ID: 1119084840

View in Genome Browser
Species Human (GRCh38)
Location 14:71730256-71730278
Sequence GTGTAAGAAGGCCTCCTCAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119084840_1119084844 1 Left 1119084840 14:71730256-71730278 CCGTTGAGGAGGCCTTCTTACAC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1119084844 14:71730280-71730302 TTAGGAATGAAATCGCTGCATGG 0: 1
1: 1
2: 1
3: 5
4: 122
1119084840_1119084846 27 Left 1119084840 14:71730256-71730278 CCGTTGAGGAGGCCTTCTTACAC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1119084846 14:71730306-71730328 GTGGTCTTTCAGCTGCAGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 168
1119084840_1119084845 8 Left 1119084840 14:71730256-71730278 CCGTTGAGGAGGCCTTCTTACAC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1119084845 14:71730287-71730309 TGAAATCGCTGCATGGTAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119084840 Original CRISPR GTGTAAGAAGGCCTCCTCAA CGG (reversed) Exonic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
907831747 1:58070853-58070875 GTGTAGGAAGGCAGGCTCAAGGG + Intronic
912707091 1:111923015-111923037 GTGGAACCAGGCCTCCTCACTGG - Intronic
913597191 1:120389508-120389530 CTGGAAGAAGGCCTTCCCAAAGG - Intergenic
914001364 1:143697706-143697728 CTGGAAGAAGGCCTTCCCAAAGG + Intergenic
914090133 1:144489798-144489820 CTGGAAGAAGGCCTTCCCAAAGG + Intergenic
914308475 1:146444424-146444446 CTGGAAGAAGGCCTTCCCAAAGG - Intergenic
914514281 1:148361069-148361091 CTGGAAGAAGGCCTTCCCAAAGG + Intergenic
914593634 1:149128709-149128731 CTGGAAGAAGGCCTTCCCAAAGG + Intergenic
916470281 1:165117111-165117133 GTGTAAGAAGGCATTCTCCTTGG + Intergenic
916774620 1:167948233-167948255 GTGTAAAAAGGTCTCCACCATGG - Intronic
918982248 1:191578131-191578153 TTGTAAGAAGGACTCTACAAAGG - Intergenic
918983222 1:191590582-191590604 GTTTAACAAGGCCTCCTTAATGG - Intergenic
919581290 1:199377314-199377336 GTGAAAGAAGGCAGACTCAAAGG + Intergenic
920212277 1:204336880-204336902 GTCTAAAGAGGCCTCCTCCAAGG + Intronic
922616089 1:226961963-226961985 GAGAATGAAGCCCTCCTCAATGG - Intronic
1064425078 10:15223217-15223239 TGGTAAGAAAGCTTCCTCAAAGG + Intronic
1068776392 10:60872651-60872673 GTTTAAGGAAGCCTCCGCAATGG + Intronic
1073353762 10:102837554-102837576 GGGAGTGAAGGCCTCCTCAAGGG + Intergenic
1075566593 10:123509483-123509505 GTTGAAGAAGGCCTCCTCCTAGG + Intergenic
1082960089 11:58911084-58911106 GTGAAAGAAGCCATGCTCAAAGG - Intronic
1084950094 11:72660058-72660080 CTATAAGAAGTCCCCCTCAAAGG + Intronic
1085147150 11:74211550-74211572 GTTTAAGAAGGCCTGCTTTAAGG - Intronic
1088102057 11:106166544-106166566 ATGTGAGATGGCCTCTTCAAGGG - Intergenic
1091816536 12:3443154-3443176 GTGTGAGATGTCATCCTCAAGGG - Intronic
1093251116 12:16805672-16805694 AAGTCAGAAGGCCTCCTTAATGG + Intergenic
1096941910 12:55355882-55355904 GGGTCAGATTGCCTCCTCAAGGG + Intergenic
1103839702 12:123852198-123852220 GTGAAAGAAGCCCGTCTCAAAGG - Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107695433 13:42994905-42994927 GTGGAAGATGGCCTCCAGAAAGG - Intergenic
1113333729 13:109357695-109357717 GTGTAACAAGCCCTCCTGGAGGG - Intergenic
1117233072 14:53742052-53742074 GTAAAAGAAGGTCTCCTGAAAGG - Intergenic
