ID: 1119084867

View in Genome Browser
Species Human (GRCh38)
Location 14:71730431-71730453
Sequence AGAGAGAGGGCAAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1414
Summary {0: 1, 1: 0, 2: 8, 3: 118, 4: 1287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119084867_1119084875 9 Left 1119084867 14:71730431-71730453 CCTTCCTCATTTGCCCTCTCTCT 0: 1
1: 0
2: 8
3: 118
4: 1287
Right 1119084875 14:71730463-71730485 CCAGACCACCATAGTCACCTGGG 0: 1
1: 0
2: 0
3: 12
4: 185
1119084867_1119084873 8 Left 1119084867 14:71730431-71730453 CCTTCCTCATTTGCCCTCTCTCT 0: 1
1: 0
2: 8
3: 118
4: 1287
Right 1119084873 14:71730462-71730484 CCCAGACCACCATAGTCACCTGG 0: 1
1: 0
2: 0
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119084867 Original CRISPR AGAGAGAGGGCAAATGAGGA AGG (reversed) Intronic
900735558 1:4297516-4297538 TGTGAGGGGGCCAATGAGGAGGG + Intergenic
900894908 1:5476650-5476672 AGAGAGAGGGGAGATGAAGGTGG - Intergenic
901461940 1:9397249-9397271 AGAGAGAGAGAAAAGAAGGAAGG - Intergenic
901499570 1:9643433-9643455 AGAGAGAGGGGAAGGAAGGAAGG + Intergenic
901678334 1:10899579-10899601 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
901860525 1:12071585-12071607 AGAGAGAGGAAATGTGAGGATGG - Intronic
901925338 1:12562406-12562428 GGAGAGAGAGCAAAGAAGGAAGG - Intergenic
902030381 1:13417661-13417683 AGAGAGAGGGAAAAGAAGCAGGG + Intronic
902273665 1:15324577-15324599 AGAGCGTGGGCCAATGAGGGGGG - Intronic
902388685 1:16090376-16090398 AGAGAGCAGGCAAGTGAGGCAGG - Intergenic
902454566 1:16523243-16523265 AGTGAGAGGACAAAGGAGGGCGG + Intergenic
902825761 1:18973138-18973160 AGAGTGAGGGCAGAAGAGGAAGG - Intergenic
903017683 1:20371867-20371889 AGGGAGGGAGCAGATGAGGAGGG + Intergenic
903117505 1:21190337-21190359 AGAGTGAGGGGAAAGAAGGAAGG + Intergenic
903470398 1:23582881-23582903 AGACTGAGGCCAAGTGAGGAGGG + Intronic
904073081 1:27816944-27816966 AGAGAGAGGAGAAAGAAGGAAGG + Intronic
904390769 1:30184357-30184379 AGAGAAGGTGAAAATGAGGAAGG - Intergenic
904390788 1:30184451-30184473 AGAGAAGGTGAAAATGAGGAAGG - Intergenic
904567161 1:31434851-31434873 GGGGAGGGGGCCAATGAGGAAGG + Intergenic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905243787 1:36598268-36598290 AGAGAGATGGCACATCAGGTAGG - Intergenic
906787925 1:48632115-48632137 AGAGAGTGGGGAAAAGAGGAAGG + Intronic
907264491 1:53249108-53249130 TGAGATGGAGCAAATGAGGAGGG - Intronic
907269975 1:53285298-53285320 AGAGAGAGGTCACTGGAGGAAGG + Intronic
908312878 1:62903081-62903103 AGGGAGAAAGCAAATGAAGATGG - Intergenic
908744537 1:67362805-67362827 AGAGAGAAGGAAAATGAGATAGG + Intronic
908940244 1:69423650-69423672 TGATAGAGGGAAATTGAGGAAGG - Intergenic
908962647 1:69717873-69717895 AGAAAGAGAGAAAAAGAGGAGGG + Intronic
909772185 1:79437704-79437726 AGAGAGAGAGTGAAGGAGGAAGG - Intergenic
909943616 1:81638288-81638310 AGAGAAAAGGAAAATGAGAAAGG + Intronic
910115190 1:83724105-83724127 AGAGAGAGGGAAAGTGAGCTAGG - Intergenic
910440646 1:87248127-87248149 AGAGAGAGAGAGAATGAGGCGGG + Intergenic
910509963 1:87992555-87992577 AGAGAGAGGCCAAAAGAGAAGGG + Intergenic
911420856 1:97638739-97638761 AGAGAGAGAGCAAGAGAGAAAGG + Intronic
912228670 1:107766693-107766715 AGAGAGAGGGAAAAGGAGAGTGG + Intronic
912340052 1:108905668-108905690 AGAGAGATGGAAAATAGGGAGGG - Intronic
912595590 1:110872667-110872689 AGACAGAGGGAGTATGAGGAGGG + Intergenic
912872896 1:113326421-113326443 AGAGAGTTAGCAAATGAAGAAGG - Intergenic
913091262 1:115478314-115478336 AGAGAGTGGACAACTGAGGCTGG + Intergenic
913142259 1:115953292-115953314 AGAGAAAGAGCAAATGGGGAGGG - Intergenic
913174870 1:116264071-116264093 AGAAAAAGGACAAATCAGGAGGG + Intergenic
913511263 1:119564729-119564751 ACAGAGAGAGAAAATGAGGGGGG + Intergenic
913963237 1:143354771-143354793 AGAGAGAGAGGAAAGAAGGAAGG - Intergenic
914057593 1:144180357-144180379 AGAGAGAGAGGAAAGAAGGAAGG - Intergenic
914121553 1:144786009-144786031 AGAGAGAGAGGAAAGAAGGAAGG + Intergenic
914960077 1:152197351-152197373 AGAGAGAGGGGAAAGAAAGAAGG - Intergenic
914999330 1:152573710-152573732 AGGGGGAGAGCAAAAGAGGATGG - Intronic
915083192 1:153366050-153366072 AGAGAGGGGGCAAATCAAGAGGG - Intergenic
915111410 1:153566555-153566577 AGACAAAGGGCCAAGGAGGAAGG - Intronic
915334871 1:155135346-155135368 AGAGGGAGGGCAAAAGAGGAAGG + Intronic
915470730 1:156124270-156124292 AGAGAGAGAGGAACTGAGGGGGG - Intronic
915924459 1:160005231-160005253 AGAGAGAGGGCAAGTGAAGCAGG - Intergenic
915947863 1:160167182-160167204 GGAGAGGGGACAAATGGGGAGGG - Intronic
916336829 1:163681774-163681796 AGAGAGTGGCAAAATGGGGATGG - Intergenic
916522780 1:165580227-165580249 AGAAAGAGAGGAAAGGAGGAAGG + Intergenic
916737983 1:167624985-167625007 AGAGAGAGGGAGAGGGAGGAGGG - Intergenic
917429921 1:174955554-174955576 AGTGAGAGAGCAAAAGAGAATGG - Intronic
917680272 1:177358820-177358842 AGAAAGGGGGAAAAGGAGGAAGG + Intergenic
917789343 1:178489448-178489470 AGAGAGGTGGGGAATGAGGAAGG + Intergenic
918110333 1:181450119-181450141 AGAGAGAGAGCAAAGGGGGAAGG + Intronic
918212842 1:182366875-182366897 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
918283582 1:183029615-183029637 AGAGAGAGAGAAACTGGGGAAGG - Intronic
918376030 1:183910101-183910123 AGAAAGAGAGCGAGTGAGGAAGG - Intronic
919161803 1:193840171-193840193 AGAGAGAGGAGAGATGGGGAAGG + Intergenic
919531300 1:198724667-198724689 AGAGAGAGAGAGAATCAGGATGG - Intronic
919638256 1:200024875-200024897 AGAGAGAGAGAAGATGGGGAAGG + Intergenic
919715956 1:200776861-200776883 AGAGTGAGAGAAAAGGAGGAAGG + Intronic
920251692 1:204626248-204626270 TGGGAGAGGGCAGATGAAGAGGG - Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920547876 1:206833710-206833732 AGAGAGAGAGAAAATGAGACTGG - Intronic
920700614 1:208215667-208215689 AGGGAGAGAGCTAAGGAGGATGG + Intronic
920768447 1:208856301-208856323 TGAGAGAGTATAAATGAGGAAGG - Intergenic
920783065 1:209013283-209013305 CGAGAGAGGGGAAGAGAGGAAGG - Intergenic
920823360 1:209401932-209401954 AGAGAGAGGGGAAAAGAGAGAGG + Intergenic
920977740 1:210801564-210801586 GAAGAGAGGGCAAATGCTGACGG + Intronic
921266924 1:213428513-213428535 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
921285070 1:213602232-213602254 AGAGAGAGAGAAAGAGAGGAAGG - Intergenic
921924910 1:220703401-220703423 AGAGAGAGGGCTGAAGAGGATGG + Intergenic
922064479 1:222123884-222123906 AGAGAGAGGGAAAGAGAGAAGGG + Intergenic
922202609 1:223418958-223418980 ATAAAGAGGGAACATGAGGAGGG + Intergenic
922596344 1:226816414-226816436 AAAGAAAGGGCAAGTGATGATGG + Intergenic
922650052 1:227330063-227330085 AGAGAAAGGACAAATGGAGAAGG - Intergenic
922724048 1:227914424-227914446 GGAGGGAGGGGAAAGGAGGAGGG - Intergenic
923182164 1:231530126-231530148 AGAGAGAGTGCAAGAGAGCAAGG + Intronic
923235738 1:232031224-232031246 AGAGAGAGAGAAAGAGAGGAAGG + Intronic
923285730 1:232493117-232493139 AGAGAGAGAGTAAAGGGGGAAGG - Intronic
923292483 1:232560026-232560048 AGAGAGAGAGCAGATTAGGCAGG - Intronic
923455814 1:234164353-234164375 GGAGAGAGGGGAAAGAAGGAGGG - Intronic
924121569 1:240804910-240804932 ATAGAGAGTGGAAATAAGGAAGG + Intronic
924240069 1:242031889-242031911 AGAGAGTGGGCAAAGTGGGAGGG + Intergenic
924513454 1:244747421-244747443 TGAGGGAGGGCAAGGGAGGAAGG + Intergenic
924628612 1:245716135-245716157 AGTGAGAGGGAAAGTGAGAAAGG + Intergenic
1063025914 10:2178747-2178769 AGAGAGGGAGGAAAAGAGGAAGG - Intergenic
1063156308 10:3382231-3382253 AGAGGGAGGGAAGAGGAGGAAGG + Intergenic
1063248165 10:4245572-4245594 AGAGAGAGGGGAAAGAAAGAAGG - Intergenic
1063599086 10:7463788-7463810 AGAGAGAGAGAAAAGAAGGAAGG - Intergenic
1063636849 10:7790079-7790101 AGAGAAATGGCAGAAGAGGAAGG - Intronic
1063859505 10:10292277-10292299 AGAGAGAGGTTAAATGGGAAAGG - Intergenic
1063996875 10:11627889-11627911 AGAGAAAGGGAAAATGATAAAGG - Intergenic
1064134168 10:12736193-12736215 AGAGAGGAGGCAAGTGAGCATGG - Intronic
1064296767 10:14085687-14085709 ACAGCGAGCGCAAATGAAGATGG - Intronic
1064414470 10:15136461-15136483 AGAGAGGGAGGAAAGGAGGAAGG + Intronic
1064482878 10:15757061-15757083 AGAGAGAAGGGGAATGAAGATGG + Intergenic
1064541750 10:16412734-16412756 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1064628527 10:17285729-17285751 AGAGAGAAGGGAAAGGGGGAGGG + Intergenic
1064877772 10:20014434-20014456 AGAGAGAGGGGAAGGAAGGAAGG - Intronic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1065933444 10:30499801-30499823 AGAGGGAGGGTAGATAAGGAAGG + Intergenic
1065976711 10:30848116-30848138 AAAAACAGGGCAAATGAAGAGGG + Intronic
1066258809 10:33708539-33708561 ACAGATGGGGCAAATGTGGAAGG + Intergenic
1066336231 10:34481233-34481255 AGGGAGAGGGAAAGGGAGGAGGG - Intronic
1066713909 10:38265867-38265889 AGAGAGAGAGACAAGGAGGAAGG - Intergenic
1067434998 10:46270414-46270436 ACTCAGAGGGGAAATGAGGAAGG + Intergenic
1067557803 10:47284846-47284868 GGAGAGAGGGAAGAGGAGGAAGG + Intergenic
1067711517 10:48654979-48655001 AGAGAGAGAGGAAGGGAGGAAGG - Intronic
1067752123 10:48978437-48978459 GGAGAGAGGGGAGGTGAGGAGGG - Intronic
1068051604 10:51957055-51957077 AGAGAGAGAGGAGATGGGGAGGG - Intronic
1068643014 10:59432342-59432364 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1068846437 10:61680960-61680982 AGAGAGAGAGAGAACGAGGATGG - Intronic
1069050211 10:63784693-63784715 AGAGAGAGAGCAAAAGGGGGTGG + Intergenic
1069303795 10:66942645-66942667 AGAGAGTGAGAAAGTGAGGAAGG - Intronic
1069556398 10:69401335-69401357 AGTGGCAGGGCAAGTGAGGAGGG - Exonic
1069777765 10:70936765-70936787 AGCAAGAGGGCAGAGGAGGAGGG - Intergenic
1070225848 10:74504783-74504805 CGAGAGAGGGCACATGAGAGAGG - Intronic
1070393793 10:75993939-75993961 AGAGAGAGGGAAAATCCTGATGG + Intronic
1070418917 10:76217062-76217084 TGTGAGGGGGCAAATGAGAATGG + Intronic
1070574890 10:77670446-77670468 AGAGGGAGGGGAAGAGAGGAAGG + Intergenic
1070658256 10:78285950-78285972 AGAGAGACAGACAATGAGGAGGG - Intergenic
1070686263 10:78484945-78484967 AGAAAGAGAGCAAAAGAGGGAGG - Intergenic
1070740930 10:78902780-78902802 AGAGGCAGGGGAAATGAGGAAGG + Intergenic
1070991660 10:80738854-80738876 GGAGAGAGGGGAAAGGGGGAGGG - Intergenic
1072274629 10:93811031-93811053 AAAGAGGGGGCAAATTGGGAAGG - Intergenic
1072307402 10:94120801-94120823 AGAGAGAGGGGTGATGGGGAAGG + Intronic
1072609433 10:97006741-97006763 TCAGAGAGGGCCAAGGAGGAAGG + Intronic
1072825845 10:98605551-98605573 ACAGAGAGTGTAAATGGGGATGG + Intronic
1073060399 10:100730298-100730320 AAAGAAAGGGAAAATGAGGAAGG - Intergenic
1073142763 10:101260029-101260051 TGAAAGAGGGAGAATGAGGACGG + Intergenic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074140230 10:110666010-110666032 AGAGAGAGGGGAAGGAAGGAAGG + Intronic
1074202125 10:111246898-111246920 AGAGGGAGGGGAGAAGAGGAGGG - Intergenic
1074205277 10:111277597-111277619 AGAGAGAGAGAAAGAGAGGAGGG + Intergenic
1074209687 10:111319048-111319070 AGAGAGAGAGAAAATGAAGACGG - Intergenic
1074253586 10:111778148-111778170 TGAGAGAGGGGACATGAGCAAGG + Intergenic
1074348645 10:112713163-112713185 AGAGAGAAGGAAACTAAGGAGGG - Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075286138 10:121187819-121187841 AGAGCCAGCCCAAATGAGGAAGG + Intergenic
1075391205 10:122093689-122093711 ATAGAGAGAGAAACTGAGGATGG - Intronic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1076109136 10:127848177-127848199 AGAGAGAGAGCAAGGGAGGGAGG + Intergenic
1076239954 10:128897310-128897332 AGAGAGAGAGCCAGTGAGGGGGG + Intergenic
1076383926 10:130044022-130044044 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1076434885 10:130433585-130433607 AGAGAGAGAGCAAGTGAAGGGGG + Intergenic
1076719342 10:132386453-132386475 TGAGAGAGGGCAGATGACCACGG - Intergenic
1077168799 11:1157349-1157371 AGAGAGAGAGCACATGCGGCAGG - Intergenic
1077238998 11:1500905-1500927 AGAGCGAGGGGAAGTGGGGAGGG - Intronic
1077372768 11:2191242-2191264 AGGGAGAAAGCAAAGGAGGAAGG + Intergenic
1077418339 11:2436409-2436431 AGAAGGAGGGCAAATGGGGGTGG - Intergenic
1077578420 11:3401877-3401899 GGAGAGAAGGCAGCTGAGGATGG - Intergenic
1077588990 11:3477243-3477265 AGAGAGAGGACAAGTGATGGAGG - Intergenic
1077693829 11:4375277-4375299 ATAGAGTGGCCAAATGATGAAGG - Intergenic
1077816448 11:5690445-5690467 GGAGAGAGGGGAGATGGGGAAGG + Intronic
1077869037 11:6246027-6246049 AGATAGAGGACAAATGTTGAAGG + Intergenic
1077901808 11:6496200-6496222 AGAGAAAGGGAAAAAGAAGAGGG + Intronic
1077908591 11:6555187-6555209 AGAGAGAGAGGGAATGAGGGAGG - Intronic
1078320901 11:10333627-10333649 AGGGAAAGGCCATATGAGGACGG + Intronic
1078744229 11:14096091-14096113 AAAGAAAGGGCAAAAGAGAAAGG + Intronic
