ID: 1119077976

View in Genome Browser
Species Human (GRCh38)
Location 14:71663574-71663596
Sequence ACTTGTGTGGTTCATTACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119077976_1119077979 -4 Left 1119077976 14:71663574-71663596 CCACTGTAATGAACCACACAAGT 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1119077979 14:71663593-71663615 AAGTCTAAACAGACTGCTCAGGG 0: 1
1: 0
2: 0
3: 21
4: 160
1119077976_1119077980 -1 Left 1119077976 14:71663574-71663596 CCACTGTAATGAACCACACAAGT 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1119077980 14:71663596-71663618 TCTAAACAGACTGCTCAGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 155
1119077976_1119077978 -5 Left 1119077976 14:71663574-71663596 CCACTGTAATGAACCACACAAGT 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1119077978 14:71663592-71663614 CAAGTCTAAACAGACTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119077976 Original CRISPR ACTTGTGTGGTTCATTACAG TGG (reversed) Intronic
900669114 1:3838888-3838910 AACTGTGTGGTTCACAACAGTGG - Intronic
904306018 1:29590802-29590824 ACTTGGGTGGTTCAGTGCAAAGG + Intergenic
904445155 1:30566475-30566497 ACTTGTTTGGTAAATTACATGGG + Intergenic
910854863 1:91685143-91685165 AGCTGTGTGGTTCATGAAAGGGG - Intronic
912229837 1:107779962-107779984 AACTGTGTAGTTCATTACAGTGG - Intronic
912900517 1:113642897-113642919 ACATCTTTGGTGCATTACAGAGG - Intronic
917803648 1:178594088-178594110 TCTTTTCTGGTTCATCACAGAGG - Intergenic
923879377 1:238086617-238086639 ATATGTCAGGTTCATTACAGTGG + Intergenic
1064951949 10:20862339-20862361 ACTATTGTGGTTCATTAATGAGG - Intronic
1065196901 10:23275433-23275455 CCTTGTGTTGCTCAGTACAGAGG + Intronic
1069252586 10:66288508-66288530 AGTTGTGTTGTTTAATACAGTGG + Intronic
1071172837 10:82887625-82887647 AATTGTCTGTTTCAATACAGTGG - Intronic
1080123853 11:28708110-28708132 ACTTGTTTAATTCTTTACAGTGG - Intergenic
1088668956 11:112122473-112122495 ACATGTGTGAATCATTACTGAGG - Intronic
1088857733 11:113771467-113771489 CCTTGGGTGGTTCATTTCAAAGG + Intronic
1101732716 12:107440054-107440076 TCTTGTCTGGTTCATTACCTGGG + Intronic
1104683388 12:130767791-130767813 TCTTTTGTGCTTTATTACAGAGG - Intergenic
1106780998 13:33058877-33058899 ATTTGTGGGGTGCATCACAGTGG + Intronic
1108926468 13:55753366-55753388 ACTTTTGTGTTTCATCAAAGAGG - Intergenic
1116466016 14:45233560-45233582 ATTTGTTTGTATCATTACAGTGG - Intronic
1119077976 14:71663574-71663596 ACTTGTGTGGTTCATTACAGTGG - Intronic
1122491974 14:102123709-102123731 AACTGTGTGGTTCATCTCAGGGG + Intronic
1126770413 15:52050497-52050519 ACTTGTTTGGTTGTTTATAGGGG - Intronic
1127809421 15:62550584-62550606 ACATGGGTGGTGCATTAAAGGGG + Intronic
1127810463 15:62560938-62560960 ACTTGCGTGGCTCTTTCCAGAGG + Intronic
1127997865 15:64164206-64164228 AACTTTGTTGTTCATTACAGCGG + Intergenic
1130195536 15:81777224-81777246 ACTTATGTGGTTGATTTCATGGG - Intergenic
1130624754 15:85502682-85502704 ACTTTTGTGGTTAAGTACTGTGG + Intronic
1138404611 16:56779848-56779870 ACATCTGAGGTTCACTACAGGGG - Intronic
1140952956 16:79836672-79836694 ACTTCTGTAGTTCATTACTAAGG + Intergenic
1144445089 17:15319719-15319741 ACGTGTGTGGTCCAGTAGAGAGG - Intronic
1148177095 17:45576101-45576123 ACTTGTTTTGTTGATTACTGAGG - Intergenic
1149358221 17:55866378-55866400 ACTTGTGTGGTGCATTGGAATGG + Intergenic
1153013819 18:565415-565437 ACTTGCGTGGTCTATGACAGAGG + Intergenic
1164973993 19:32557729-32557751 ACTTGAATGGTTCACTACACAGG - Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
931761000 2:65416865-65416887 AGCTGTGTGATTCAGTACAGAGG + Intronic