1117537335 14:56714597-56714619 GGGTAAGCAGACCACCTCAAAGG + Intronic
1117850386 14:59962163-59962185 GTGTAAGAAGCTCTTCGCAAGGG + Intronic
1119084840 14:71730256-71730278 GTGTAAGAAGGCCTCCTCAACGG - Exonic
1122582965 14:102783027-102783049 GTGTACGCAGGCCTCCTAACGGG - Intronic
1127126750 15:55819512-55819534 GTGTAACAGGGTCTCCTCACGGG + Intergenic
1128750994 15:70148846-70148868 GGGTAGGAAGGCCTCATCCAGGG + Intergenic
1129635939 15:77317906-77317928 GTGTAAAAAGCCATTCTCAAAGG + Intronic
1134263954 16:12676643-12676665 CTGTAAGAAGGCTTCCTGGAGGG + Intronic
1134409430 16:13991689-13991711 GGGTAATAAGCCCTCATCAAAGG - Intergenic
1134829124 16:17309311-17309333 GGGTAATTAGGCCTCCCCAAGGG - Intronic
1135070627 16:19348681-19348703 GTGTATGAAGGCATGCTCACAGG - Intergenic
1136405257 16:30042018-30042040 GTGTAAAAAGGGCTCCTTAGGGG - Intronic
1137495221 16:48964283-48964305 AGGTAGGAAGGCCTCCTCCAAGG + Intergenic
1138706561 16:58921128-58921150 GTGGGAAAATGCCTCCTCAAGGG - Intergenic
1139014978 16:62678866-62678888 GTGTAACATGCCCTCCTCTAAGG + Intergenic
1147869044 17:43574407-43574429 GTGTCAGGAGGCCTGGTCAAGGG - Intronic
1152876119 17:82787113-82787135 GTGTAAAACGGTCTTCTCAAAGG + Intronic
1155384999 18:25267431-25267453 GGGTCAGACTGCCTCCTCAAGGG + Intronic
1157280168 18:46341760-46341782 TTGTAAGAAAGCTTGCTCAAGGG - Intronic
1157911084 18:51617865-51617887 GTATAAAAAGGCCTGCTCACAGG - Intergenic
925969097 2:9094575-9094597 CTGAAAGCAGGCCTCCTCATGGG + Intergenic
926001093 2:9333420-9333442 GTATAAGAAGGCCTCTTATAGGG + Intronic
926119952 2:10236385-10236407 GTGGAAGACGGGCCCCTCAATGG - Intergenic
931073706 2:58684966-58684988 GTGGAATAATGGCTCCTCAAAGG + Intergenic
933263047 2:80151375-80151397 GTGTTAGAACTCCTCATCAAAGG - Intronic
935823711 2:106920163-106920185 TTAGAAGAAGGACTCCTCAAAGG - Intergenic
937466143 2:122134805-122134827 GTCTAGGAAGGCCTTCTGAAGGG + Intergenic
938760805 2:134424233-134424255 GGGTAAGATGGCCTCCACATGGG - Intronic
939932870 2:148255657-148255679 TTGTAAGAAAGCCTCCACCAGGG + Intronic
942157707 2:173148527-173148549 GTTTATGAAGGTCTGCTCAAGGG - Intronic
943134179 2:183890781-183890803 GTGTAAGATGGCCACCTCTTTGG - Intergenic
944391749 2:199225781-199225803 GTGTAACAAAGCCTCCACCAGGG + Intergenic
944536399 2:200714549-200714571 CTGTAGGAAGGCAACCTCAAAGG - Intergenic
1169330250 20:4710562-4710584 GTGAGAAAAGGCCTCCTCCAGGG - Intergenic
1169759823 20:9079263-9079285 CTTTAACAAGCCCTCCTCAAAGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1173431481 20:42991178-42991200 GTGTAAAAATGCACCCTCAAGGG + Intronic
1174306594 20:49617815-49617837 GGGGATGAAGGCCTGCTCAAGGG - Intergenic
1174524460 20:51160160-51160182 GTATAAGCAGGTCTCTTCAAAGG - Intergenic
1179121134 21:38546969-38546991 GTGTATGAAGTGGTCCTCAAAGG + Intronic
1179563689 21:42233358-42233380 GTGCAAGAAGGCTCCCTCCACGG - Intronic
1185362089 22:50414396-50414418 TTGTAAGAAAGCCCCCTCAAGGG - Intronic
950523316 3:13509086-13509108 GGGTGAGCAGGCCTCCTCAAAGG - Intergenic
951359300 3:21705583-21705605 GAGTAAGAGGACTTCCTCAAAGG + Intronic
955556984 3:60148967-60148989 GTGGAAGGAGGCATGCTCAAAGG - Intronic
957685810 3:83502380-83502402 GTGTAACAAGGACTCCACCAGGG + Intergenic
958172551 3:89956114-89956136 GTGTCATAAGGCCACCTCATGGG - Intergenic