1078897887 11:15614105-15614127 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1080143373 11:28949534-28949556 AGACAGAGTTCAAATTAGGATGG + Intergenic
1080243156 11:30150532-30150554 GGAGAGAGGGGAAAGGAGGAAGG + Intergenic
1080397893 11:31906724-31906746 AGACAGAGGGGAAGGGAGGAAGG - Intronic
1080517150 11:33034934-33034956 ACAGAGAGGGGAAAGGTGGAAGG - Intergenic
1080846050 11:36027950-36027972 AGACAGAAGGCATAGGAGGATGG + Intronic
1080930412 11:36804362-36804384 AGAGAGAGAAGAAATGAAGAAGG - Intergenic
1081001272 11:37675641-37675663 AGAGAGGGAGCAAAAGAGAAAGG + Intergenic
1081434104 11:43008278-43008300 AGAGAGAGGGGGAGGGAGGAAGG + Intergenic
1081567441 11:44268717-44268739 TGAGAGAGGGAGAGTGAGGAGGG + Intronic
1081603271 11:44510265-44510287 ACAGAGAGGGAAACTGAGGCAGG - Intergenic
1081724111 11:45314834-45314856 AGAGAGAGGGGAAATAAATAAGG - Intergenic
1081745421 11:45469458-45469480 GGAGAGGGAGAAAATGAGGAAGG - Intergenic
1081781821 11:45718356-45718378 TGAGAGAGGGGAAAAGAGCATGG - Intergenic
1081882872 11:46468841-46468863 AGAGAGAAAGAAAAGGAGGAAGG + Intronic
1082196783 11:49316204-49316226 GGAGAGGGGGCACAGGAGGAAGG + Intergenic
1082714678 11:56597726-56597748 GGTGAGAGAGCAAATGAGGTTGG + Intergenic
1082716475 11:56620046-56620068 AGTGAGAGGGCAGATGAGGTTGG + Intergenic
1082996396 11:59259110-59259132 AGTGAAAGGGCCAATGAGGAGGG - Intergenic
1083041394 11:59690928-59690950 AGAGAGAGAGAAAAGGAGAAAGG - Intergenic
1083729925 11:64647431-64647453 AGAGGGAGGGCAGCTGAGGCAGG - Intronic
1083828290 11:65215449-65215471 AGAGAGAGCGAAGAGGAGGAAGG - Intergenic
1083926269 11:65808946-65808968 AGAGAGGGGGCGAGTGATGAAGG - Intergenic
1084235458 11:67785393-67785415 GGAGAGAAGGCAGCTGAGGATGG - Intergenic
1084244688 11:67848866-67848888 AGAGAGAGGACAAGTGATGGAGG - Intergenic
1084296369 11:68215140-68215162 AGAATGAGGGCAAACGAGGGAGG - Intergenic
1084585810 11:70061509-70061531 AGAGAGAGAGAAAGGGAGGAGGG - Intergenic
1084751120 11:71204999-71205021 GGAGAGAGGGCAGGTGAGGGAGG - Intronic
1084827996 11:71745690-71745712 AGAGAGAGGACAAGTGATGGAGG + Intergenic
1084893289 11:72247722-72247744 GGAGAGAGAGGAAATGAAGAGGG - Intergenic
1085231299 11:74973308-74973330 AGAGAGAGTGCCAATGAGCCAGG - Intronic
1085564605 11:77501766-77501788 AGAGAGAGCTCAAATATGGATGG + Intergenic
1085712980 11:78846858-78846880 AGAGAGAAGGGAAATGAATATGG - Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085918066 11:80915198-80915220 AGAGAGAGAGCAAATGAAGATGG + Intergenic
1086034544 11:82400821-82400843 AGAGAGAGGCCTAAGGAGGGGGG + Intergenic
1086659043 11:89391989-89392011 GGAGAGGGGGCACAGGAGGAAGG - Intronic
1086772811 11:90790540-90790562 AGAGAGAGAGAAAGTCAGGAAGG + Intergenic
1087717499 11:101625421-101625443 AGGGAGAGGTGAAAAGAGGAAGG - Intronic
1087845845 11:102971577-102971599 AGGGAGAGAGCAAAGGAGGGAGG + Intergenic
1088272673 11:108050935-108050957 AGATATATGGAAAATGAGGACGG - Intronic
1088472140 11:110197867-110197889 AGAGTGAGAGCAAATGATGATGG + Intronic
1088505357 11:110522115-110522137 AGAAAGATTGTAAATGAGGAGGG - Intergenic
1089012858 11:115144832-115144854 AGAGAGAGAGAAGATGAGGGAGG - Intergenic
1089084497 11:115805594-115805616 AGAGAAGGGGCAGATAAGGAAGG + Intergenic
1089135038 11:116242212-116242234 AGAGACAAGGCTACTGAGGATGG + Intergenic
1089174244 11:116536785-116536807 AGAGAGAGGGGAATCCAGGAAGG - Intergenic
1089269192 11:117289810-117289832 GGGGAGAGGGCAAATGTGAATGG + Intronic
1089291988 11:117443114-117443136 AGAGAGTGGGGGAGTGAGGAGGG + Intronic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089641621 11:119851422-119851444 AGAGAGAGAGCAAGGGAGGGAGG - Intergenic
1090183396 11:124719998-124720020 AGAGAGAGAGAGAAGGAGGAAGG + Intergenic
1090250391 11:125246872-125246894 AGAGAATGGGAAAGTGAGGAGGG - Intronic
1090350282 11:126103718-126103740 AGAGACAGGGCAGAGGAGGGCGG - Intergenic
1090510871 11:127373750-127373772 AGAGATAGGAAAGATGAGGAAGG - Intergenic
1091446764 12:548198-548220 AGAGAGAGGGTAGATGCAGAAGG - Intronic
1091481732 12:839479-839501 AGAGAGAAGGCCAAAGTGGATGG + Intronic
1091690293 12:2591643-2591665 AGAGAGAGAGAGCATGAGGAAGG + Intronic
1091860258 12:3774919-3774941 AGAGAGAGAGCAAAAGAGCAAGG - Intergenic
1091957968 12:4664099-4664121 AGAGAAAGAGGAAATGAAGAAGG + Intronic
1092163920 12:6330808-6330830 AGGGAGAGGGCAGGTGAGCATGG + Intronic
1092201047 12:6583120-6583142 GGAGAGAGGGCAGATGAGCGGGG + Intronic
1092237418 12:6818937-6818959 TGAGAGAGGGGAAAGGGGGAGGG + Intronic
1092799085 12:12145536-12145558 AGAGAGAGGGAAAGAGAGAAGGG - Intronic
1092917517 12:13202105-13202127 AGAAAGGGGGCAAAAGAGCAAGG + Intronic
1093663372 12:21783441-21783463 AGAGAAAGAGAAAATGAGGAGGG - Intergenic
1093767654 12:22982954-22982976 AGAGTGTGAGCAAATGAGGCAGG - Intergenic
1093921304 12:24862700-24862722 AGAGAGAGGGGAAAAGAGAACGG - Intronic
1094677208 12:32632556-32632578 AGAAAGAGGGCAAATTATGCAGG + Intronic
1095103466 12:38205291-38205313 AGAGTGAGAGCCATTGAGGAGGG - Intergenic
1095108878 12:38268867-38268889 AGAGAGAGGGAGGATGAGAATGG + Intergenic
1095160708 12:38911848-38911870 AGAGAGAGTGTAGATCAGGAAGG + Intergenic
1095163807 12:38948071-38948093 AGTGAGGGGGGAAGTGAGGATGG + Intergenic
1095694353 12:45127952-45127974 AGAAAGAGGGCAGAAGAGGAGGG - Intergenic
1095946033 12:47753831-47753853 TGGGAGAGGGCACATTAGGAGGG + Intronic
1096094267 12:48924338-48924360 AGGGAAAGGTCAATTGAGGATGG - Intronic
1096328400 12:50687014-50687036 AGAGAACGGAGAAATGAGGAGGG + Intronic
1096465540 12:51846353-51846375 AAAGACAGGGACAATGAGGAAGG + Intergenic
1096717233 12:53499066-53499088 AGAGAGAGAGGGAAGGAGGAGGG - Intronic
1096727715 12:53578484-53578506 AGAGAGAAGGAAAATGAGCTAGG + Intronic
1096926019 12:55147470-55147492 AGAAAGAGGGAAAAGGAGGAGGG + Intergenic
1096958325 12:55549856-55549878 AGAGAAAGGTAAAATGTGGATGG + Intergenic
1096981852 12:55732662-55732684 AGGGTGAGGGGATATGAGGAGGG + Intergenic
1096981857 12:55732681-55732703 AGGGTGAGGGGATATGAGGAAGG + Intergenic
1097227856 12:57489238-57489260 AGAGAGAGAGCAACAGATGATGG - Intronic
1097356064 12:58603202-58603224 AGAGAGAGGATAAGTGAGCAAGG + Intronic
1097485723 12:60196709-60196731 AGAGAGAGAGCAAGTGATTAGGG + Intergenic
1097987442 12:65798838-65798860 AGAGAGAGAGAAAAAGAGGAAGG + Intergenic
1098009381 12:66034154-66034176 AGGGAGAGGGAAGAGGAGGAAGG + Intergenic
1098451115 12:70618979-70619001 AGAGAGAGAGAAAAGGAGAACGG + Intronic
1098490880 12:71076272-71076294 AGAGAGAGGGCAAAGGGAGGAGG + Intronic
1098725280 12:73956956-73956978 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1099226276 12:79973171-79973193 AGAGAGAGGGAAAGAGAGGGAGG + Intergenic
1099830256 12:87833121-87833143 AGAGACAGAGCAAAGGGGGAAGG - Intergenic
1099951368 12:89308126-89308148 AGAGTGAGGAGAAATGAGGCTGG + Intergenic
1100042468 12:90336977-90336999 AGGAAGAGAGGAAATGAGGAAGG - Intergenic
1100138555 12:91586552-91586574 AGCGACAGGGAAGATGAGGAAGG - Intergenic
1100337948 12:93650186-93650208 AGAGAGAGAGAAAAGGAGCAGGG - Intergenic
1100375632 12:94013731-94013753 AGAGAGAGGGGAAGGAAGGAAGG + Intergenic
1100662445 12:96714837-96714859 AGAAAGAGGGAAAATAATGATGG + Intronic
1100825713 12:98472493-98472515 AGAGAGAGAGAAAGAGAGGAGGG + Intergenic
1101142570 12:101811606-101811628 AGGAAGAGAGCAAAGGAGGAGGG + Intronic
1101199450 12:102419461-102419483 AGAGAGAGACCACTTGAGGATGG + Intronic
1101397708 12:104363144-104363166 GGAGAGAGGGCAACTGAAGATGG - Intergenic
1101502503 12:105317098-105317120 AGAGAGAGAGGAAAGAAGGAAGG + Intronic
1101551030 12:105762348-105762370 AGTGACAGGGGAAATGATGAGGG - Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101851535 12:108406948-108406970 AGAGAGAGAGAGAATGAGGCAGG + Intergenic
1101987682 12:109460561-109460583 GCAGAGAGGGAAAATGAGGAAGG + Intronic
1102016901 12:109654216-109654238 AGAGAGGGGAGGAATGAGGAGGG - Intergenic
1102094655 12:110227751-110227773 AGAGAGAGAGAAAAAAAGGAAGG + Intergenic
1102240002 12:111319303-111319325 AAAGGGAAGGGAAATGAGGAAGG + Intronic
1102631819 12:114287575-114287597 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1103279254 12:119741715-119741737 AAAGAGAGGGCACATGAATAAGG + Intronic
1103551665 12:121742374-121742396 AGAGGGAGAGCAAAAGGGGATGG - Intronic
1103596473 12:122027145-122027167 AGAGTGAGGGCATCTGAGGGGGG + Intronic
1103697297 12:122826240-122826262 AGAGGGAGGGGAGAGGAGGAGGG - Intronic
1103791667 12:123476566-123476588 ACAGAGATGGCATGTGAGGAAGG + Intronic
1103962349 12:124617072-124617094 AACGAGAGGGCAGATGTGGAGGG - Intergenic
1104332492 12:127860227-127860249 AGAGGAAGGGGAGATGAGGAAGG + Intergenic
1104415335 12:128593067-128593089 AGAGAGAAGGAAGATGAGAAAGG - Intronic
1104415338 12:128593110-128593132 AGAGAGAGAGGAAAGGAAGATGG - Intronic
1104415356 12:128593284-128593306 AGAGAGAGGGAAAAGGAAAATGG - Intronic
1104435316 12:128751436-128751458 TGGGAGAGGGGAAATGGGGAAGG + Intergenic
1104439777 12:128785327-128785349 AGGCAGTGGGCAAATCAGGAGGG + Intergenic
1104536308 12:129621242-129621264 GGAGAGAGGGACAATCAGGAAGG - Intronic
1104652041 12:130542152-130542174 AGAGAGAGGGGAAAGGATGCTGG + Intronic
1104654045 12:130559983-130560005 ACAGAGAGGGAAACTGAGAATGG + Intronic
1104854105 12:131894295-131894317 GGAGAGAGGGGAAAGGAGGGAGG + Intergenic
1105038535 12:132943836-132943858 AGGGCGAGGGAAAATGAGGCTGG + Intronic
1105273980 13:18904210-18904232 CGGGAGAGGGGAAAAGAGGATGG - Intergenic
1105308567 13:19186455-19186477 AGAGAGAGAGAAAAGAAGGAAGG - Intronic
1105999322 13:25705134-25705156 AGAAAAAGGGAAAATGAGAAAGG - Intronic
1106307729 13:28528223-28528245 ATAGAGCGGGGAAATGGGGAGGG + Intergenic
1106488740 13:30196094-30196116 AGAGAGAGGGCAGATGCCCAGGG + Intergenic
1106720518 13:32430330-32430352 AGAGAGAAGACAGCTGAGGAAGG + Intergenic
1106878985 13:34108361-34108383 GGATAGAGAGCAAAGGAGGAAGG + Intergenic
1107118763 13:36775970-36775992 AGAGAGAGAGCATATGAAGGAGG + Intergenic
1107221306 13:37984492-37984514 AGATCGAGAGCAAATGGGGAGGG + Intergenic
1107822370 13:44297285-44297307 AGAGAGGAGGGAAATGGGGAAGG + Intergenic
1108048014 13:46401673-46401695 TGAGAGAGAGAAAAAGAGGAAGG - Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108271453 13:48764051-48764073 AGAGAGGGAGAAAAGGAGGAAGG - Intergenic
1108436576 13:50406779-50406801 AGAGAGGGGGGAAAGAAGGAGGG - Intronic
1108440336 13:50446750-50446772 AGAGTGGGGGGAAATGGGGAAGG - Intronic
1108462683 13:50682898-50682920 AGGGAGAGGGGAAGTGAGGTGGG - Intronic
1108910846 13:55549973-55549995 AGAGAGAGAGATAGTGAGGAGGG - Intergenic
1109230025 13:59745202-59745224 AAAGAGAAGGCAAAAGAGAAGGG + Intronic
1109688209 13:65848360-65848382 AGAGAGAGAGAAAGAGAGGAAGG + Intergenic
1110018526 13:70439727-70439749 AGAGAGAGAGGAAAGAAGGAAGG - Intergenic
1110130512 13:72003060-72003082 AGAGAGAGAGGAAGGGAGGAAGG - Intergenic
1110211691 13:72980915-72980937 AAAGATAGGACAATTGAGGAAGG + Intronic
1110400460 13:75084163-75084185 AGAGAGAGAGCGAAGGAGGGAGG + Intergenic
1110657213 13:78014360-78014382 ACAGAGAGGTCATATGAAGAGGG + Intergenic
1110784068 13:79502553-79502575 AGATAGAGGGAAAATCAGGAGGG + Intronic
1110837123 13:80095744-80095766 AGAGAGAGGGGAAATATAGAGGG - Intergenic
1111022157 13:82465238-82465260 AGAGAGAGGGCAAATATTAAAGG + Intergenic
1111246746 13:85550659-85550681 AGAGATGGGGCAAATGACAAAGG + Intergenic
1111355454 13:87095318-87095340 AGAGAGAGAAAAAATGAGGTTGG - Intergenic
1111962398 13:94825818-94825840 AGAGAGAATGCAGATGAGGCAGG - Intergenic
1112227065 13:97550231-97550253 AGAGAGAAAGAAAAGGAGGAAGG + Intergenic
1112314852 13:98351751-98351773 AGAGAGAGAGCAATTGGGGGTGG + Intronic
1112621559 13:101058739-101058761 TGAGACAGGGCTAATGAGGTTGG - Intronic
1112723327 13:102272191-102272213 TGAAAGAGGGAAAATGGGGAGGG - Intronic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1113261300 13:108566700-108566722 AGAGAGAAAGGAAAGGAGGAAGG + Intergenic
1113531927 13:111033464-111033486 GGAGAGAGGGAAGAGGAGGAGGG + Intergenic
1113566648 13:111323300-111323322 TGAAAGAGCGGAAATGAGGATGG + Intronic
1114066589 14:19064430-19064452 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1114095677 14:19335593-19335615 AGATAGAGGGGGAATGGGGAAGG + Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114407436 14:22469903-22469925 AGAGAGAGAGGAAGTGAGGGAGG + Intergenic
1114501014 14:23168676-23168698 TGCAAGAGGGAAAATGAGGATGG + Intronic
1114598545 14:23934993-23935015 TGAGAGGGGGCAAAAGAGAAAGG + Intergenic
1114767443 14:25390118-25390140 TGAGAGAAAGGAAATGAGGATGG + Intergenic
1115119199 14:29919975-29919997 AGAGAGAGAGAAAGAGAGGAAGG + Intronic
