTTTAAATCAGG + Intergenic
977519559 4:98063595-98063617 CAAGTTAAGATGTTTAAAGCAGG + Intronic
978481461 4:109195790-109195812 GCAGTCAAAATGTTTGATTCTGG + Intronic
979180186 4:117716426-117716448 ATAGTTAATTTGTTTGAATCAGG - Intergenic
979875554 4:125886354-125886376 GCAGTTAATATTGTAACATCTGG - Intergenic
982103457 4:151990985-151991007 GGAGTGAATATGTTAAAATGAGG - Intergenic
982340762 4:154295867-154295889 GCAGTTGATCTGTTGAATTCAGG - Intronic
983185341 4:164694288-164694310 GCAGTTAAAATTTTGACATCTGG - Intergenic
984084568 4:175292988-175293010 GCACTTATTATTTCTAAATCTGG + Intergenic
984622592 4:181971189-181971211 ACAGATAATGTTTTTAAATCAGG + Intergenic
984815013 4:183828039-183828061 ACAGTTCATTTGTTCAAATCAGG + Intergenic
985703804 5:1389162-1389184 GCATTTAATATGTTTACAGATGG - Intergenic
986360552 5:6974337-6974359 GCAGTTACTATGTGTTAAGCTGG + Intergenic
986464726 5:8009912-8009934 GCAGTAAATATCTTTAAATTGGG + Intergenic
986498509 5:8372727-8372749 GCAGATAACATTATTAAATCTGG + Intergenic
986865237 5:11978482-11978504 GCAGTTTTTTTTTTTAAATCAGG + Intergenic
987597260 5:20018231-20018253 GGTGTAAATATGTTGAAATCTGG - Intronic
987667152 5:20958357-20958379 ACATTTAAAATGTTTAAATTTGG + Intergenic
988414971 5:30934854-30934876 GCAGCTAATATTTCTTAATCTGG - Intergenic
988886847 5:35567382-35567404 GGATTTAATATTTTAAAATCAGG - Intergenic
989841050 5:46070517-46070539 TTAATTAATAGGTTTAAATCTGG - Intergenic
990571579 5:57084464-57084486 AGACTTAATATGTTTAAATGTGG + Intergenic
990819132 5:59817616-59817638 TCAGTAAATAAGTTTAAATGTGG + Intronic
991114741 5:62941550-62941572 GCAGTTAACATTTTTAAAATGGG - Intergenic
991132840 5:63144956-63144978 GCAGTTAAAAAGTATAAACCAGG - Intergenic
992271630 5:75070142-75070164 GGAGTTACTATGTTTACATATGG - Intronic
995087924 5:108136896-108136918 GTAATTAATAAGTTAAAATCTGG - Intronic
996376806 5:122819411-122819433 GCAGTGAATATGTTTAATGGGGG + Intronic
996895940 5:128482734-128482756 TAAGTTAATATGTTTAAATGAGG + Intronic
999208356 5:149866601-149866623 TCAGTTGATTTGTTCAAATCAGG - Intronic
1002815919 6:680289-680311 GCAGTTGATGTGTTAGAATCAGG + Intronic
1003697118 6:8419716-8419738 ATAGTTCATATGTTTAAATAAGG - Intronic
1005273295 6:24189299-24189321 GCAGTTACTAAGGTTAACTCAGG + Intronic
1007850265 6:44795884-44795906 GCAGTTGGTTTGTTCAAATCAGG + Intergenic
1008224204 6:48892432-48892454 GCCCTTAATATGATTACATCAGG - Intergenic
1008766924 6:54928592-54928614 GCTGTTAATATGTTTTCATTTGG - Intronic
1009730742 6:67602374-67602396 GCAGTAATTAAGTTTAAATGAGG + Intergenic
1010356237 6:74937204-74937226 GCTGTTAATATGATTATATTGGG + Intergenic
1012111274 6:95237937-95237959 GCACTTAAAATGTTTATAGCAGG - Intergenic