959162720 3:102740144-102740166 GTGTAACAAAGCCTCCACCAGGG - Intergenic
959992389 3:112643735-112643757 ATGTAAGAAGGCATCCAAAAAGG + Intronic
960643347 3:119850460-119850482 GTGCAAGGAGGCTTCCTCACAGG - Intronic
961994634 3:131228961-131228983 GTATACGAAGCCCTCCTCAGTGG - Intronic
962627994 3:137246368-137246390 GAGTGAGAAGACTTCCTCAAGGG + Intergenic
963753360 3:149206286-149206308 GTGTAACAAGTCTTCATCAAAGG - Exonic
963826991 3:149966518-149966540 GAATAAGAAGGCATACTCAATGG - Exonic
968455367 4:695748-695770 GTGTAAGTAAGCCTTCTCCAGGG + Intergenic
968714645 4:2147357-2147379 TTTTACGAAGGCCTCCTCATGGG - Intronic
969418403 4:7075731-7075753 GTGTCTGGAGGCCTCCTCAGTGG + Intergenic
971865443 4:32164677-32164699 ATGCAAGAAGGCATCGTCAATGG - Intergenic
971978786 4:33726654-33726676 GTCTCAGAAGGCCTACTCACTGG + Intergenic
977575206 4:98666920-98666942 GTGTAACAAAGCCTCCACCAGGG + Intergenic
979665111 4:123302830-123302852 CTCTAGGAATGCCTCCTCAATGG + Intronic
984842988 4:184085440-184085462 GTGTAAGAAGCCATCTGCAAAGG + Intergenic
997008360 5:129847580-129847602 GTGAAAGCAGGCCTGCCCAAAGG - Intergenic
997917254 5:137940045-137940067 GAGTAAGTAGGCCCTCTCAAGGG - Exonic
1001216546 5:169861232-169861254 GCTTAAGAAGGACACCTCAATGG - Intronic
1003030790 6:2598865-2598887 GTGTCTGAAGGCCTCGTCCATGG + Intergenic
1006314600 6:33282829-33282851 GAGTCAGAAGGCCTGCCCAAGGG - Intronic
1006578046 6:35060258-35060280 GTGGCTGCAGGCCTCCTCAATGG + Intronic
1010425041 6:75720230-75720252 GTTTAAGCAGGTCTCCTCACAGG + Intergenic
1014752769 6:125272417-125272439 GTGTAATAAAGCCTCCACCAGGG - Intronic
1016332206 6:142965394-142965416 GTGGAAGAAGGCTTCCTTTAAGG - Intergenic
1016560654 6:145392281-145392303 GTCTCCGATGGCCTCCTCAAAGG + Intergenic
1026402927 7:70034326-70034348 GGGTAAGAAGGACAACTCAAGGG - Intronic
1034552291 7:151828977-151828999 GTGTTAGAAGGCTTCTTAAATGG + Intronic
1042449255 8:68925267-68925289 GTCTGAGCAGGCCTCGTCAAAGG + Intergenic
1045914565 8:107451712-107451734 GTGTAAGATGACCTCCACAATGG - Intronic
1048067960 8:130990716-130990738 GTGAAAGAAGCCCTCTCCAAAGG - Intronic
1049019561 8:139946382-139946404 GTGTTAGAAGCCCTCGTCAATGG + Intronic
1057648991 9:96903312-96903334 GTGAAAGAAGCCCGTCTCAAAGG - Intronic
1185659957 X:1719824-1719846 GGGAAAGAAGGACTCCACAAGGG - Intergenic
1187666840 X:21622274-21622296 TTGTAAGAAGAGCTCCACAAAGG - Intronic
1188097923 X:26045457-26045479 GTGTAAGACGGCCACCTCCTTGG - Intergenic
1190319794 X:49173280-49173302 GTGTGAGAAGGGGTCCACAATGG + Exonic
1191119258 X:56886483-56886505 GTCTCAGAAGCCCTCCTAAAGGG - Intergenic
1192111856 X:68373137-68373159 GTTTTAGAAAGCCTCCCCAAAGG + Intronic
1192191586 X:68994470-68994492 GAGTAGGGAGGCCTCCCCAAAGG + Intergenic
1195175694 X:102313359-102313381 GTGTAAGAATGACTTCTGAATGG + Intronic
1195183170 X:102373734-102373756 GTGTAAGAATGACTTCTGAATGG - Intronic
1196344198 X:114632776-114632798 TTCTAAGGAGGCCTCCTCTAAGG - Intronic
1198946274 X:142018697-142018719 GTGTAAGACGGTCTACACAATGG + Intergenic
1201593414 Y:15639500-15639522 GTGTAAGAAGGCATGTTCAATGG - Intergenic
1201648637 Y:16262491-16262513 GTGTAAGATGGCCACCTCCTTGG + Intergenic
1201654173 Y:16322810-16322832 GTGTAAGATGGCCACCTCCTTGG - Intergenic