1116200051 14:41781709-41781731 AGAGAGAGAGGAAAGAAGGAAGG + Intronic
1116433750 14:44874558-44874580 AGAGAGAGGAAAAAGAAGGAAGG + Intergenic
1117556618 14:56892987-56893009 GGAGAGAGGGAAAATGGGTAGGG - Intergenic
1117965925 14:61206655-61206677 AGCAAGAGGGCAAATGAGATTGG + Intronic
1118089570 14:62458225-62458247 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1118137693 14:63046333-63046355 CGAGAGAGGGGGAGTGAGGAGGG + Intronic
1118333469 14:64832396-64832418 ACAGAGCAGGCAAAGGAGGAAGG - Intronic
1118401394 14:65383002-65383024 AGAGAAAGGGCAAAGCAGAAGGG - Intergenic
1118572459 14:67207328-67207350 AGAGAGAGAGCAAAAGAGAGAGG + Intronic
1118723843 14:68612844-68612866 AGGGAGAGGGGAAGGGAGGAAGG + Intronic
1118969489 14:70621350-70621372 AGAGTGTGGGCCAAGGAGGAAGG - Intergenic
1119055105 14:71411474-71411496 AGAGAGAAGACAACTGGGGAAGG - Intronic
1119084867 14:71730431-71730453 AGAGAGAGGGCAAATGAGGAAGG - Intronic
1119157290 14:72422809-72422831 AGAGGAAGGCCAAGTGAGGATGG + Intronic
1119768707 14:77206677-77206699 AGAATGAGGGCATTTGAGGAAGG + Intronic
1119980700 14:79077602-79077624 AGAGAGATCACAAATGAGTAAGG + Intronic
1120091527 14:80337700-80337722 AGAGAGAGGAAAAAGGAGGAAGG + Intronic
1120172046 14:81256008-81256030 AGAGAGAGGGTAAAGGAAGGGGG + Intergenic
1120281371 14:82442904-82442926 AGAGTGAGGGAAACTCAGGACGG - Intergenic
1121077081 14:91077763-91077785 AGAGAGAGAGAAAGAGAGGAAGG + Intronic
1121103144 14:91263983-91264005 GGAGAGAGGCGAAAGGAGGAGGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121287781 14:92749637-92749659 ACAGATAGGGCAACTGAGGGAGG + Intergenic
1121381970 14:93479607-93479629 AGAGAGAGAGGAAGGGAGGAAGG - Intronic
1121629674 14:95413133-95413155 AGAGAGAGAGAAAAAGAGAATGG - Intronic
1121726546 14:96156223-96156245 AGAGAGAGGGAGAAGAAGGAAGG + Intergenic
1121852544 14:97235626-97235648 AGAGTGAGGGAAAAACAGGAAGG - Intergenic
1121856242 14:97272735-97272757 AGAGAGAGAGAAAAGAAGGAAGG - Intergenic
1121915982 14:97837318-97837340 AGAGAGAAAGAAAAGGAGGAAGG + Intergenic
1121979328 14:98440717-98440739 AGACTGAGGGCAAAGGAGGATGG + Intergenic
1122140725 14:99661408-99661430 AGAGAGAGAGAAAAGAAGGAAGG + Intronic
1122236787 14:100335266-100335288 AGTGAAAGGGCCAATGGGGAGGG + Intronic
1122366391 14:101197307-101197329 AGTGGGAGGGCCAGTGAGGATGG - Intergenic
1122777715 14:104129489-104129511 AGAGAGAAGGAAAAAAAGGAAGG - Intergenic
1123140407 14:106072142-106072164 AGAGAGAGAGCAAGTGAGCGGGG - Intergenic
1123899167 15:24859007-24859029 GGAGAGAGGGGAAAAGGGGAAGG - Intronic
1124226590 15:27900431-27900453 AGAGAGAGAGAAATTCAGGACGG - Intronic
1124390483 15:29251177-29251199 AGGCAGAGGGCAACTGTGGAGGG + Intronic
1124470367 15:29978897-29978919 AGAGAGAGAGGAAAGGGGGAGGG + Intergenic
1124803682 15:32860133-32860155 AGAGAGAAAGAAAAAGAGGAAGG + Intronic
1125330285 15:38575312-38575334 AGGGAGAGGGAAAAGGAGGGAGG + Intergenic
1126084303 15:44997246-44997268 AGAGAGAGAGGAAGGGAGGAAGG - Intergenic
1126333478 15:47559803-47559825 AAAGATAGGACAAATGAGAATGG + Intronic
1126475838 15:49064104-49064126 AGAGAGTGGCAAAATGGGGAAGG - Intergenic
1126811565 15:52411087-52411109 AGAAAGAGAACAAACGAGGATGG + Intronic
1127007028 15:54582085-54582107 AGAGAGGGAGGGAATGAGGACGG + Intronic
1127164237 15:56227837-56227859 AGAGAGAAGGAAAATGATAAAGG - Intronic
1127553109 15:60060589-60060611 GGAAAGAGGACAAATGAGAAAGG + Intronic
1127618883 15:60714029-60714051 AGAGAGAGAGATAATGAAGAAGG - Intronic
1127691117 15:61398660-61398682 AGGGAGAGGGGAAAGGTGGAGGG + Intergenic
1128206704 15:65859034-65859056 AGAGAGAGAGAAAAGAAGGAAGG - Intronic
1128369031 15:67025856-67025878 AGAGAGAGGGCAAGCGGGAAGGG + Intergenic
1128492013 15:68156738-68156760 AGAGAGAGCGCCAAGAAGGAGGG + Intronic
1129089621 15:73135359-73135381 GGAGAGAGAGGAAAAGAGGAAGG - Intronic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129363680 15:75041246-75041268 AGTAAGATGGCAAATGAGCAGGG - Intronic
1129602825 15:77010120-77010142 ACAGTGAGGGCAAGTGAGGAAGG - Intronic
1129728515 15:77916273-77916295 ATAGACAGAGCAAATGAGGCAGG + Intergenic
1129782221 15:78280017-78280039 AGAGAAAGGGTCAATTAGGAAGG - Intronic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1129953774 15:79614824-79614846 AGAGAGAAGGCGGCTGAGGATGG + Intergenic
1129974748 15:79812823-79812845 GGAGGGAGGGGAAATGAGGCTGG + Intergenic
1129978594 15:79845928-79845950 AATGGGAGGGGAAATGAGGAGGG - Intronic
1130012120 15:80160100-80160122 AGAGAGAGGGCCAATGGGCCTGG - Intronic
1130028221 15:80288334-80288356 AGAGAGAGAGAGAAAGAGGAGGG + Intergenic
1131159023 15:90092398-90092420 AGAGAGAGAGAAAGGGAGGAAGG - Intronic
1131666165 15:94573122-94573144 AGAGATAAGGAAAGTGAGGAAGG - Intergenic
1131680791 15:94720840-94720862 TTAGAGAAGGCATATGAGGAAGG - Intergenic
1131685935 15:94767574-94767596 AGAGAGAGAGAAAGAGAGGAAGG + Intergenic
1131842831 15:96455790-96455812 AGAGAGAGAGCAAATGACTTGGG - Intergenic
1132185695 15:99800256-99800278 TGAGAGTGGGCAAAGAAGGAAGG + Intergenic
1132405569 15:101540321-101540343 TGATGGAGGGCAAAGGAGGATGG - Intergenic
1132429984 15:101752442-101752464 TGAGAGTGGGCAAAGAAGGAAGG - Intergenic
1133011874 16:2917775-2917797 AGAGGGAGGCCAAAGGAAGAGGG - Intronic
1133261055 16:4550467-4550489 GGAGAGGGGGCCAAGGAGGAAGG - Intergenic
1133347023 16:5078027-5078049 GGAGAGAAGGCAGCTGAGGATGG - Intronic
1133392585 16:5422179-5422201 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1133567579 16:7009165-7009187 AGAGAAAGAGCAAGAGAGGAAGG - Intronic
1133654558 16:7847891-7847913 ACTGGGAGGGAAAATGAGGATGG + Intergenic
1133722701 16:8509738-8509760 AGAGAGAGGGGAGAGCAGGAGGG - Intergenic
1133819537 16:9224283-9224305 AGAGAGAGGGGAAAGGGGAAGGG - Intergenic
1134232311 16:12438416-12438438 AGTGAGCGGGTAAATGAAGAAGG - Intronic
1134818627 16:17227443-17227465 AGGCAGAGGGCAGATGAGGAAGG + Intronic
1135027513 16:19010110-19010132 GGAGAGAGGGGAAAGGGGGAAGG - Intronic
1135464643 16:22674949-22674971 AGAGAGAGGGAAAAGCAGAAGGG + Intergenic
1135706865 16:24682679-24682701 AGAGAGAGGGCCACCGAGGTGGG + Intergenic
1135865851 16:26101188-26101210 AGATGGAGGGCAAAGGAGTAGGG - Intronic
1136099553 16:27983697-27983719 TGAGATAGGGTAACTGAGGAGGG - Intronic
1136334601 16:29603201-29603223 GGTGAGGGGGCAAGTGAGGAGGG - Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1137545086 16:49397171-49397193 GGACAGAGAGCAAATGAGAAGGG - Intronic
1137559504 16:49493600-49493622 GAAGAGAGGGGACATGAGGAAGG + Intronic
1137600690 16:49754190-49754212 AGAGAGAGGGCAGGTTAGGTGGG - Intronic
1137687049 16:50393452-50393474 TGTGGGAGGGCACATGAGGAGGG + Intergenic
1137756471 16:50906350-50906372 ACAGAGAGGGGAACTGAGGCTGG - Intergenic
1138051652 16:53784906-53784928 AGAGTGGGGGAAAGTGAGGAGGG + Intronic
1138119099 16:54383915-54383937 AGAGAGAGAGAAAAAGGGGAAGG - Intergenic
1138487097 16:57352781-57352803 AGGGAGAGGGGTAATGGGGAGGG + Intergenic
1138579284 16:57929644-57929666 AAAGAAAGAGCAAATGCGGAGGG + Intronic
1138742304 16:59325010-59325032 AGAGAGAGAGAAAATGACTATGG + Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139246752 16:65452274-65452296 AGAGAGAGAGAAAAAGAGGGAGG + Intergenic
1139421575 16:66852499-66852521 AGAGAGAGGGGAAGGAAGGAAGG + Intronic
1139485897 16:67256432-67256454 AGAGACATGGCAAGTGGGGAAGG - Intronic
1139586706 16:67908602-67908624 AGAGGGAGGGCTGAGGAGGATGG + Intronic
1140985908 16:80157772-80157794 AGAGAGAAGCCACGTGAGGAGGG - Intergenic
1141186470 16:81791109-81791131 AGAGAGAGGGAGGAGGAGGATGG + Intronic
1141362248 16:83406448-83406470 AGAGAGAGAGAAAAAGAGAAAGG - Intronic
1141377532 16:83545741-83545763 AAAGGGTGGGCAGATGAGGAGGG - Intronic
1141379108 16:83559583-83559605 AGAGAGAGAGAAAAGAAGGAAGG + Intronic
1141382598 16:83589349-83589371 AGGGAGAGGGCAAGGGAGGGAGG - Intronic
1141499221 16:84432038-84432060 AGAGAGATGGCAAACCTGGATGG + Intronic
1141822518 16:86456800-86456822 AGAGAGAGAGGAAAGAAGGAAGG - Intergenic
1142254479 16:89007091-89007113 AGCGAGAGGGCAAAGGAGGGAGG - Intergenic
1142953453 17:3503957-3503979 GGAGGGAGGGCAGATCAGGAAGG - Intronic
1143376161 17:6468909-6468931 GGAGAGGGGGCAGGTGAGGAAGG - Intronic
1143478531 17:7216341-7216363 GGAGAGAGGGGATTTGAGGAGGG - Intronic
1143830813 17:9648980-9649002 AGAGAGAGGGAAAGGAAGGAAGG - Intronic
1144040286 17:11404521-11404543 AGTGAGAGGGCAAATGGGGGTGG - Intronic
1144995536 17:19265633-19265655 AGAGAGAGAGCAGAGGAAGATGG - Intronic
1145026358 17:19470774-19470796 TGAGAGATGGAAAATGAGGCAGG - Intergenic
1145276857 17:21436785-21436807 TGAGAGATGGAAGATGAGGAAGG - Intergenic
1145314691 17:21722678-21722700 TGAGAGATGGAAGATGAGGAAGG - Intergenic
1145713139 17:26994615-26994637 TGAGAGATGGAAGATGAGGAAGG - Intergenic
1146475202 17:33157136-33157158 AGGGAGAGGGACACTGAGGAGGG - Intronic
1146534394 17:33637661-33637683 AGAAAGAAAGCAAATAAGGAAGG + Intronic
1146826863 17:36030670-36030692 AGAGAGAGGGGAAAGGGGAAGGG - Intergenic
1147381746 17:40060375-40060397 AGAGAGAGGTAAAAAGAAGATGG + Intronic
1147457307 17:40545898-40545920 AGAGAGAGGGCAAGAAAGAACGG - Intergenic
1147761736 17:42802253-42802275 AGAGAGAGGTTAAAAGGGGAGGG + Intronic
1147785766 17:42977642-42977664 AGAGAGAGGGGGAGGGAGGAAGG + Intronic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148467552 17:47873955-47873977 AGAAAGAGAGGAAAGGAGGAGGG - Intergenic
1148579491 17:48733955-48733977 AGAGAGAGGAAAAAAAAGGAAGG - Intergenic
1148618023 17:49014539-49014561 ACAGAGAGGGCACTTGAGGGGGG + Intronic
1148809966 17:50284039-50284061 TGAGAGAGGGCGGAGGAGGAGGG - Intergenic
1148864060 17:50619464-50619486 AGAGGGAAGGCGAAGGAGGAAGG - Intronic
1148893431 17:50824485-50824507 AGAGAGAAGGCCAATAAGGCTGG + Intergenic
1149538977 17:57454397-57454419 AGAGAGAGAGGAAAGAAGGAAGG - Intronic
1150278127 17:63912911-63912933 AGAGAGAGAGACAAAGAGGAAGG - Intronic
1150296810 17:64014458-64014480 AGAGAGAGGGGAAGGAAGGAAGG + Intronic
1150465187 17:65386637-65386659 AGGGAGAGAGAAAAAGAGGAAGG - Intergenic
1150824359 17:68461705-68461727 TGAGAAAGGGTAAAGGAGGAAGG + Intergenic
1150954544 17:69842810-69842832 AGGAAGAGGGCTTATGAGGATGG + Intergenic
1151065704 17:71147415-71147437 AGAGAGAGGGAAGAGGAGAAAGG - Intergenic
1151529650 17:74696123-74696145 TGAGAGATGGAAAATGAGGAAGG + Intronic
1151807536 17:76415433-76415455 CCAGACAGGTCAAATGAGGAAGG - Intronic
1152003239 17:77660452-77660474 AGAGAGAGAGGAAGGGAGGAAGG - Intergenic
1152099457 17:78292520-78292542 ATGGAGAGGGCAGATGAGGAGGG - Intergenic
1152140652 17:78534537-78534559 AGAAAGAGGGGCCATGAGGAGGG - Intronic
1152226427 17:79094906-79094928 AGAGAGAGGGTCAACGAGGAGGG + Intronic
1152486155 17:80594993-80595015 AGAGAGAGGGAGAAAGAGAATGG + Intronic
1152667919 17:81582014-81582036 TCAGAGAGGGAACATGAGGAGGG + Intronic
1152690277 17:81714868-81714890 AGAGAGGGGGAAACTGAGGCAGG - Intronic
1152917360 17:83048011-83048033 AGAGAGAGAGAAAGAGAGGAAGG - Intronic
1153086181 18:1290691-1290713 AGAGAGAGGACAAAAGAAGGGGG - Intergenic
1153521910 18:5961874-5961896 AGAGACAGGGCAACTGGGGCAGG + Intronic
1153647390 18:7207406-7207428 AGGGAGATGGTAGATGAGGAAGG + Intergenic
1153966256 18:10184926-10184948 AGAGAGAGAGCAAGAGAGAAGGG - Intergenic
1154013409 18:10594891-10594913 AGAGAGAGAGGAAGGGAGGAAGG + Intergenic
1154152582 18:11918154-11918176 AGAGAGAGAGGAAGGGAGGAAGG + Intergenic
1155353466 18:24928816-24928838 AGAGAGAGAGCAAGTGAGTGAGG - Intergenic
1155494614 18:26430432-26430454 AGAGGGATGGGAAATGGGGATGG - Intergenic
1155540107 18:26861077-26861099 AGAGTGAGGATAAATGAGGTGGG + Intronic
1155750975 18:29422062-29422084 AGAGCCAGGTCATATGAGGAGGG - Intergenic
1155865235 18:30956620-30956642 AGAAAGAGAGAAAAAGAGGAAGG + Intergenic
1155904201 18:31429608-31429630 AGTGAAAAGGCAAAGGAGGAAGG + Intergenic
1155958259 18:31972340-31972362 AGAGAGGGGGAAAATGGAGAGGG - Intergenic
1156076800 18:33288405-33288427 AGAGAGAGGGAAGAAAAGGAAGG - Intronic
1156076811 18:33288446-33288468 AGAGAGAGGGAAGAAAAGGAAGG - Intronic
1156312459 18:35937303-35937325 AGAGAGATGAAAAAGGAGGAGGG + Intergenic
1156356250 18:36343622-36343644 AGAGAGGAGGCAAAGGAGGTGGG - Intronic
1156376321 18:36518479-36518501 GGAGAGACATCAAATGAGGAAGG - Intronic
1156650556 18:39221430-39221452 AGAGAAAGAGCAAATGAGAAGGG - Intergenic
1156681465 18:39594106-39594128 AGAAAGAAAGCAAATTAGGAAGG - Intergenic
1156897880 18:42267087-42267109 AGTGTGAGGGTCAATGAGGAAGG - Intergenic
1156949862 18:42882246-42882268 AGACAGATGTCATATGAGGAAGG - Intronic
1157002917 18:43549044-43549066 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1157079961 18:44513371-44513393 AGAGAGAGAGAAAAAGAGAAAGG + Intergenic