1013506765 6:110808089-110808111 TCAATAAAAATGTTTAAATCAGG - Intronic
1019102446 6:169642275-169642297 GCAGTTGAGATGGTTAAATGTGG + Intronic
1020954782 7:14727347-14727369 GCAGTAATTATGTTAAAAACAGG + Intronic
1020972264 7:14959480-14959502 GAATTTAATATTTTTAAATTTGG + Intronic
1023334753 7:39157126-39157148 GCTGTTAAAATGTTCAATTCCGG + Intronic
1024492261 7:49998643-49998665 GTAATTAGTATCTTTAAATCTGG + Intronic
1026828596 7:73598298-73598320 TTAGTTAATATGTTAATATCTGG - Intronic
1029912100 7:104163827-104163849 GAAGTTAATATGTTAATATTAGG - Intronic
1030330863 7:108268900-108268922 GAAGTTAATATTTGTAAAGCAGG - Intronic
1031360288 7:120841513-120841535 GTAGTTGATTTGTTTGAATCGGG - Intronic
1033592838 7:142827968-142827990 GCAGTTAATTAGTTAAAATGTGG - Intergenic
1034699129 7:153081567-153081589 TCATTTAAAATGTTTAAATAAGG - Intergenic
1035535575 8:388573-388595 TCAGCTAACATGTTTACATCTGG + Intergenic
1037070896 8:14647730-14647752 TATGTTAATATGTTTAAAGCAGG + Intronic
1037833662 8:22203680-22203702 GCAGCTCATCTGTTTAAACCTGG - Intronic
1041742290 8:61168863-61168885 GCTGAGAATATTTTTAAATCTGG - Intronic
1042934880 8:74048421-74048443 CCAGGTAATTTTTTTAAATCCGG + Intergenic
1044851271 8:96431328-96431350 GAAGTTGATATTTTAAAATCAGG - Intergenic
1045441142 8:102212411-102212433 GGAGTTAATACTTTTAAATAGGG - Intronic
1045807117 8:106175972-106175994 GCACTTAATCTATTTAAATATGG + Intergenic
1045868472 8:106897318-106897340 GGGTTTAATATGTTTAACTCTGG - Intergenic
1046462077 8:114552635-114552657 GCAAATATAATGTTTAAATCTGG - Intergenic
1048006503 8:130423824-130423846 GCATTTACTATGTTTACATTTGG + Intronic
1052102152 9:24461303-24461325 GCAATTGAAATGTTGAAATCAGG + Intergenic
1052958920 9:34277860-34277882 GCAGTTAAAACGGTGAAATCTGG + Intronic
1056341952 9:85644036-85644058 GTAGTTAATATGTGTAAGTATGG - Intronic
1061691572 9:132336659-132336681 GGGGTTAGTATGTTCAAATCAGG - Intronic
1187404372 X:18989301-18989323 GCAGTTAAGATCTTTAAGTTTGG - Exonic
1188068550 X:25692145-25692167 GGAGTCAATATATTTATATCAGG - Intergenic
1189906139 X:45761803-45761825 GCACTTAATATCTTTAAACAAGG + Intergenic
1192803283 X:74487348-74487370 GCAGTTAATATGTTTCATATGGG - Intronic
1195538710 X:106038165-106038187 GGAGATGATATGTTTACATCTGG - Intronic
1195722716 X:107881757-107881779 ACAGTTGATTTGTTTGAATCAGG - Intronic
1195743435 X:108090278-108090300 GCAGTTGGTTTGTTTAAATCAGG + Intronic
1197802111 X:130361850-130361872 GCTGTTAATATGTAAAAATCAGG - Intronic
1198068824 X:133127670-133127692 GCACTTAATATATTCTAATCTGG - Intergenic
1199360383 X:146910851-146910873 TCAGTTGATTTGTTCAAATCCGG + Intergenic
1201335020 Y:12871411-12871433 GCAGTAATTAGGTTTAAATGAGG + Intergenic