933188862 2:79310887-79310909 ACTTGTGTATTTCTTTAGAGTGG + Intronic
938338557 2:130520341-130520363 ACGTGTGAGGTTTATTAAAGAGG - Intergenic
938351282 2:130600409-130600431 ACGTGTGAGGTTTATTAAAGAGG + Intergenic
938595739 2:132785412-132785434 TCTTGTGGGGTTCCTTGCAGGGG + Exonic
938606724 2:132901376-132901398 AGTTGTCTGATTAATTACAGTGG - Intronic
940301842 2:152183962-152183984 ACTTGTGAAGTTCATAGCAGAGG - Intergenic
943295495 2:186132987-186133009 ACTAGTATGGCTTATTACAGAGG + Intergenic
943813124 2:192215273-192215295 AATTGTGTAGTTCACTACTGAGG + Intergenic
948557896 2:238827928-238827950 CCTTTTGTGGTTTATTAGAGTGG - Intergenic
1173416569 20:42862202-42862224 CCTTGAGTGGTTCAATACAGTGG - Intronic
1174612095 20:51806300-51806322 ACTTCTGTGTTCCATTACTGTGG - Intergenic
1177591530 21:23175743-23175765 ACCTGAGTCTTTCATTACAGTGG - Intergenic
1179340596 21:40504717-40504739 CCTTGAATGGTTCAATACAGAGG + Intronic
1182142302 22:27971415-27971437 TATTGTGTTGTTCATAACAGTGG + Intergenic
949482564 3:4508006-4508028 AATTGTGTGGTAAAATACAGAGG + Intronic
950482144 3:13250846-13250868 ACTTGCCTGGATCATTGCAGTGG + Intergenic
952274746 3:31866383-31866405 ACTTGTGTGGTTGAGTGCACAGG - Intronic
955683912 3:61530577-61530599 ACCTGTGTGCTTCATTTAAGAGG - Intergenic
960003361 3:112755965-112755987 CCTTGTTTGGATCATTCCAGTGG - Intronic
962176438 3:133160408-133160430 CCTTGTCTGGTTCCTGACAGAGG - Intronic
964035770 3:152194819-152194841 ACTTGTGTAATTAATTACACAGG - Intergenic
969178037 4:5414765-5414787 AATTGTGTGATTGATTACATGGG + Intronic
969920637 4:10536349-10536371 CCTTCTGTGGTTGATTACATGGG + Intronic
970877313 4:20886144-20886166 AGTTATATGGTTCCTTACAGTGG - Intronic
973152844 4:46909407-46909429 TTTTGTTTGATTCATTACAGAGG - Intergenic
978816648 4:112914095-112914117 ACTTGTTTGGGTCATATCAGTGG + Intronic
980063913 4:128161292-128161314 AAATGTGTGGAGCATTACAGAGG - Intronic
981445441 4:144832020-144832042 AGTTTTGTGGTTATTTACAGTGG - Intergenic
987457240 5:18162828-18162850 ACTTGTTTGGTTCTTTTCTGTGG + Intergenic
994679501 5:102867675-102867697 ACTTGCATGCTGCATTACAGAGG - Intronic
997595843 5:135107004-135107026 GCTTGTGTGGTTTATTAAAGAGG + Intronic
999378983 5:151106792-151106814 ACTTGTGGGGTTGGTTACAGAGG - Intronic
1001170156 5:169411686-169411708 ATTTGTATGGTTCATTACAAGGG + Intergenic
1010643903 6:78364302-78364324 AATTCTGTGGTTTATTACAGTGG + Intergenic
1010891966 6:81324607-81324629 TCTTGTTTGTTTTATTACAGAGG - Intergenic
1011431709 6:87294339-87294361 CCTTGTGTGGTTCATTGAGGGGG - Intronic
1012899102 6:104986582-104986604 ACATTTGTGGTTCATTTTAGGGG + Intronic
1014632094 6:123801339-123801361 ATTTGAGTGGTTTATTTCAGAGG + Intergenic
1020898922 7:13977862-13977884 AATTGTGTGGTTAATTTAAGTGG - Intronic
1023254266 7:38297669-38297691 ATTTGTTTGGATCATTACACAGG + Intergenic
1028796956 7:94913579-94913601 AATTGTGTTATTCATTACAAAGG - Intronic
1042113073 8:65402296-65402318 ACCTGTGTGGTCCATTTCTGAGG + Intergenic
1042497475 8:69471248-69471270 TCTTCTGTGGGTCATTAAAGTGG - Intronic
1046514326 8:115239127-115239149 ACTTTTGTGGTTTATAGCAGAGG + Intergenic
1047043086 8:121020718-121020740 AATGGTGTGGTTCATTTCAAAGG + Intergenic
1056209713 9:84354372-84354394 ACCTGTGGGGTTCCTTTCAGGGG - Intergenic
1056467259 9:86869868-86869890 ACTTGTGTGCTTCAAGTCAGTGG - Intergenic
1189203902 X:39221380-39221402 ACTGTGGTGGTTCAGTACAGAGG + Intergenic
1195251367 X:103051428-103051450 CCTTGTGACGTTTATTACAGGGG + Intergenic
1196192264 X:112807227-112807249 ACTTGTGAAGTTCAGTCCAGAGG + Intronic
1197339232 X:125245298-125245320 TCTTGTGAGGTTCATTATACAGG - Intergenic