1157102448 18:44743064-44743086 AGAGAGAGAGAAAGGGAGGAAGG - Intronic
1157283358 18:46360554-46360576 AGAGAGAGGGAAAGTCTGGAAGG - Intronic
1157453217 18:47803367-47803389 AGTTAGAGTGAAAATGAGGAAGG - Intergenic
1157512212 18:48284442-48284464 AGAGAGAGGGAAAGGGAGGGAGG + Intronic
1157612719 18:48968449-48968471 AGGGAGGGAGGAAATGAGGAAGG + Intergenic
1157890474 18:51411255-51411277 AGAGAGAAGGCCAATGGGGCTGG + Intergenic
1158063701 18:53379249-53379271 ACAGAGAGGGCAAAAGATGCAGG + Intronic
1158265764 18:55659331-55659353 AGGGAAAGGGGAAATGAGGGAGG - Intronic
1158312233 18:56171102-56171124 AGAGTGAGGCCAAGTGAGGCTGG - Intergenic
1158643331 18:59221040-59221062 AGAGGGAGGGCAAAAGGGCAGGG - Intronic
1158643924 18:59227074-59227096 AGAGAGAGAGCAAGAGAGAAAGG - Intronic
1158748784 18:60234144-60234166 AGAGAGGGGGAATATGATGAAGG - Intergenic
1158930784 18:62324101-62324123 AGACAAGGGGGAAATGAGGACGG + Intergenic
1159077599 18:63699538-63699560 AGAGAGAGAGCGAAGCAGGAAGG + Intronic
1159102254 18:63970254-63970276 TGAGAGAGGGGAAGGGAGGAAGG + Intronic
1159238786 18:65713225-65713247 AAAGAGAGGGGAAGGGAGGAAGG - Intergenic
1159414595 18:68127429-68127451 AGAGAGAGAGGAAAGAAGGAAGG + Intergenic
1159541485 18:69782885-69782907 ACAGAGAGGGAAAAAGAGGATGG - Intronic
1159804102 18:72934501-72934523 GGAGAGAGAGCAAAGGAGGGAGG - Intergenic
1160037567 18:75315904-75315926 AGAGAGAGCGAGAAAGAGGAAGG - Intergenic
1160038382 18:75321821-75321843 ACAGAGAGGGCCAATGAGTCCGG + Intergenic
1160192357 18:76724429-76724451 AGAGAAAGGACAAATGACTAGGG + Intergenic
1160367083 18:78335530-78335552 GGAGAGAGGGAGAAGGAGGAGGG + Intergenic
1160371595 18:78376737-78376759 GAAGAGAAGGCACATGAGGAAGG - Intergenic
1160573155 18:79832170-79832192 TGAGAAAGGGCAGGTGAGGATGG - Intergenic
1160621513 18:80174336-80174358 ACAGAGAGGGGAACTGAGGCTGG + Intronic
1161094218 19:2379713-2379735 AGAGAAAGAGAAAAAGAGGAAGG - Intergenic
1161159975 19:2756545-2756567 AAAGAGAGTGTATATGAGGAGGG + Intronic
1161477684 19:4495564-4495586 GGAGAGAGGGAAAAGGAGGGCGG + Intronic
1161845571 19:6710100-6710122 AGAGAGAGGGAGAGTGAGGGGGG + Intronic
1162098137 19:8322925-8322947 GGAGAGAGGGGAAAAGAGGGGGG + Exonic
1162210261 19:9085774-9085796 AGAGAGAGGTCAAAGTAGGTAGG + Intergenic
1162226309 19:9225512-9225534 AAGGAGAGGGGAATTGAGGATGG + Intergenic
1162790242 19:13058998-13059020 TGAGAGGAGGCAAATGAGGATGG - Intronic
1162849584 19:13420507-13420529 AGAAAAAAGGCAAATGAAGATGG + Intronic
1162904557 19:13816041-13816063 AGAGAGAGGGGAAGGAAGGAAGG + Intronic
1162983811 19:14256457-14256479 AGAGAGAGAGGAAGTGAGGAAGG - Intergenic
1164434337 19:28216348-28216370 AGAGAGAGGGAAAGAGAGGCTGG - Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164730764 19:30502497-30502519 AGAGAGAGGGCAGCTGTGGCTGG + Intronic
1164917716 19:32065548-32065570 AGAGAGAGACCACATGAGGCAGG + Intergenic
1165072422 19:33263302-33263324 AGAGAGAGAGAAAATGAAAATGG - Intergenic
1165205523 19:34181983-34182005 AGAGAGAGAGGAATTAAGGATGG - Intronic
1165327588 19:35123218-35123240 AGGGAGAGGGCAAATGGGGGCGG + Intronic
1165364850 19:35359141-35359163 AGAGAGTGGGCAGAGGATGAAGG - Exonic
1165366669 19:35371610-35371632 AGAGAGTGGGCAGAGGATGAAGG - Exonic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165831638 19:38733521-38733543 TGAAAGAGGCCAAATAAGGAAGG - Intronic
1165923558 19:39313786-39313808 GGAGACAGGGCAAAGGAGGGCGG + Intronic
1166032757 19:40145451-40145473 AGAGAGAGAGAAAGAGAGGAAGG + Intergenic
1166253080 19:41584776-41584798 AGTGAGAGGGCATCTGAGGGGGG + Intronic
1166556423 19:43703082-43703104 AGAGAAAGAGCAAAGGAGGGAGG - Intergenic
1166728995 19:45047435-45047457 AGAGAGAGAGGAAGGGAGGAAGG + Intronic
1166823975 19:45598065-45598087 AGAGAGAGGGCAGAGGAGAGGGG - Intronic
1166986598 19:46663797-46663819 AAAGAGAATGCAAATGAGGCCGG + Intergenic
1167014832 19:46834263-46834285 AGAGAGACAGAAAATGATGACGG - Intergenic
1167058659 19:47129763-47129785 AGAGAGAGGGAAAGGAAGGAAGG - Intronic
1167204771 19:48093613-48093635 AGAGAGAGGGCTAGAGAGGTAGG - Intronic
1167231293 19:48285530-48285552 AGAGAGAGAGGAAAGAAGGAAGG + Intronic
1167294060 19:48639219-48639241 AGAGGGAGGGCAGGTGAGCAAGG + Intronic
1167497366 19:49827500-49827522 AGGGAGAGGCCATGTGAGGACGG - Intronic
1167814388 19:51866983-51867005 AGAGAGAGAGAAAAGGAAGAAGG + Intronic
1167873450 19:52392281-52392303 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1168158295 19:54490992-54491014 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
1168508907 19:56959042-56959064 AGAGAGAGAGGAAGAGAGGAAGG + Intergenic
1168659690 19:58155892-58155914 AGAGAGAGAGGAAGGGAGGAAGG + Intergenic
1202697076 1_KI270712v1_random:133030-133052 AGAGAGAGAGGAAAGAAGGAAGG - Intergenic
924975249 2:167428-167450 AGACAGAGTGAAAATGAGGTTGG - Intergenic
925339470 2:3126128-3126150 AGGGAGGGGGCAGACGAGGAAGG + Intergenic
925355519 2:3238493-3238515 AGAGAGAAGGAATGTGAGGAAGG - Intronic
925485738 2:4328335-4328357 AGAGAGAGGAGAAATGAGCCAGG + Intergenic
925524941 2:4788959-4788981 AGAGAGAGAGAGAGTGAGGAGGG + Intergenic
925531592 2:4868992-4869014 AGAGAGAGAGAAAAAGAGAACGG + Intergenic
925549607 2:5057834-5057856 AGACAGAAGCTAAATGAGGAAGG - Intergenic
925590078 2:5500787-5500809 AGAGAGAAGGGAGAGGAGGAAGG + Intergenic
925654162 2:6126869-6126891 AGAGAGATAGGAAATGAGGTTGG + Intergenic
925755553 2:7128380-7128402 GGAGAGGGGGGAAAGGAGGAAGG - Intergenic
925853346 2:8105650-8105672 AAAGAGAGGGAAAAGGAGGAAGG - Intergenic
926069787 2:9877832-9877854 AGAGAGAGGAGAAAAGAGGGAGG - Intronic
926108857 2:10169590-10169612 AGAGGGAGGGCATTTGAAGACGG + Intronic
926121489 2:10243468-10243490 AGAGGGAGGCCACATCAGGAGGG + Intergenic
926143174 2:10380644-10380666 AGAGAAAGAGAAAATGGGGAGGG - Intronic
926291947 2:11538709-11538731 AGAGAGAGGGGGAGGGAGGAAGG - Intronic
926391388 2:12397081-12397103 AGAGACAGGGCAAGGAAGGAAGG + Intergenic
926585428 2:14680621-14680643 AGAGAGAAGGCAAATGCATAAGG + Intergenic
926631549 2:15141156-15141178 AGAGAGGGGGAAAAAGAGAAGGG - Intergenic
926737633 2:16085795-16085817 TGAGACAGAGCAAATGGGGAAGG - Intergenic
926824066 2:16884740-16884762 AGAGAGAGAGGAAGGGAGGATGG - Intergenic
926952298 2:18255274-18255296 AGAGAGAAGTGAGATGAGGAAGG - Intronic
926997911 2:18758270-18758292 TGAGAGAGGGCACAGCAGGATGG + Intergenic
927017605 2:18981593-18981615 AAAGAGAGGGCAAATCAGTAGGG + Intergenic
927247367 2:20968370-20968392 AGATAAAGGGCAAGGGAGGAGGG - Intergenic
927329990 2:21851372-21851394 AGAGAGTGGAAAATTGAGGAAGG + Intergenic
927451377 2:23212339-23212361 ATAGAGAGGGCAGGTGTGGAAGG - Intergenic
927469866 2:23365221-23365243 AGAGAGAGAGGAAAGAAGGAAGG + Intergenic
927499915 2:23575769-23575791 AGAGAGAGGGGAAAAGATGCAGG + Intronic
927641715 2:24849738-24849760 TGACAGAGGGGAAAGGAGGAGGG + Intronic
927862851 2:26570925-26570947 AGGGAGAGGTCAGATGTGGAGGG + Intronic
927947811 2:27147887-27147909 AGAGAAAGGGAAAAAGAGGCCGG - Intergenic
927975606 2:27336033-27336055 AGAGAGAGAGCATGTGGGGATGG + Intronic
928228492 2:29475898-29475920 AGACAGGCGGCAAATGAGAACGG + Intronic
928277509 2:29916529-29916551 GCAGAGAGAGCAAAGGAGGATGG - Intronic
929049222 2:37820903-37820925 AGAGAGAGAGAAAAAGGGGAGGG - Intergenic
929274013 2:40005945-40005967 AGAGAGAGAGCTAAGGGGGAAGG + Intergenic
929297198 2:40261805-40261827 AGAGAAAGAGAAAATGATGATGG + Intronic
929742059 2:44612856-44612878 AGTGAGAGAGAAAAAGAGGAAGG - Intronic
930021702 2:47005582-47005604 AGAGAGAGGAACATTGAGGAAGG + Intronic
930030618 2:47056197-47056219 GGGGAGAGGGCAAGGGAGGAAGG - Intronic
930189484 2:48442787-48442809 AGAGAGTGGTGAAATGAGGTAGG + Intronic
930270572 2:49251571-49251593 AGAGAGAAGGGAAAAGAGAAGGG - Intergenic
930355032 2:50307334-50307356 AGAGACATGTCAAATTAGGAAGG + Intronic
930919827 2:56739314-56739336 AGAAAGAGGGCATAAGGGGAGGG - Intergenic
930946217 2:57079230-57079252 AGAGAGAGAGAAAAGGGGGAGGG - Intergenic
931243674 2:60475621-60475643 AGAAAGAGGGGAAATTTGGAGGG - Intronic
931774109 2:65525048-65525070 AGAGAGAGGGGAAATGGGTGTGG + Intergenic
931928841 2:67106155-67106177 TGAGAGAAGGCATATGGGGAAGG - Intergenic
932015343 2:68020778-68020800 AGACAGAGAGAAACTGAGGAAGG - Intergenic
932448306 2:71794044-71794066 AGAGAGAGGGAAAAAAAGCAAGG + Intergenic
932857039 2:75245822-75245844 AAAGAGAGGGAAAACGAGGAGGG - Intergenic
932875889 2:75451442-75451464 AGAGAGAGAGCAAGTGAGGGAGG + Intergenic
932888163 2:75565964-75565986 AGAGAGAGAGAAAAAGAGAAAGG - Intronic
932930693 2:76034467-76034489 AGAGAGAGGGAAAAAGAGCGAGG + Intergenic
933058421 2:77703648-77703670 AGAGATATGGCACATGATGAAGG - Intergenic
933260049 2:80122358-80122380 GGAGAGAGAGCAAAAAAGGAAGG - Intronic
933363376 2:81316140-81316162 AGAGAGAGAGAAAAGGAGAAGGG - Intergenic
933780987 2:85801089-85801111 AGAGAGAGGGTAAAGGGGAAGGG - Intergenic
933885250 2:86713297-86713319 AGAGAGAAGGAAAATGATGTAGG + Intronic
933924924 2:87083386-87083408 AGAGAGAAGGAAAATGATGTAGG - Intergenic
934049975 2:88201635-88201657 AGAGAGAGAGAAAGAGAGGAAGG + Intergenic
934122448 2:88853392-88853414 AGAGGGAGGGAAAAAGAGAAGGG - Intergenic
934278237 2:91590044-91590066 AGAGAGAGAGGAAAGAAGGAAGG - Intergenic
935836579 2:107061769-107061791 AGAGGGAGGGAAAAGGTGGAAGG - Intergenic
935942271 2:108253038-108253060 AGAGAGAGAGAAAAAGAGAAAGG + Intronic
936514702 2:113174278-113174300 AGAGAAGGGTCAGATGAGGAGGG - Intronic
936522800 2:113222145-113222167 AGAGAGAGTGCCATTGTGGAAGG - Intronic
936593855 2:113829135-113829157 AGAGAGGGAGCAAGAGAGGAAGG + Intergenic
936613321 2:114023338-114023360 AGAGGGTGGGGAAAAGAGGAGGG - Intergenic
936791985 2:116162113-116162135 TGAGGGAAGGCTAATGAGGATGG - Intergenic
936972591 2:118189209-118189231 AGCTTCAGGGCAAATGAGGAAGG - Intergenic
937062797 2:118992772-118992794 AGAGAGAGGGAAAGGAAGGAGGG - Intronic
937817076 2:126262798-126262820 AGAAACAATGCAAATGAGGATGG + Intergenic
938164147 2:129011453-129011475 AGAGAGAGAGAGAATGAGGGAGG + Intergenic
938225475 2:129612241-129612263 AGAGAGAGAGAAATTGGGGATGG + Intergenic
938382763 2:130845934-130845956 AGCCAGAGGGCAGATGAGGAAGG + Intronic
938483980 2:131684558-131684580 AGATAGAGGGGGAATGGGGAAGG - Intergenic
938745397 2:134273258-134273280 AGAGAGAGGGCAGAAAAGCAAGG - Intronic
938770455 2:134496818-134496840 ATAGGGAGAGCAAAGGAGGAGGG - Intronic
939115657 2:138057386-138057408 AGAGAGAGGGGAAGGAAGGAAGG - Intergenic
939230012 2:139412415-139412437 AGAGAGAGGAGATATGATGATGG + Intergenic
939506054 2:143048453-143048475 AGAGAGAGAGAGAAAGAGGAGGG - Exonic
939835429 2:147124478-147124500 AGAGAGAGAGCAAAGGGGGAAGG - Intergenic
939925432 2:148168230-148168252 AGAGACAGGGCTATTGAAGAAGG - Intronic
940287801 2:152049602-152049624 GGAGAGAGAGAAAATGAGGAAGG - Intronic
940466219 2:154030746-154030768 GGAGAGAGGGCAAGTGAAGGTGG - Intronic
940642838 2:156365104-156365126 GGAGAGAGGGCAGAGGAGGAAGG + Intergenic
940897979 2:159099293-159099315 TGAGGGAGGGCAAAGAAGGAAGG - Intronic
941378123 2:164756060-164756082 AGAGAGAGAGAGAATGAGGGAGG + Intronic
941451520 2:165666022-165666044 AGAGAGAGAGGAAGGGAGGAAGG + Intronic
941652833 2:168112023-168112045 AGAGCGAGGACCAATTAGGATGG + Intronic
942067569 2:172285947-172285969 AGAGAGAGAGCAAGGAAGGAAGG - Intergenic
942393433 2:175520850-175520872 AGAGAGAAGGGAAAGGAGAAAGG - Intergenic
942491053 2:176490274-176490296 AGAGGGAGGGCCAAAGAGGACGG - Intergenic
943978996 2:194522827-194522849 AGAGAGACAGGAGATGAGGAAGG + Intergenic
944345789 2:198664251-198664273 ACAGAGAGAGAAAATGAGGGAGG - Intergenic
944371055 2:198984626-198984648 AGAGAGAGAGCAAGAGAGAAGGG + Intergenic
944407030 2:199396587-199396609 AGAGAGGAGCCAAGTGAGGATGG + Intronic
944512323 2:200476916-200476938 AGAGAGCTGGAAAATGGGGATGG + Intronic
944612495 2:201425762-201425784 AGAGAGAGAGAGAGTGAGGAGGG + Intronic
945101889 2:206269892-206269914 AGAGAGAAAGGAAAGGAGGAAGG - Intergenic
945420811 2:209633839-209633861 ACAATGAGGGCAAATGAAGAGGG + Intronic
945540708 2:211082517-211082539 AGAGAAAAGGGAGATGAGGAGGG + Intergenic
945544040 2:211126773-211126795 AGAGAGAGGAGAAAGGAGGAAGG - Intergenic
945649314 2:212538840-212538862 AGAGAGAGAGAAAGTGAGGAGGG - Exonic
945766054 2:213978999-213979021 AAAGAGAGGAGAAATAAGGACGG + Intronic
945766472 2:213985716-213985738 AGAGAGAGGGAATAAAAGGATGG + Intronic
945869854 2:215215293-215215315 AGGGAGAGGGAAAATCAGGGTGG + Intergenic
945941633 2:215957092-215957114 AGAGGGTGGGCAAGGGAGGAAGG + Intronic
946002327 2:216493049-216493071 AGAGAGAGAGCAAGAGAAGAGGG - Intergenic
946115904 2:217461928-217461950 AGAGAGAGGGCAAAGAGGAAGGG + Intronic
946490317 2:220143230-220143252 AGTGAGAAGGCAAAAGATGATGG - Intergenic
946519128 2:220446709-220446731 AGTGAAAGGGGAAGTGAGGAGGG - Intergenic
946554429 2:220839373-220839395 AGAAGGAGGGGAAATAAGGAAGG + Intergenic
946610980 2:221457714-221457736 AGGGAGGGAGCAAAGGAGGATGG + Intronic
946665260 2:222042788-222042810 AGAGAGAGGGGAAATCACTATGG - Intergenic
946895767 2:224321894-224321916 AGAGAGAGAGAAAAGAAGGAAGG + Intergenic
947091114 2:226512428-226512450 AGAGAGAGAGGAAGGGAGGAAGG - Intergenic
947394370 2:229672586-229672608 AGAGAGAGGAAAAAGGATGAGGG + Intronic
947398231 2:229707502-229707524 AGATCCAGGGCATATGAGGAGGG - Intronic
947696088 2:232190583-232190605 AGAGAGAGAGGAAGAGAGGAAGG + Intronic
947922025 2:233885366-233885388 AGAAAGAGGGAAAATAATGAAGG - Intergenic
948075157 2:235160269-235160291 AAACAGAAGGCAGATGAGGAGGG - Intergenic
948104937 2:235405920-235405942 AGAGAGAGAGGAAAGAAGGAAGG - Intergenic
948468899 2:238165046-238165068 AGTGGGAGGGCGACTGAGGAGGG - Intronic
948622099 2:239242202-239242224 AGAGAGAGGACGAGAGAGGAAGG + Intronic
948624242 2:239258754-239258776 AGAGACAGGACAAAGGAGTAAGG + Intronic
1169009420 20:2237954-2237976 AGAGAGGGGGGAAAGAAGGAAGG - Intergenic
1169276229 20:4235405-4235427 AGAGAGAAGGGAGAAGAGGAGGG - Intronic
1169636113 20:7693762-7693784 GGAGAGAAGGAAAAGGAGGAGGG - Intergenic
1169783245 20:9331452-9331474 AGAGAGAGGGCAAGAGAGAAAGG + Intronic
1170085240 20:12524310-12524332 AGATAGAGGGCAAAAAGGGAAGG - Intergenic
1170204553 20:13784581-13784603 AGAGAGCGGGCAGAAGGGGAGGG - Intronic
1170400134 20:15973254-15973276 AGAAAAAGAGGAAATGAGGAAGG + Intronic
1171069709 20:22056582-22056604 AGAGAGAGAGCAAAAAAAGAAGG - Intergenic
1171255366 20:23685990-23686012 AGAGAGAGGGCCAATCAGTGTGG + Intronic
1171262707 20:23747912-23747934 AGAGAGAGGGCCAATCAGTGTGG + Intronic
1171368083 20:24640362-24640384 AGAGAGAGAGGAAGGGAGGAAGG + Intronic
1171400469 20:24870021-24870043 AGAGTGACTGCTAATGAGGATGG - Intergenic
1171422419 20:25026087-25026109 AGAGGGAAGACAAATGAAGAGGG + Intronic
1172328620 20:34057806-34057828 ATATTGAGGCCAAATGAGGAGGG + Intronic
1173047982 20:39530961-39530983 AGAGAAAGAGGAAAGGAGGAAGG - Intergenic
1173427372 20:42954874-42954896 GGAGAGAAGGGAAAGGAGGAGGG + Intronic
1173443257 20:43096225-43096247 GGAGAGAGAGGAAAAGAGGAGGG - Intronic
1173563532 20:44022983-44023005 AGAGAGAGGGAAAGGGAGGTGGG + Intronic
1174151125 20:48487069-48487091 AGAGAGAGAGAAAAGAAGGAAGG + Intergenic
1174270141 20:49362400-49362422 AGAGAGAGGGGTAAGGAGAAAGG - Intergenic
1174398005 20:50259830-50259852 AGAGAGAGAGGAAAGGAGAAGGG - Intergenic
1174553371 20:51377389-51377411 AGAGGGAAGGCCCATGAGGAAGG + Intergenic
1174790100 20:53469884-53469906 AGAGAGAGAGGAAAGGAGGAAGG + Intronic
1175010358 20:55728577-55728599 AGAGAGGGAGCAAAAGAGAATGG + Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175502759 20:59461956-59461978 AGGGAGATGGCAAAGGAGAAGGG - Intergenic
1175588620 20:60168774-60168796 AGACAGAGGGCAGAGGAAGAAGG + Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176093577 20:63329554-63329576 AAAGGGAGGGCATGTGAGGACGG - Intronic
1177046902 21:16182558-16182580 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1177575733 21:22952810-22952832 AGAGAGAGAGAAAATAATGAGGG - Intergenic
1177589166 21:23139535-23139557 AGAAAGTGGGCAAATGTGAAAGG - Intergenic
1177641835 21:23853857-23853879 AGAGAGAGAGAAAATGAGAGAGG + Intergenic
1177797423 21:25793585-25793607 AGAGAGAGGGGAAGGGAGGGAGG - Intergenic
1177905486 21:26967233-26967255 TGGGGGAGGGCAAAAGAGGAGGG + Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178296922 21:31417925-31417947 AGAGAGAGAGAAATTGAAGATGG + Intronic
1178349414 21:31861689-31861711 AGACAGATGGCAAATGAGTGAGG + Intergenic
1178712876 21:34934949-34934971 AGAGAGAGGGAAAATGAATATGG - Intronic
1178882933 21:36462977-36462999 GGAGAGAGGGAAGAAGAGGAGGG + Intronic
1179008769 21:37537043-37537065 GGAGAGAGGGGAGAGGAGGAAGG + Intergenic
1179044093 21:37829695-37829717 AGAGGAGTGGCAAATGAGGAAGG + Intronic
1179188557 21:39104253-39104275 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1179375307 21:40845597-40845619 AGAGAGAGAGAAAGAGAGGAGGG - Intronic
1179389759 21:40977069-40977091 GGACAGAGGGCAATTGAGGGTGG - Intergenic
1180485070 22:15787020-15787042 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1180595063 22:16967685-16967707 AGGCAGAGGGCAGATGAGGCAGG - Intronic
1181139806 22:20796159-20796181 AGCGAGAGGGCAAGCGAGAAGGG - Exonic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181577174 22:23802435-23802457 AGACAGAAGGAAAAGGAGGAGGG - Intronic
1181777550 22:25170511-25170533 GGAGAGAGGGCCATTGAGGTGGG + Intronic
1182781478 22:32871930-32871952 AGAAAGATAGAAAATGAGGATGG - Intronic
1182961849 22:34482767-34482789 AAAGACAGTGTAAATGAGGAAGG + Intergenic
1183162945 22:36126904-36126926 AGAGAGAGAGAAAGAGAGGAAGG - Intergenic
1183259929 22:36788127-36788149 TGAGAGAGGGAGAAGGAGGAAGG + Intergenic
1183284306 22:36952778-36952800 AGACAGAGGACAGAGGAGGACGG - Intergenic
1183689731 22:39381939-39381961 AGAGAGGGGACAGATGGGGAGGG - Exonic
1183720725 22:39559999-39560021 AGAGAGAGGGTGAGAGAGGATGG - Intergenic
1183790682 22:40066203-40066225 TGAGACACGGCAAATGAAGAAGG - Intronic
1183836926 22:40461882-40461904 AGAGAAGGGGCAAGTGAAGATGG - Intronic
1183961117 22:41412571-41412593 AAAGACAGGGCAGACGAGGATGG - Intergenic
1184036001 22:41918465-41918487 AGACAGGGGGCAAATGAGCCTGG - Intergenic
1184087505 22:42274014-42274036 CGAGAGCTGGCAAGTGAGGAAGG - Intronic
1184328970 22:43813565-43813587 ATAAAGAAGGCAAATGGGGAGGG - Intergenic
1184458501 22:44624597-44624619 AGAGGGAGGCCACGTGAGGATGG + Intergenic
1184863838 22:47191849-47191871 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1184947259 22:47812382-47812404 AGAGAGAGGGAAAAAGTGCATGG + Intergenic
949614302 3:5737046-5737068 AGAGACAGAGCAAATGGAGAAGG + Intergenic
949647181 3:6109381-6109403 AGAGGGAGGGAGAAAGAGGAAGG - Intergenic
949988386 3:9557377-9557399 AAAGAGAGAGCAAGAGAGGAAGG + Intergenic
950418350 3:12882045-12882067 AGAGAGAGGACACATGAGCAAGG - Intergenic
950568308 3:13784695-13784717 AGAGGGAGAGGAAAAGAGGATGG - Intergenic
950962825 3:17123416-17123438 AGAGAGAGGACAGCTGGGGAGGG + Intergenic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951200328 3:19869288-19869310 AGAAAGTGGGGAAAGGAGGATGG + Intergenic
951388722 3:22075482-22075504 AGAGAGTGGGAAAGTGAAGAGGG - Intronic
951420142 3:22474228-22474250 AGAGAAAGGGAAAGTGAGAAGGG + Intergenic
951689958 3:25385083-25385105 AAAGAGAGGACAAGTGTGGAGGG - Intronic
951745241 3:25970998-25971020 AGAGAAAAGGAAAATGAAGAGGG - Intergenic
951851321 3:27144076-27144098 AGAAAGAGAGGAAAGGAGGAAGG - Intronic
951914908 3:27790347-27790369 ATAGGGAGGGGTAATGAGGAGGG + Intergenic
951931588 3:27973511-27973533 AGTGAGTGGGCAAACGAGGCGGG + Intergenic
951951279 3:28201978-28202000 AGTAAGAGGGAAAATGAAGAGGG - Intergenic
952014057 3:28936150-28936172 AGAGAGGGAGGAAAAGAGGAAGG - Intergenic
952621302 3:35346396-35346418 AGAGAGAGTGCAAGGGAAGAGGG + Intergenic
952786191 3:37157553-37157575 AGAGAGAGGGGAAAAGAGGAAGG + Intronic
952881979 3:37991109-37991131 AGAGTGAGGGGAAAGGAGGATGG - Intronic
953135471 3:40177920-40177942 AGAGAGAAGGAACGTGAGGAAGG - Intronic
953225302 3:41013498-41013520 ATAGAGTGGGGAAATGAGGCAGG + Intergenic
953380125 3:42464065-42464087 AGAGAGAGGACCAAGGAGAATGG - Intergenic
953382157 3:42480154-42480176 ATGGAGTGGGCAGATGAGGAGGG + Intergenic
953485148 3:43287199-43287221 AGAGAAAGGGCAAAGGGGTAAGG + Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
954146861 3:48638820-48638842 AGAGAGAGGACAAAGGAAGGAGG - Intronic
954756067 3:52840654-52840676 CCAGGGAGGGCAAATGAAGAAGG - Intronic
954759115 3:52861248-52861270 AGAGAGAGGGGAGAAGGGGAAGG + Intronic
954874298 3:53791327-53791349 TGAGAGAGAGCAAAGGAGGGGGG + Intronic
954940939 3:54372568-54372590 AGACAGAGAGCTAATGAAGAAGG - Intronic
954970651 3:54649142-54649164 GGAGAGAGGGAAAAGGAGAAAGG - Intronic
954988946 3:54821704-54821726 AGAGAGAGAGGAAAGAAGGAAGG - Intronic
955134337 3:56201002-56201024 AGAGGGAGGTCACATGAGTAAGG - Intronic
955238678 3:57161819-57161841 AGAGCCAGTGTAAATGAGGATGG + Intronic
955353351 3:58210093-58210115 AGAGGGAGGGATGATGAGGATGG + Intronic
955446379 3:59015456-59015478 AGAAAGAGGGAAAAGGATGAGGG + Intronic
955469721 3:59273826-59273848 AGACAGAGGTCAAATCTGGAGGG + Intergenic
955717748 3:61848226-61848248 AGAGAGAGTGCAAACATGGAGGG - Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
955914782 3:63895724-63895746 AGAGAGAGAGAAAAGGAGAAAGG - Intronic
955947547 3:64209844-64209866 AGAAAGAGAGGAACTGAGGATGG + Intronic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
956812572 3:72878420-72878442 AGAGAGAAGGAAAATGATGTAGG - Intergenic
956846513 3:73188737-73188759 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956850999 3:73228113-73228135 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956873735 3:73442266-73442288 AGACAGAGGGGAAGTGGGGAGGG + Intronic
956998188 3:74851937-74851959 AGAGAGAGAGCGAAAGAGCAAGG - Intergenic
957051427 3:75415190-75415212 GGAGAGAAGGCAGCTGAGGATGG - Intergenic
957361440 3:79164524-79164546 ATAAAGCAGGCAAATGAGGATGG - Intronic
957550197 3:81694466-81694488 CAAGAGTGGGCAAAGGAGGAGGG + Intronic
957566933 3:81896197-81896219 AGAGAGAGGGCAAATCTGGAAGG + Intergenic
957578755 3:82043505-82043527 AGAGAGAGTGAGAATGAGAATGG + Intergenic
957587949 3:82156945-82156967 AGAGAGAGACAAAAGGAGGAAGG - Intergenic
957756487 3:84494790-84494812 AGAGAGAGGGAGAAAGAGAAAGG - Intergenic
957966908 3:87333680-87333702 AGAGAAAGGGAACAAGAGGAAGG - Intergenic
958536825 3:95414758-95414780 AGAGAAAGAAGAAATGAGGAAGG + Intergenic
958556113 3:95679034-95679056 AGAGAGAGAGGAAGAGAGGAAGG + Intergenic
958557891 3:95703757-95703779 AGAGTGAGGGTAAGTGAGGGTGG + Intergenic
958790457 3:98645286-98645308 ACAGTGTGGGCAGATGAGGAGGG - Intergenic
959187738 3:103068096-103068118 AGAGAGAGGGGAAGGAAGGAAGG + Intergenic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959418858 3:106109672-106109694 AGAGAGAAAGAAAAAGAGGAAGG - Intergenic
960135210 3:114097761-114097783 AGAGAGAGAGGAAGGGAGGAAGG - Intergenic
960203824 3:114870874-114870896 AGAGACAGGAAAAATGAGGAGGG - Intronic
960418706 3:117416425-117416447 AGTGAGGATGCAAATGAGGAGGG - Intergenic
960511471 3:118554447-118554469 AGAGAATGGACAAATGAGTATGG - Intergenic
961060009 3:123820702-123820724 AGAGAGAGAGGAAAGAAGGAAGG - Intronic
961172676 3:124809306-124809328 AGAGAGAAGGGAAAGGATGAGGG - Intronic
961303054 3:125934404-125934426 GGAGAGAAGGCAGCTGAGGAGGG + Intronic
961445689 3:126980251-126980273 AGAGATGGGGAAAATGAGGGAGG + Intergenic
961449037 3:126994241-126994263 AGAGAGGGGGTCACTGAGGAAGG - Intronic
961473100 3:127130254-127130276 AGAGAGAGAGAAAGTGAGAAGGG - Intergenic
961708778 3:128810588-128810610 AGAGAGAGGACACATGAGCAAGG + Intronic
961892803 3:130144625-130144647 AGAGAGAGGACAAGTGATGGAGG - Intergenic
962297284 3:134202382-134202404 AGAGAAAGGGAGAATGATGAAGG + Intronic
962385986 3:134933173-134933195 AGAGAGAGGAGAAAAAAGGATGG - Intronic
962507320 3:136061169-136061191 AGAGAGAGAGAAAAAGAAGATGG + Intronic
962801959 3:138898102-138898124 CGAGAGAGGGAAACTAAGGAAGG + Intergenic
962973131 3:140423798-140423820 GGAGAGAGGGGAAAAGGGGAAGG - Intronic
963103419 3:141625652-141625674 AGAGTGTGGGGAAATGAGGGTGG - Intergenic
963125288 3:141810378-141810400 AGAGAGAGGGAGAGAGAGGAAGG - Intronic
963179246 3:142336606-142336628 AGAGAGAGAGGAAAAGAGAAGGG + Intronic
963316572 3:143765185-143765207 AGAGAGAGAGAAAGGGAGGAAGG - Intronic
963429552 3:145181222-145181244 AGTGAGGGGGGAAATGAGGTAGG - Intergenic
963667161 3:148202614-148202636 TCCCAGAGGGCAAATGAGGAAGG - Intergenic
963781024 3:149486840-149486862 ATAATGAGGGCCAATGAGGAGGG + Intronic
963783546 3:149510610-149510632 AGAGGGAGGGAAAAGAAGGAAGG - Intergenic
964233257 3:154495482-154495504 AGGGAGAGGAGAAATGAGAACGG - Intergenic
964306161 3:155342558-155342580 AGAGAGAGGGTAGAGGAGGAGGG + Intergenic
964372684 3:156017552-156017574 AGAGAGATCACAAATGAGGGAGG + Intergenic
964646246 3:158961061-158961083 AGAGAGAGAGAAAGGGAGGATGG - Intergenic
965034508 3:163421025-163421047 AGAGAGAGGGGTAAAGAGGTAGG - Intergenic
965123574 3:164595297-164595319 AGAGAGTGAGCAAGTGAGCATGG + Intergenic
965864885 3:173194469-173194491 ATAGGGAGGGCAACTAAGGAAGG + Intergenic
966206212 3:177409310-177409332 AGAGAGAGGGCAAACAAAAAAGG - Intergenic
966211022 3:177453675-177453697 AGAGAGAGAGGAAGAGAGGAAGG - Intergenic
966427695 3:179797929-179797951 TGATTCAGGGCAAATGAGGAAGG + Exonic
966633930 3:182110770-182110792 AGAAAGAAGGCAAATGTGGCTGG - Intergenic
966782646 3:183597108-183597130 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
967174213 3:186848188-186848210 AGAGAGAGAGAAAAGAAGGAAGG + Intronic
967175344 3:186857957-186857979 AGAGAGAAAGAAAAGGAGGAAGG - Exonic
967314871 3:188142742-188142764 AGAGAGAGGGAAAGAAAGGAAGG + Intergenic
967344058 3:188433761-188433783 AGAGAGAAGGAAAAGAAGGAAGG + Intronic
968123415 3:196142055-196142077 AGAGAGAGAGGAAAGAAGGAAGG + Intergenic
968427245 4:532160-532182 AGGGACTGGGCAAATGTGGAGGG - Intronic
968837222 4:2973894-2973916 TGAGAGAGGGCGGATGAGGTTGG - Intronic
968994207 4:3935569-3935591 GGAGAGAAGGCAGCTGAGGATGG - Intergenic
969089832 4:4685422-4685444 AGGGAGAGGGCAAAGGAGGATGG + Intergenic
969118223 4:4887788-4887810 AGAGAGGTGGCTCATGAGGACGG + Intergenic
969163381 4:5281099-5281121 AGAGAGAGGGCAAAGGGGGAAGG + Intronic
969597903 4:8159246-8159268 ACAGAGAGGGAAACTGAGGCGGG + Intergenic
969711332 4:8845918-8845940 AGAGAGAGGGGAAAAGGGAAGGG + Intergenic
969819723 4:9710667-9710689 GGAGAGAAGGCAGCTGAGGATGG + Intergenic
970153446 4:13116465-13116487 AGAGAGAAAGTAAAGGAGGAAGG + Intergenic
970224560 4:13844131-13844153 AGAGAGATGGGAATGGAGGAAGG - Intergenic
970563617 4:17308965-17308987 AGAAAGAGGGTCAATGAGGCTGG - Intergenic
970768581 4:19582331-19582353 AAAGAATGGGAAAATGAGGAAGG - Intergenic
970807836 4:20056682-20056704 AGAGAGAGAGCAAGAGAGGTAGG + Intergenic
971166176 4:24186160-24186182 AGAGGGTGGGCAAAAGAAGAGGG + Intergenic
971548181 4:27914064-27914086 AGAGAGAGAGAAAAAGAGAAAGG - Intergenic
971971585 4:33627462-33627484 AGAGAGATGGAATATGAAGAGGG - Intergenic
972096002 4:35348116-35348138 AGAGAGAGAGCAAGTGAGCGTGG + Intergenic
972129333 4:35810314-35810336 AGGAAGAGGGGAAAGGAGGAGGG + Intergenic
972134057 4:35869718-35869740 AGAGAAAGGGCAAGAGAGGCAGG + Intergenic
972342211 4:38162352-38162374 AGAGGGAGGGGAAAGGAAGAGGG - Intergenic
972378952 4:38500983-38501005 AGAAAAAGGGCAAAAAAGGAAGG - Intergenic
972687688 4:41367008-41367030 AGAGAGAGAGCAAGCGAAGAGGG + Intronic
972755226 4:42039764-42039786 AGATAGAGGGAAAAAGGGGAAGG - Intronic
972771123 4:42197904-42197926 AGAGAGAAGGAAGAGGAGGAAGG + Intergenic
973320377 4:48804231-48804253 AGAGAGAGAGAGAAAGAGGATGG - Intergenic
973858658 4:55039034-55039056 AAAGAGAGGCTATATGAGGAAGG - Intergenic
974131184 4:57757840-57757862 AGAGAGAGAGCAAATAGAGAGGG + Intergenic
974136801 4:57828197-57828219 AGAGAGAGGGGGAAGGAGTAAGG + Intergenic
974291364 4:59935729-59935751 AGAGAGAGTAAAAATGAGGATGG + Intergenic
975101652 4:70520988-70521010 TGAGGGAGGGGAAATGAGGTAGG + Intronic
975269997 4:72420246-72420268 AGAGAGTGAGCAGATGAGGCCGG - Intronic
975454294 4:74572058-74572080 AGAGAGATGACAAAAGAAGAAGG + Intergenic
975757006 4:77580830-77580852 AGGGAGAGGGGAAAGGAGGAGGG - Intronic
975787466 4:77907515-77907537 AGAGAGAGAGGGAAGGAGGAAGG - Intronic
975997070 4:80328134-80328156 AGAGAACAGGGAAATGAGGAAGG + Intronic
976349096 4:84040282-84040304 AGAGACAGGGCAGATGGGGAGGG - Intergenic
976688010 4:87837399-87837421 ACACAGAGGGCAAATGAGCTTGG + Intronic
976920276 4:90432566-90432588 AGAGAGAGAGGAAAGAAGGAAGG - Intronic
977371826 4:96147057-96147079 AGAGAGGGGGAAAAAGAGGTTGG - Intergenic
977565601 4:98577404-98577426 TGGGAGAAGGCAAATGATGAGGG - Intronic
977752710 4:100628372-100628394 AGAGAGTGGGAAAATCAAGAGGG - Intronic
977917874 4:102613907-102613929 AGAGAGGAGGCAAAGGAAGAAGG - Intronic
977919223 4:102625198-102625220 AGAGAAAGGGAGAAAGAGGAAGG - Intergenic
978270178 4:106879083-106879105 GGAGAAAGGGAAAATGGGGAAGG + Intergenic
978310284 4:107379744-107379766 GGAGAGAGGGGAAAAGGGGAAGG - Intergenic
978311423 4:107388272-107388294 GGAGAGAGGGGAAAAGGGGAAGG - Intergenic
978400982 4:108330393-108330415 TAAGAAAGGGCAAACGAGGAAGG - Intergenic
978404891 4:108368729-108368751 AGGGAGGGGGCACATGAGGTGGG + Intergenic
978471118 4:109068467-109068489 AGAGAGAGAGCAAAATCGGAGGG + Intronic
978497668 4:109377570-109377592 AGTGAGAGAGGAAATCAGGAAGG + Intergenic
978752321 4:112264071-112264093 AGAGAGAGGGAAAAAAATGAAGG - Intronic
979483651 4:121246834-121246856 AGAGAGAGGGCAAGGGAGTGTGG + Intergenic
980096331 4:128495024-128495046 AGAGAGAGCGAAAAGAAGGAAGG - Intergenic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
980643938 4:135617259-135617281 AGGCAGATGTCAAATGAGGAAGG - Intergenic
980773485 4:137409348-137409370 AGAGAAAGAGCAAAAGAGGAGGG + Intergenic
981358812 4:143823907-143823929 AGAAAGAGCTCAAATCAGGATGG + Intergenic
981809291 4:148755221-148755243 AGAGAGAGAGAAAGGGAGGAGGG - Intergenic
981840299 4:149103886-149103908 AGAGAAAGGGGAAGTGAGGATGG - Intergenic
981921621 4:150090952-150090974 AGAGACAAGGCAAATGAGTATGG + Intronic
982314485 4:154018315-154018337 AGAGAGAGAGAAAATGACAATGG + Intergenic
982451860 4:155562328-155562350 AGAAAGATGGCACATGAGTAGGG + Intergenic
982797393 4:159662883-159662905 GGAGAGAGGGAGAATGAGGTGGG + Intergenic
982856771 4:160392592-160392614 AGATATGGGGCAAAAGAGGAAGG + Intergenic
982905408 4:161063147-161063169 AAGGAGAGGGTAAAAGAGGAAGG - Intergenic
982967346 4:161929127-161929149 AGAGAGAGAGCAACAGAGGGAGG - Intronic
984022069 4:174497870-174497892 AGAGAGAGAGAAAGTGAGGCCGG - Intronic
984682700 4:182628548-182628570 AGAGAGAGAGCAAAAGAGACAGG + Intronic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
984959763 4:185085161-185085183 AGAAAGAGAGCAAAAGAGAAAGG - Intergenic
985180734 4:187258779-187258801 AGAGAGAAGGCACAGGAGGGTGG - Intergenic
985222752 4:187725642-187725664 AGAGAGAGGGAAAACGAGGCTGG - Intergenic
985230283 4:187808838-187808860 AGAGAGAGAGGAAAGAAGGAAGG + Intergenic
985440601 4:189980647-189980669 AGAGTGAGGGCCACTGAGGGGGG + Intergenic
985470326 5:38203-38225 AGACAGGGTGCAAATGAGGTGGG - Intergenic
985519172 5:363261-363283 AGAGAGCTGGCACATGAGGCTGG + Intronic
985721261 5:1490440-1490462 GGAGAGAAGGCCAATGATGAAGG + Intronic
986022019 5:3813049-3813071 AGAGAGGAGGCAGAGGAGGATGG + Intergenic
986279749 5:6313772-6313794 AGAGGGAGGACAAATGATGTGGG - Intergenic
986279770 5:6313833-6313855 AGAGGGAGGACAAATGATGTGGG - Intergenic
986286273 5:6361244-6361266 AGAGGGAGGGCAAAGGCCGACGG - Intergenic
986478342 5:8158947-8158969 ACAGAAAGGGAAAATGAAGAAGG - Intergenic
986691494 5:10317298-10317320 AGAGAGAGAGGAAGGGAGGAAGG - Intergenic
986691504 5:10317361-10317383 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
986695832 5:10353819-10353841 AGAGGGAGGGGAGAGGAGGAGGG - Exonic
986889820 5:12288747-12288769 AGAAAGAGAAGAAATGAGGAAGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987266026 5:16255907-16255929 AGAGAGAGAGCAAAGGGAGAAGG + Intergenic
987723821 5:21671571-21671593 AGAGAGAGTGAAAGAGAGGAAGG + Intergenic
988093697 5:26574533-26574555 AGAGAGAGGGCAGTTGGGCAAGG + Intergenic
988354350 5:30153276-30153298 TGAAAGAAGGCAAATGAGTATGG + Intergenic
988445441 5:31281306-31281328 AGAGAGAGGGAGAAAGAGAAAGG + Intronic
988500625 5:31780774-31780796 AGTGAGAGGGAAAATGAGATTGG - Intronic
988705544 5:33722979-33723001 AGAGAGAGTGGGTATGAGGATGG + Intronic
988783878 5:34548266-34548288 AAAAAAAGGGCAAATCAGGAGGG + Intergenic
988801209 5:34698179-34698201 AGAGGGAGGGGAAGGGAGGAGGG - Intronic
989110925 5:37905978-37906000 AGAGAGTGGGAAAATGAAGTAGG - Intergenic
990534369 5:56705390-56705412 AGAGAGTGGGAAAGTGAGCAGGG - Intergenic
990563094 5:57003264-57003286 AGAGAGAGAGAAAACCAGGAGGG + Intergenic
990721875 5:58705722-58705744 AGAGAGAGTGCAAGTGGGTAGGG - Intronic
990746045 5:58960237-58960259 ACAGAGAGGTCAAAAGAGGCTGG - Intergenic
990846014 5:60140518-60140540 AAAGAGAGAGAAAAGGAGGAAGG + Intronic
991127947 5:63088678-63088700 AGAGAGGGGGAAAAGGAGGTAGG - Intergenic
991185267 5:63799441-63799463 AGAGAGAGAGAACATGAAGAGGG - Intergenic
991420198 5:66432964-66432986 AGAGAGAGAGCTAAGGGGGAAGG + Intergenic
991978546 5:72207935-72207957 AGAGAGAGAGAAAGTGAGGAGGG - Exonic
991985722 5:72284481-72284503 AGAGAGATGGAAAAAGAGAAGGG + Intronic
992017929 5:72594668-72594690 AGGGAGTGAGGAAATGAGGAAGG - Intergenic
992199127 5:74367146-74367168 AGAGTGAGGGCAGAGGAGGTGGG - Intergenic
992217870 5:74543509-74543531 GTAGAGAGGGCAAATTAGAAGGG - Intergenic
992491087 5:77245573-77245595 AGAGAAAGAGGAAATGAGGCAGG - Intronic
992502699 5:77357790-77357812 AGAGAGAAGGCAAAAGAGGGAGG - Intronic
992850211 5:80799242-80799264 AGAAAGAGGGAAAATGAAGCTGG - Intronic
992950160 5:81850761-81850783 TGAGAGAGGCCAAATGAGCCCGG + Intergenic
993427398 5:87784898-87784920 AGACAGAGGGAAAAGGAGGAAGG + Intergenic
993900760 5:93582958-93582980 AGAAAGAAAGCAAAAGAGGAGGG + Intergenic
994162704 5:96574351-96574373 AGAAAGTGGGCAAATGAGGCCGG - Intronic
994864881 5:105255065-105255087 AGGGAGAGGGGAAAGGAGGGAGG + Intergenic
995157936 5:108938000-108938022 AGAGATAGGGAAAAAAAGGAGGG - Intronic
995278719 5:110308296-110308318 AGAGAGAGGGAAAAGAAAGATGG - Intronic
995441483 5:112197219-112197241 AGAGACTGGGCAGATGAGGGGGG - Intronic
995451279 5:112303865-112303887 TAAGGGAGGGCAAAGGAGGAGGG + Intronic
996279079 5:121705595-121705617 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
996661387 5:126007785-126007807 AGAGAGAGATCAAAGGATGAGGG - Intergenic
997387670 5:133486396-133486418 AGAGAGACGGCAGAGGAGGGGGG + Intronic
997486325 5:134234009-134234031 CAGAAGAGGGCAAATGAGGATGG - Intergenic
997653935 5:135541813-135541835 AGAGAGGGGGGAAACGAGGCAGG + Intergenic
998383412 5:141742093-141742115 AGAGAGAAGGGAAAGAAGGAAGG - Intergenic
998654077 5:144155490-144155512 AGACTGACGGCAAATGAGGCAGG - Intergenic
998668409 5:144325476-144325498 GGGGAGAGGGCAAGTGAGGAAGG - Intronic
998744146 5:145237724-145237746 AGTGTGATGGCAAATGAGGCTGG + Intergenic
998769164 5:145522450-145522472 AGAGAGAGAGAAAATGAGAGAGG + Intronic
998872063 5:146562143-146562165 GGAGTGAGGGAAACTGAGGATGG + Intergenic
998919207 5:147049271-147049293 AGAAAGAAGGAAATTGAGGATGG + Intronic
998996967 5:147876468-147876490 AGAGAGAGAGAAAAGGAGAAGGG - Intronic
999065660 5:148683119-148683141 AGAGAGGGGGAGAATGAGGGGGG + Intergenic
999748383 5:154608954-154608976 AGGGCAAGAGCAAATGAGGAGGG - Intergenic
999885940 5:155922811-155922833 AGAAAGAGGGCATTTGAGGTTGG + Intronic
1000774703 5:165404901-165404923 AGAGAGAGAGGAAGGGAGGAAGG + Intergenic
1000778904 5:165454732-165454754 AGAGAGAGGGAAAATTAGCCTGG + Intergenic
1001305092 5:170566658-170566680 AGAGAGTGGGCCAGTGAGGAAGG + Intronic
1001518023 5:172370477-172370499 AGAGAGCCAGGAAATGAGGAGGG + Intronic
1001635207 5:173205034-173205056 AGAGAGAAGGCAAACAAGCAGGG - Intergenic
1001989055 5:176100878-176100900 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1001989674 5:176105890-176105912 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1001989984 5:176108436-176108458 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1002226886 5:177729702-177729724 AGAGGGAAGGCAAATGGTGAAGG + Intronic
1002227196 5:177732247-177732269 AGAGGGAAGGCAAATGGTGAAGG + Intronic
1002266948 5:178041524-178041546 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1002794409 6:460005-460027 AGAAAGAGGGCAAAAGAGAAAGG - Intergenic
1003737770 6:8896814-8896836 AGAGAGAGGAAAAAAGAGGAAGG - Intergenic
1003901052 6:10655923-10655945 AGAGAGAGGGGAAGCGAGGAGGG - Intergenic
1004002047 6:11604815-11604837 AGAGGGAGGGGAGAGGAGGAGGG + Intergenic
1004149123 6:13098329-13098351 AGAGAGAAGGAAAAACAGGAAGG - Intronic
1004251582 6:14027010-14027032 AGAGGCAGGGGAAATGAGGCAGG + Intergenic
1004436016 6:15594975-15594997 AGTGAGTGTGCAATTGAGGAGGG + Intronic
1004456474 6:15796347-15796369 AGAGTGGCGGGAAATGAGGATGG + Intergenic
1004582706 6:16969939-16969961 AGAGAGAGGGGAAGGAAGGAAGG + Intergenic
1004858924 6:19781318-19781340 ACAGAAAGGGAAAATGAGGCCGG - Intergenic
1004908033 6:20255369-20255391 AGAGATCGGCCAAATCAGGAAGG - Intergenic
1005149821 6:22736014-22736036 AGAAAGAGAGGAAAAGAGGAAGG - Intergenic
1005373183 6:25155793-25155815 ACAGAGAGAGAAAATCAGGAAGG + Intergenic
1005888153 6:30112954-30112976 AGAGAGAGAGGAAAAGAAGAGGG + Intronic
1005898215 6:30196060-30196082 AGAGATAGGGTAACTGGGGAAGG - Intronic
1006012623 6:31055304-31055326 AGAGAGAGGGAAAGGAAGGAAGG + Intergenic
1006110660 6:31742974-31742996 GGATAGAGGGAAAATGGGGAAGG + Intronic
1006123550 6:31822377-31822399 AGAAAGAGGGGAAAGGAGGGGGG - Intergenic
1006145511 6:31956915-31956937 AGTGACAGGGGAAATGGGGATGG - Intronic
1006459607 6:34150715-34150737 AGAGGGAGGGAATATGAGAAAGG + Intronic
1006562985 6:34929796-34929818 AGAGAGAGAGAGAAGGAGGAAGG - Intronic
1006705873 6:36020665-36020687 AAAGATAGAGTAAATGAGGATGG + Intronic
1006754495 6:36403507-36403529 GGAGAGAGGGCAGGTGTGGAAGG + Intronic
1006937834 6:37730695-37730717 TGAGAGAGGGGGACTGAGGAAGG + Intergenic
1007122429 6:39394426-39394448 AGGGATAGGGGAAATAAGGAGGG + Intronic
1007496057 6:42260948-42260970 AGAGAGTGGGGAAAGGAGGAGGG + Intronic
1007649303 6:43408121-43408143 AGAAGAAGGGCAACTGAGGAAGG - Intergenic
1007951489 6:45876515-45876537 AGAGAGAGAGAAAAAAAGGAGGG - Intergenic
1008035402 6:46740037-46740059 GGAGAGAGGGAAGAGGAGGAAGG + Intergenic
1008094088 6:47321160-47321182 AGTGAAAGGGCAAAGGAGGGTGG - Intergenic
1008432710 6:51437637-51437659 AGATAGAGGACAAATGATGTTGG + Intergenic
1008637298 6:53423771-53423793 AGAGAGAGAGAAAGAGAGGAAGG - Intergenic
1008856588 6:56095550-56095572 AGATAGAGGCCAAACCAGGAAGG - Intronic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1010579382 6:77575308-77575330 AGAGAGATGGGAAGTGTGGATGG - Intergenic
1010993259 6:82503863-82503885 AAAGAGAGAGCAGATGAGTATGG + Intergenic
1011009680 6:82689711-82689733 AGAGAGAGGGGAAGGAAGGAAGG + Intergenic
1011101518 6:83727917-83727939 GGTGAGAGGGCAGAAGAGGATGG - Intergenic
1011134273 6:84082952-84082974 GGAGAGAGGGGAAAAGGGGAAGG - Intronic
1011280302 6:85670833-85670855 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
1011383974 6:86773644-86773666 AGAAGAAGGGCCAATGAGGAGGG + Intergenic
1011402917 6:86983521-86983543 TGAGAAAGGGGAAATGACGAGGG + Intronic
1011584215 6:88907374-88907396 AGAGAGAGGGCATGTGAAGGAGG - Intronic
1011584220 6:88907434-88907456 AGAGAGAGGGCATGTGAAGGAGG - Intronic
1012031876 6:94080188-94080210 AGAGAGAAGTCAAATTAGGTTGG + Intergenic
1012260234 6:97080255-97080277 AGAGAAAGGGACAATCAGGAAGG + Intronic
1012839101 6:104306899-104306921 AGAAAGATGGCAGATGAGTAAGG - Intergenic
1013542913 6:111129248-111129270 AGAAAGTGGGCAAAGAAGGAAGG + Intronic
1013721854 6:113039902-113039924 AGAGAGAGAGCATGTGAAGAGGG + Intergenic
1013766302 6:113578047-113578069 AGAGAGAGAGAAAAGGAGGGAGG - Intergenic
1014115736 6:117665956-117665978 AGAGAAAAGGCAAATGAGATAGG - Intergenic
1014115853 6:117667935-117667957 AGAGAGAAGGCAAATGAGATAGG + Intergenic
1014148711 6:118028486-118028508 ATATACAGGGCAAATTAGGAAGG + Intronic
1014234262 6:118937146-118937168 AGAGAGAGGGAGAATGAGTGAGG - Intergenic
1014724003 6:124954260-124954282 AGAGAGAGGAGAAGGGAGGAAGG - Intergenic
1014849187 6:126320108-126320130 AGAGAGAGGAGAAAGGCGGACGG - Intergenic
1014911784 6:127103629-127103651 AGAGAGAGATCAAATCAGAATGG - Intergenic
1014942624 6:127460968-127460990 TGAGAGAGGGAAAGGGAGGAGGG + Intronic
1014993645 6:128114285-128114307 AGAGAGAGAGCAAGTGAGCGGGG + Intronic
1015021220 6:128478282-128478304 AGTGAGAAGGCAAAAAAGGAAGG - Intronic
1015030947 6:128595207-128595229 AGTGAGTGGGGAAATGAAGACGG + Intergenic
1015366468 6:132401824-132401846 AGGCAGAGGGAAAAGGAGGAGGG + Intergenic
1015526051 6:134175895-134175917 AGAAAGAGGGAAAAGGGGGAGGG + Intronic
1015820139 6:137252311-137252333 AGAGTGAGAGGAAAGGAGGAAGG - Intergenic
1015900758 6:138063301-138063323 AGAGAGAGGGGAAGGAAGGAAGG + Intergenic
1015987495 6:138899177-138899199 AGAGGGAGGGAAAAAAAGGAGGG + Intronic
1016154850 6:140792733-140792755 AGAGTTAGGGGAAATGTGGAAGG + Intergenic
1016227558 6:141758579-141758601 AGAGAGAGAGGAAATGAGAGAGG - Intergenic
1016248213 6:142013252-142013274 AGAGAGAGAGAAAAAGAGGGAGG - Intergenic
1017630640 6:156393172-156393194 AGGGAGAGGCCAAATCACGAAGG - Intergenic
1018457982 6:163969845-163969867 AGCAAGGGAGCAAATGAGGAGGG - Intergenic
1018651750 6:165998316-165998338 AGAGAGAAAGCAAAGAAGGAAGG + Intergenic
1018797270 6:167196270-167196292 TGAGAGAGGGCAGGTGGGGAGGG - Intronic
1018819027 6:167358494-167358516 TGAGAGAGGGCAGGTGGGGAGGG + Intronic
1018859567 6:167701010-167701032 AGAGAGAGAGAAAAGGAAGAAGG + Intergenic
1018972062 6:168536666-168536688 GGAGAGAGGGGAGATGAGGTGGG + Intronic
1019114194 6:169744286-169744308 AGAGAGAGGGGAAGAGAGAAAGG + Intronic
1019293678 7:262704-262726 AGAGAGTGGACGAACGAGGAGGG + Intergenic
1019433458 7:1010319-1010341 ACAGACAGGTCACATGAGGATGG + Intronic
1019486155 7:1290290-1290312 GGAGAGAGGGCAGGAGAGGAGGG + Intergenic
1019830325 7:3321824-3321846 AGAGAGAGAGAAAAGGAGGAAGG - Intronic
1020002104 7:4761990-4762012 AGAGACAGGGCAGATGAGGTGGG + Intronic
1020181767 7:5928150-5928172 AGAGAGAGAGCAGCTGGGGAAGG + Intronic
1020291787 7:6728304-6728326 AGAGAGAGAGGAAGGGAGGAAGG - Intergenic
1020495391 7:8845456-8845478 AGACAGAGAGCAAAAGAGGGAGG - Intergenic
1020777571 7:12473744-12473766 AGAAAGAGGACGAATGAGCAGGG - Intergenic
1020809399 7:12833178-12833200 AGAGAGAGAGCAAAGGCGGAAGG + Intergenic
1021889578 7:25174177-25174199 AGAGAGAGGGGGAAAGAGAAAGG - Intronic
1022096966 7:27147261-27147283 AGGGAGAGGGGAAAGGAGGCAGG - Intronic
1022340835 7:29466213-29466235 AGAGAGAGAGGAAGAGAGGAAGG + Intronic
1022355644 7:29612062-29612084 AGAGATGGGGAAAATGTGGAGGG + Intergenic
1022370866 7:29770117-29770139 AGGGAGAGGGAAAAGAAGGAGGG - Intergenic
1022749103 7:33204572-33204594 AGAGAGAGGGCCATGGAGAAAGG + Intronic
1022858261 7:34338678-34338700 AGAGAGAGAGCGAAGGAGTAGGG + Intergenic
1022905592 7:34852326-34852348 AGAGAGAGAGGAAGGGAGGAAGG + Intronic
1023442720 7:40201157-40201179 AGAGAGAGGGAAAATAAGAAAGG + Intronic
1023734963 7:43226713-43226735 AAAGAGAGTGCAAGGGAGGAGGG + Intronic
1023747556 7:43335736-43335758 AGAAAGAGAGGAAAGGAGGAAGG - Intronic
1023747576 7:43335956-43335978 AGAGAGAGGGAAAGGAAGGAAGG - Intronic
1024153801 7:46599969-46599991 AGAGAGAGGAAAAAGGAGGTAGG + Intergenic
1024176564 7:46846379-46846401 AGAGAGGGGGCAGAGGAAGAGGG - Intergenic
1024270189 7:47635963-47635985 AGACGGAGGGGAAAAGAGGAAGG + Intergenic
1024629698 7:51236868-51236890 AGAGGGAGGGCAGTGGAGGATGG - Intronic
1024728984 7:52233823-52233845 TGAGAGAAGGCAATAGAGGAAGG + Intergenic
1024771184 7:52725082-52725104 AGCGAGAGAAGAAATGAGGAAGG + Intergenic
1024961435 7:54980922-54980944 AGAGAGAGGCATAAGGAGGAAGG + Intergenic
1025116020 7:56258934-56258956 ACAGACAGAGAAAATGAGGAAGG - Intergenic
1025604293 7:63028264-63028286 AGTGTGAGAGAAAATGAGGAAGG + Intergenic
1025746132 7:64244615-64244637 AGAGAAAGGACAATTCAGGATGG + Intronic
1025848060 7:65217936-65217958 AGAGAGAGTGACAATGAGGTGGG - Intergenic
1025898298 7:65723801-65723823 AGAGAGAGTGACAATGAGGTGGG - Intergenic
1025939201 7:66061730-66061752 AGAGAGAGAGCAAGTGAAGGGGG + Intergenic
1026110548 7:67455761-67455783 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1026192236 7:68140086-68140108 AGAGAGAAAGCAAAAGAGGGAGG + Intergenic
1026193346 7:68149738-68149760 AGAGAGATGGAGAATGAGGGTGG + Intergenic
1026200467 7:68210089-68210111 AAAGATAGAGAAAATGAGGAAGG - Intergenic
1026284900 7:68954659-68954681 AGAGAGAGGGAAAAAGAGGGAGG + Intergenic
1026589049 7:71680363-71680385 AGAGAGAGCGCGAGGGAGGAAGG - Intronic
1026638774 7:72106558-72106580 AGGGAGAGAGAAAAAGAGGAAGG + Intronic
1026719454 7:72818105-72818127 AGAGAGGGAGCAAAGGAGTAGGG - Intronic
1026829465 7:73602159-73602181 AGAGAGAGGGAAAGAAAGGAAGG - Intronic
1026837562 7:73648503-73648525 AGAGAGAGGGAAAGAGAGGAAGG - Intergenic
1026961492 7:74410931-74410953 AGAGAAAAGGAAAATGAGGGAGG + Intergenic
1027232530 7:76281048-76281070 AGAGAGAGGGCGAAAGAGCGAGG - Intronic
1027501342 7:78955630-78955652 AGAGAGAGAGAAAAGGAGGGAGG - Intronic
1027545948 7:79527864-79527886 AGAGAGAAGGAAGAAGAGGAGGG - Intergenic
1027833003 7:83204634-83204656 AGAAAGAGAGAAAATTAGGAAGG - Intergenic
1027899433 7:84091323-84091345 AGAGAGAGAGAGAAAGAGGAGGG + Intronic
1027995467 7:85420825-85420847 AGAGAGAGAACAAGAGAGGAAGG - Intergenic
1028411445 7:90534549-90534571 AGAGAGAGAGCAAGTAAGAAAGG + Intronic
1028636791 7:92998010-92998032 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1028696397 7:93717793-93717815 AGAGAGAGGGAGAGAGAGGAAGG + Intronic
1028696987 7:93725609-93725631 AGACTGAGTGGAAATGAGGAGGG - Intronic
1028959876 7:96736646-96736668 GGAGACAGGTCAAATGATGAAGG + Intergenic
1029026323 7:97420741-97420763 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1029106480 7:98180942-98180964 AGAGAGAGAGAGAAAGAGGAGGG + Intronic
1029253817 7:99255453-99255475 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1029473943 7:100771813-100771835 AGAGAGAAGGCAGATGAGCCAGG - Intronic
1029531438 7:101127881-101127903 AGAGAGAGAGGAAAGAAGGAAGG + Intronic
1029546620 7:101213481-101213503 GGAGAGAGAGAATATGAGGAGGG - Intronic
1029625795 7:101719363-101719385 AGAGGGAGGACAGATGGGGAGGG + Intergenic
1030166768 7:106563006-106563028 AGAGAGGGAGGAAAAGAGGAAGG + Intergenic
1030206494 7:106957090-106957112 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1030206502 7:106957141-106957163 AGAGAGAGAGAGGATGAGGAAGG + Intergenic
1031307262 7:120145804-120145826 AGAGAGATGGAAAATGTGGCAGG - Intergenic
1031485413 7:122317386-122317408 TGAGAGAGGGACAATGAGCAAGG + Intergenic
1031517415 7:122718371-122718393 GGAGAGAGGGAAAAGGAGGTAGG + Intronic
1031538843 7:122968057-122968079 AGAGAGAGGGAAAGATAGGAAGG + Intergenic
1031633842 7:124077928-124077950 AGAGAGAGAGCAAGTGAAGTGGG - Intergenic
1031864203 7:127019926-127019948 AGAGAAAGGGCAAAAGAGAAAGG - Intronic
1032201345 7:129825243-129825265 AGAGAGAGGGGAAGGGAGAAAGG - Intergenic
1032380511 7:131474946-131474968 AGAGAGAGTGACAATGAGGGGGG + Intronic
1032410042 7:131688159-131688181 ACACAGAGGGCGGATGAGGAGGG - Intergenic
1032510181 7:132466178-132466200 AGAGAGAGGGCCAGTGTGAAAGG + Intronic
1032536206 7:132666798-132666820 AGAGAGAAGGCAAATGATCTGGG + Intronic
1032540423 7:132698299-132698321 AGAGAGAGAGAAAGAGAGGAGGG + Intronic
1033349707 7:140552326-140552348 AGAGAGAGGGAAAGGAAGGAAGG - Intronic
1033811110 7:145012192-145012214 AGAGAGAAAGCAAGGGAGGAGGG - Intergenic
1034042841 7:147897639-147897661 AGAGAGAGGACAAAGGTAGATGG - Intronic
1034296411 7:149976590-149976612 AGAGAGAGAGAAAATGATGCAGG + Intergenic
1034574016 7:151981625-151981647 AGAGAGAGAGAAAGGGAGGAAGG - Intronic
1035038015 7:155908069-155908091 AGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1035762191 8:2077003-2077025 AGACAGAGAGTAAAAGAGGATGG + Intronic
1035874201 8:3169922-3169944 GGAGAGAGGGGAGAGGAGGAAGG - Intronic
1036124328 8:6049119-6049141 AGAGGTGGGGAAAATGAGGAGGG - Intergenic
1036373038 8:8176856-8176878 AGAGAGAGGACAAGTGATGGAGG + Intergenic
1036381929 8:8241258-8241280 GGAGAGAAGGCAGCTGAGGATGG + Intergenic
1036571285 8:9981878-9981900 CGAGAGAGGGCACAGGAGGCGGG + Intergenic
1036651603 8:10647485-10647507 GGGGAGAGGAGAAATGAGGATGG - Intronic
1036679888 8:10864316-10864338 AGAGAGGGGCCACATGAGGAAGG - Intergenic
1036877867 8:12488785-12488807 AGAGAGAGGACAAGTGATGGAGG - Intergenic
1036998248 8:13685687-13685709 AGAGAGAGAGAAATTGAGCAAGG - Intergenic
1037512680 8:19599574-19599596 AGAGAGAAAGGAAAGGAGGAAGG + Intronic
1037514435 8:19616673-19616695 AGAGAGAGAGAGAATGAGGGGGG - Intronic
1037519558 8:19666884-19666906 AGAGAGAGAGGAAGTGAGGAAGG + Intronic
1037671156 8:21016435-21016457 AGAGACAGGGAAAAGGAGAAAGG - Intergenic
1037783483 8:21887533-21887555 TGAGGGAAGGCAAATGAGAAGGG - Intergenic
1037949443 8:23009175-23009197 AGAGAGAGAGAAAAGAAGGAAGG + Intronic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1038161964 8:25048158-25048180 ATAGAGAGGGAACATGAAGATGG + Intergenic
1038353543 8:26805225-26805247 TGAGAGTGGACAAATGAGGAAGG - Intronic
1039364572 8:36916372-36916394 AGACAGGGAGGAAATGAGGAAGG + Intronic
1040103246 8:43523400-43523422 GGAGAGAGGGGAAAAGGGGAAGG + Intergenic
1040393558 8:46972660-46972682 GGAGAGAGAGGAAATGAGGAAGG - Intergenic
1040729844 8:50430805-50430827 ACAGAGATGGTAAATCAGGATGG + Intronic
1040799091 8:51321613-51321635 AGAGAGAGAGCAAATGGGGGAGG - Intronic
1040885656 8:52260998-52261020 AAAGACAGAGCAAAAGAGGAAGG + Intronic
1041010715 8:53540091-53540113 GGGGAGAGAGGAAATGAGGAAGG + Intergenic
1041257575 8:55992452-55992474 AGGGAAAGGGCAGGTGAGGAAGG - Intronic
1041263924 8:56045670-56045692 AAAAAGAGGGCAAATCTGGAAGG - Intergenic
1041519970 8:58744937-58744959 AGCCAAAGGGCAAATGATGAGGG + Intergenic
1041622978 8:59994930-59994952 ACAGAGAAGGAAAATAAGGAGGG - Intergenic
1041725299 8:61012288-61012310 AGAGAGAGTGCAAAAGAGCTTGG - Intergenic
1041774543 8:61509731-61509753 AGAGGTAGGGGAAAGGAGGAAGG - Intronic
1042119019 8:65464062-65464084 AGAGAGAGGGAAAAAGGGAATGG - Intergenic
1042207676 8:66345427-66345449 AGAGAGAGGCAACAAGAGGAAGG + Intergenic
1042317806 8:67442995-67443017 AAAGAGAGGGAAAAGAAGGATGG - Intronic
1042397797 8:68311806-68311828 AGAGAGAAGGAAGAAGAGGAGGG - Intronic
1042492068 8:69410797-69410819 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1042555816 8:70033116-70033138 AGGGAGAGGAGAAAGGAGGAAGG + Intergenic
1042599269 8:70481995-70482017 AGAGAGAAGGGTAATGTGGAAGG - Intergenic
1042663969 8:71185976-71185998 AGAGGGAGAGGAAAAGAGGAAGG - Intergenic
1042855343 8:73261396-73261418 GGAGAGAGGGCAAACGGTGAGGG + Intergenic
1042982689 8:74548209-74548231 AGACAGAAGGCAAATGAAAAAGG + Intergenic
1043176266 8:77026663-77026685 AGAGAGAGGACAAATGATGGAGG + Intergenic
1043390940 8:79790995-79791017 AGAGAGAGAGAGAATGTGGAAGG + Intergenic
1043781976 8:84347497-84347519 TTAGAGAGGGCAGATTAGGAAGG - Intronic
1043980973 8:86638935-86638957 AGAGAGAAGGAAAGGGAGGAGGG - Intronic
1044214629 8:89594588-89594610 AGAGAGGGAGGAAAAGAGGAAGG + Intergenic
1044647985 8:94464889-94464911 AGAGGGAGAGCAAAAGAGGGAGG + Intronic
1044723076 8:95169205-95169227 AGAGATAGAGCAATTGTGGATGG + Intergenic
1044910472 8:97053361-97053383 AGAGATAGAGTACATGAGGAGGG + Intronic
1045028802 8:98116263-98116285 AGTGAGAGGGCAAGTGGGGTAGG - Intronic
1045218851 8:100176915-100176937 AGAGGGAGAGGAAAGGAGGAGGG - Intronic
1045536064 8:103029256-103029278 AGAGAGAGAGAAAAGAAGGAAGG - Intronic
1046111984 8:109736437-109736459 AGAGAGAGGGCGAGGGAGGGAGG - Intergenic
1046177625 8:110599026-110599048 AGAGAGAGGGAAGATAAGGAGGG - Intergenic
1046180920 8:110646448-110646470 AGAGAGAGGGAGAAAGAGTAAGG + Intergenic
1046224422 8:111259475-111259497 GGAGAGAGGGGAGAGGAGGAAGG + Intergenic
1046717552 8:117584227-117584249 TGAGATAGGACAAATGAGCATGG + Intergenic
1047126059 8:121961900-121961922 AGAGAGAGAGAAAAAGAGGGCGG - Intergenic
1047221432 8:122921657-122921679 AGAGAGAGAGAAAGTGAGGAAGG + Intronic
1047253065 8:123195075-123195097 AATGAGAGAGCAATTGAGGAAGG + Intronic
1047317082 8:123744785-123744807 AGAGAGAGAGTTCATGAGGATGG + Intergenic
1047891727 8:129319348-129319370 AAAGAGAGGACTAATTAGGATGG - Intergenic
1048183641 8:132218871-132218893 GGAGAGAAGGGAAGTGAGGAAGG - Intronic
1048186495 8:132246568-132246590 AGAGAGAGAACAAATGAACAAGG - Intronic
1048514167 8:135090762-135090784 AGAGAGAGAGCAAGAAAGGAAGG - Intergenic
1048575025 8:135683514-135683536 AGAGAGAGGGAGAAAGAGAAGGG + Intergenic
1048720787 8:137321981-137322003 AGAGAGAGAGAAAGAGAGGAAGG + Intergenic
1048748365 8:137642104-137642126 AGAAAGAGGATAAATGAGGAAGG - Intergenic
1048966574 8:139619122-139619144 ACAGAGAGAGCAAGTGAGGAGGG + Intronic
1049210593 8:141384800-141384822 AGGGAGATGGCAACTGTGGATGG + Intergenic
1049829931 8:144693998-144694020 ATAGCGAGGGCAAAGGAGAAAGG + Intergenic
1049924512 9:395491-395513 ACACAGAGGGCAAATGTGGGTGG + Intronic
1050157336 9:2681288-2681310 AGAGGAAGGGCAAATGAGTGGGG + Intergenic
1050579736 9:7040338-7040360 AGAGAGAGAGGGAAAGAGGAAGG - Intronic
1050631886 9:7568406-7568428 AGAGAAAGGGAAAATGTGGTGGG - Intergenic
1050690603 9:8222718-8222740 AGAGAGAGAGAAAGGGAGGAGGG + Intergenic
1050967931 9:11832495-11832517 AGAGAGAGGGGAAGGAAGGAAGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051121488 9:13756903-13756925 AGAAAGAGGGCTGATGAGAAAGG + Intergenic
1051178785 9:14388490-14388512 AGAGAGAGAGAAAGTAAGGAGGG + Intronic
1052303289 9:26976545-26976567 GGAGAGAGGGGAGAGGAGGAAGG + Intronic
1052362911 9:27578923-27578945 AGAGAGAGGGAAAGTGGGGGAGG + Intergenic
1052412893 9:28145665-28145687 AGAGAGAGGGAGAAGGAGGGAGG - Intronic
1052564593 9:30132516-30132538 AGAGAGTGGGCAGATGAAAATGG + Intergenic
1052847387 9:33349294-33349316 ATACAGAGGGCTAAGGAGGATGG + Intronic
1053120292 9:35541249-35541271 AGAGACATGGAAGATGAGGATGG - Intronic
1053437327 9:38084777-38084799 AGAGAAAGGAAAAAAGAGGAAGG - Intergenic
1054897634 9:70331598-70331620 AGAGAGAGGGCCATTTAGGAAGG + Intronic
1055198854 9:73631626-73631648 AGAAAGAGGGCAAATAAAGTAGG - Intergenic
1055375778 9:75647399-75647421 AGAGGGAAGGGAAATGAGGAAGG - Intergenic
1055531193 9:77185674-77185696 CCAGAGAGGGCAAAAGAGGAGGG - Intronic
1055652418 9:78419331-78419353 AGAGAAGTGGCAAAGGAGGATGG + Intergenic
1055708241 9:79031843-79031865 AGAGAGAGAGGAAAGGAGGAGGG + Intergenic
1055731316 9:79281861-79281883 AGAGAGAGAAGAAATGAGAAAGG + Intergenic
1055775988 9:79767632-79767654 TGGGAGAGGGAAAAGGAGGATGG - Intergenic
1055779772 9:79807821-79807843 AGAGAGAGAGAAAAGAAGGAAGG + Intergenic
1055985159 9:82051349-82051371 AGAGAGAATGAAAAAGAGGAGGG - Intergenic
1056197330 9:84240940-84240962 AGAGAGAAGGAAAGTGAGGTTGG + Intergenic
1056225728 9:84493369-84493391 AGACAGAGGCCAGAGGAGGATGG + Intergenic
1056476041 9:86952061-86952083 AGAGAGAGAGCAAAGGAGAGGGG + Intergenic
1056513471 9:87328180-87328202 AGAGGGAAGGGAAATGAGGCAGG + Intergenic
1057054897 9:91952710-91952732 AGAGGGAGAGAAAATGAGCAGGG + Intergenic
1057076350 9:92140194-92140216 GGAGACAGGGCAAAAAAGGAAGG + Intergenic
1057094736 9:92295453-92295475 AGAGAGAGGGGAAAGGGGGAAGG + Intergenic
1057243671 9:93435448-93435470 AGAGAGAGAGAAAAGGAGGTGGG - Intergenic
1057426235 9:94952039-94952061 AGGAAGAAGGCAAATGAGAATGG + Intronic
1057440741 9:95081389-95081411 GGAGAGTGGGGAAATGGGGAAGG - Intronic
1058092570 9:100822158-100822180 ACTGAGAGGGCAAATAAGGATGG - Intergenic
1058180318 9:101790436-101790458 AGAAAAAGGGCAAATGGAGAAGG + Intergenic
1058277035 9:103056160-103056182 AGACAGAGGGGAAATGACGCTGG + Intergenic
1058721924 9:107772287-107772309 AGAGAGAGAGCAAAGGGGGAAGG + Intergenic
1058782306 9:108350549-108350571 AGAGAGGGGGGAAAAGAGGGAGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059367575 9:113798698-113798720 AGAGAGAGCGCAAAGGGGCATGG + Intergenic
1059384168 9:113950988-113951010 AGTGGGAGGGGAAAGGAGGAAGG + Intronic
1059527380 9:115005147-115005169 TGAGAGGGAGCAAATGAGAATGG - Intergenic
1059634160 9:116155311-116155333 AGAGAGAGGGAGGTTGAGGAGGG - Intronic
1059814765 9:117900102-117900124 AGAGAGAGGGAAGAGAAGGAAGG - Intergenic
1059889246 9:118783029-118783051 AGAGAGAGGGCAATTGTAGCAGG + Intergenic
1060546313 9:124462910-124462932 AGAGAGAGAGAAAGTCAGGAAGG - Intronic
1060659506 9:125395993-125396015 GGAGAGTGGGCAAATAAGGAAGG - Intergenic
1060763562 9:126276142-126276164 AGACAAAGGGGAAATGAGGTGGG - Intergenic
1060819769 9:126654624-126654646 AGACAGAGGGCACATGGGGAAGG - Intronic
1061026823 9:128055290-128055312 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1061206603 9:129167506-129167528 AGAGAGAGGGCAAGTGGGAGAGG - Intergenic
1061360424 9:130138460-130138482 AGGGCGAGGGCAGAGGAGGAGGG - Exonic
1061560064 9:131396239-131396261 AGGAAGAGGGCAAGGGAGGAAGG - Intronic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1061849437 9:133405779-133405801 AGGGAGAGGGCACACGTGGAGGG - Exonic
1061894498 9:133640119-133640141 AGAGAGAAAGCCAAGGAGGATGG + Intronic
1062117169 9:134815686-134815708 AGAAAGAGGGGAAATGGGGCTGG - Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062741724 9:138178987-138179009 AGAGTGAGAGCCACTGAGGAGGG - Intergenic
1185554817 X:1012977-1012999 AGAGAGAGGGATACTGGGGAGGG - Intergenic
1185707237 X:2276929-2276951 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707275 X:2277107-2277129 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707292 X:2277196-2277218 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707310 X:2277285-2277307 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707347 X:2277464-2277486 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707481 X:2278085-2278107 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707540 X:2278350-2278372 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707620 X:2278708-2278730 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707792 X:2279503-2279525 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707867 X:2279849-2279871 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185707947 X:2280207-2280229 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185708119 X:2281002-2281024 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185708175 X:2281263-2281285 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185708291 X:2281791-2281813 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185708330 X:2281970-2281992 AGAGGGAGGGCAAACGAGAGAGG + Intronic
1185708407 X:2282324-2282346 AGAGGGAGGGCAAACGAGAAAGG + Intronic
1185820250 X:3196094-3196116 AGAGAGAAGGGAAAGGAAGAAGG + Intergenic
1185954812 X:4478025-4478047 AGAGAGAGAGAGAATGAGGGAGG + Intergenic
1185966846 X:4615135-4615157 AGAGAGAGAGAAAAAGAGAAAGG + Intergenic
1186045494 X:5532466-5532488 AGAGAGAGGACAGAGGAAGAGGG + Intergenic
1186088700 X:6020991-6021013 AGAGAGAGAGAAAAGAAGGAAGG - Intronic
1186156262 X:6729812-6729834 AGAGAGAGGGTAAAAGGGGAAGG - Intergenic
1186206376 X:7204892-7204914 AGAGAGAGAGCGAAGGAGGGAGG - Intergenic
1186367551 X:8911175-8911197 AGAGAGAGAGAAAAGAAGGAAGG + Intergenic
1187220730 X:17323417-17323439 AGAAAGAGGGAAAGAGAGGAAGG - Intergenic
1187413468 X:19071320-19071342 AGAGAGAGGTTAAAAGAGGAGGG - Intronic
1187500096 X:19832534-19832556 GGAGAGAGGGGTAAGGAGGAAGG + Intronic
1187933806 X:24316858-24316880 AAAAAGAGGGAAAAAGAGGAAGG - Intergenic
1188158331 X:26769591-26769613 AGAAATAAGGCAAATGAGGAAGG + Intergenic
1188276277 X:28205566-28205588 AATGAGAGGGAAAATGAGGGAGG - Intergenic
1188455440 X:30359260-30359282 AGAGAGAGAGAAATTGAGGGAGG + Intergenic
1188786853 X:34357144-34357166 GGAGAGAGGGAAAAGGAGAAAGG - Intergenic
1189053356 X:37670274-37670296 AGAGAAATGGCAAAGCAGGAAGG - Intronic
1189155385 X:38751319-38751341 AGAGAGAGAGCATGTGAGAAAGG + Intergenic
1189311950 X:40025489-40025511 AGTGGGTGGGCCAATGAGGAAGG + Intergenic
1189960354 X:46318625-46318647 AGGGAGGGAGCAAAGGAGGAAGG + Intergenic
1189988865 X:46576151-46576173 AGGGAGAGGGGAAATGAGAGAGG - Intronic
1190357157 X:49616662-49616684 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1190359820 X:49638260-49638282 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1190417702 X:50197434-50197456 GGAGAGAGGGGAAAGGAGGAGGG - Intronic
1190586763 X:51952195-51952217 AGAGAGAAGGAAAATGATAAAGG + Intergenic
1191671331 X:63751315-63751337 AGAGAGAAGGCAGAGGAGGAAGG + Intronic
1192093156 X:68182396-68182418 AGAGAGAGGGGAAGGGAGGAAGG + Intronic
1192095669 X:68207975-68207997 AGAAAGAAGGAAAAGGAGGAAGG - Intronic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1192970764 X:76226739-76226761 AAAGAGAGGTCAAATCAGAATGG - Intergenic
1193679822 X:84504530-84504552 AGTGAGAGGGGAAAAGAGGAAGG - Intergenic
1193858343 X:86634102-86634124 AGAGAGAGAGCAAGTGAAGGGGG + Intronic
1194676388 X:96799125-96799147 AGAGAGATGGGAGATCAGGAAGG - Intronic
1195412442 X:104582551-104582573 AGAAAGAGGAGAAAGGAGGAAGG - Intronic
1195516164 X:105778767-105778789 AGGGAGAGGGGAGAGGAGGAGGG - Intergenic
1195521970 X:105841400-105841422 AAAGAGAGGGAAAATGAAGTGGG + Intronic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1197163450 X:123349504-123349526 AGAGAGAAGGCAATTGAATAAGG - Intronic
1197176578 X:123492759-123492781 AGAGTGAGGACAAAAGGGGAGGG - Intergenic
1197207338 X:123801492-123801514 AGAGAGAGGGGAAGGAAGGAAGG + Intergenic
1197728478 X:129792049-129792071 AAAGAATGGGCAAATTAGGAGGG - Intronic
1197801416 X:130353578-130353600 AGAAAGAGGACAAATGATAAAGG - Intronic
1198052273 X:132960655-132960677 AGAGAAAGGGCCAGTGAGGTTGG + Intronic
1198374907 X:136029232-136029254 AGAATGATGGGAAATGAGGATGG + Intronic
1198511731 X:137358836-137358858 AGAGAGATGCAAAATGAAGATGG - Intergenic
1198518791 X:137432173-137432195 AGAGAGAGAGAATATGAGAAAGG + Intergenic
1198558017 X:137816653-137816675 ATAGAGAGAGAAAGTGAGGAGGG - Intergenic
1198683677 X:139205821-139205843 CTACAGAGGGCAGATGAGGAAGG + Intronic
1198885707 X:141333853-141333875 GGAAAGAGGGCACTTGAGGATGG - Intergenic
1198897154 X:141468276-141468298 GGAAAGAGGGCACTTGAGGATGG + Intergenic
1198910255 X:141605716-141605738 AGAGAGAGAGGAAAGAAGGAAGG - Intronic
1199192947 X:144993556-144993578 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
1199598848 X:149528603-149528625 AGAGAGAGAGGAAGGGAGGAAGG - Intronic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1200054056 X:153449524-153449546 AGAGTGAGGGCAGAGCAGGAAGG - Intronic
1200691462 Y:6308691-6308713 AGTGGGAGTGCAAGTGAGGATGG - Intergenic
1201043810 Y:9866025-9866047 AGTGGGAGTGCAAGTGAGGATGG + Intergenic
1201458979 Y:14201541-14201563 AGGGAGAGAGCGAGTGAGGAAGG + Intergenic
1201758560 Y:17515265-17515287 AGAGTGAGAGCCACTGAGGAGGG + Intergenic
1201842995 Y:18390725-18390747 AGAGTGAGAGCCACTGAGGAGGG - Intergenic